Báo cáo khoa học: A L225A substitution in the human tumour suppressor HIC1 abolishes its interaction with the corepressor CtBP docx

... the central invariant Leu225 to Ala in the GLDLSKK motif abolishes the interaction between HIC1 and C-terminal binding protein 1 (CtBP1 ). (A) In mammalian two-hybrid assays, HIC1 mutant L22 5A ... the CtBP N-terminal region. Point mutation of the only invariant residue in the CtBP- interacting domain is sufficient to abolish the HIC1 CtBP interaction Having...

Ngày tải lên: 23/03/2014, 10:21

... A point mutation in the ATP synthase of Rhodobacter capsulatus results in differential contributions of DpH and Du in driving the ATP synthesis reaction Paola Turina and B. Andrea Melandri Department ... the ACMA assay, proton pumping rates in the i nner membranes were also reduced to a similar extent in the mutant. The most striking impairment of ATP synthesis in...

Ngày tải lên: 21/02/2014, 03:20

... restrictions gov- erning the combination of features and values in feature specifications; the definition of the value range of a feature can thus be regarded as another special case of cooccurrence ... specifica- tions; the latter are themselves items consisting of a feature name and a feature value in an ar- rangement. The formal devices already introduced allow...

Ngày tải lên: 22/02/2014, 10:20

... underline). Name Size (nt) Sequence CLL 121 5¢-TCACCATAGGCATCAAGGAATCGCGAATCCGCCTCGTTCCGGCTAAGTAACATGGAGCAG GTCGCG ATTTCGACACAATTTATCAGGCGAGCACCAGATTCAGCAATTAAGCTCTAAGCC- 3¢ GTL 121 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGA TCTGCTCC ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢ GCL ... 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGA TCTGCTCC AT...

Ngày tải lên: 07/03/2014, 12:20

... undemtand what fs being said. [1} The room has a large window, The room has a window facing east. {1} appears to he describing two windows, because there is no device indicating that the window ... a3 ('hepzibah'); bt('tike',exp:='b2',recip:=&apos ;a3 '0staLive); b2('churchy'); cl('give',agnt:='aZ',aff:='...

Ngày tải lên: 24/03/2014, 01:21

... For the detection of the unspliced pgRNA and the SP1 splicing variant of HBV, primers SP1 (tgcccctatcctatcaacac), SP2 (actcccataggaattttccgaaa) and U2 (ttccaatgaggattaaagacag) were used. Quantification ... mutagenesis (Stratagene, La Jolla, CA, USA) using the proofreading DNA polymerase KOD plus (Toyobo, Osaka, Japan). Deletion mutants are indicated by a ‘D’ prefix and substitution...

Ngày tải lên: 28/03/2014, 23:20

... years, to anoxia and diapause, conditions that are invaria- bly accompanied by large increases in intracellular Ca 2+ [3]. Despite intense research on the mammalian PTP since its characterization by ... liver mitochondria (trace e), although with a delay, as explained in [44–46], as compared with its vehicle (tra- ce c). NH 4 OH at 5 mm reduced the ADP–ATP exchange rate, pro...

Ngày tải lên: 29/03/2014, 00:20

... or by another acidic residue in the vicinity, allowing the metal binding even in the absence of these residues. This normally results in a decrease in metal affinity, indicating that the activ- ity ... knowledge of RNase II proteins. To date, there are no structural or mutational data available from any other proteins of the family. The SK4803 strain is par- ticularly int...

Ngày tải lên: 30/03/2014, 15:20

... favored later, the tagger makes a re- pair. They claimed that the tagger’s reanalysis can model the processing difficulty in human s disam- biguating lexical categories when there exists a discrepancy ... to carry out simulations that compare the evolution of probabilities in the tagger with that in a theo- retically more powerful model trained on the same data, such...

Ngày tải lên: 20/02/2014, 11:21

... speaker). A Metalinguistic Information Database (MID), on the other hand, compiles the real-time data provided by metalan- guage analysis of leading-edge research papers, and can be conceptualized ... EMOs facilitate the task of locating them accurately in text. C) EMOs can be further analyzed into 3 distinct components, each with its own properties and lin- guistic realiza...

Ngày tải lên: 20/02/2014, 15:20