show that expanding an ordinary engineering tensor as a linear combination of the nine possible ways to form basis dyads is similar in spirit to expanding an ordinary engineering vector as a linear combination of the laboratory orthonormal basis
Báo cáo khoa học: Nup358, a nucleoporin, functions as a key determinant of the nuclear pore complex structure remodeling during skeletal myogenesis docx
... (5¢-GATCTCCTCTTCAGCTA CCACCGCTTGAGAGACTTACTCTTGATTGTAACGA GGATA-3¢ and 5¢-AGCTTATCCTCGTTACAATCAA GAGTAAGTCTCTCAAGCGGTGGTAGCTGAAGAGG A- 3¢) were annealed and inserted into the BglII and HindIII ... GDP, across the nuclear envelope regulates the binding and release of cargo by transport factors RanGTP is abundant in the nucleus as a result of the activity of RCC1, a guanine nucleotide exchange ... transfected with synthesized siRNAs [nontargeting, 5¢-GCAGCAUCUUUAAUGAAUAdTdT-3¢ and 5¢-AUAAGUAAUUUCUACGACG dTdT-3¢; Nup358, 5¢-CCAGUCACUUACAAUUAAAd TdT-3¢ and 5¢-UUUAAUUGUAAGUGACUGGdTdT-3¢ (siNup358-1),...
- 12
- 454
- 0
Báo cáo khoa học: Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx
... were dried and autoradiographed Competitor DNAs used in EMSA analysis were: NF1 wt, 5¢-TTTTG GATTGAAGCCAATATGATA-3¢; NF1 mut, 5¢-TTTT GGATTGAATAAAATATGATA-3¢; Site-2 wt, 5¢-GCGT CTCACCCTAGTCCTGGTCCTGCTCCAAGGGTTTT ... elements To obtain further proof that NF1 is the Site-2/ Site-3 binding protein, DNase I protection analysis was carried out using purified recombinant human NF1 As anticipated, recombinant NF1 ... by Luciakova et al [13] MALDITOF analysis was performed in reflector mode using a Voyager-DE STR MALDI-TOF mass spectrometer (Applied Biosystems) Internal calibration was performed with autodigested...
- 8
- 426
- 0
Báo cáo khoa học: Identification of mitogen-activated protein⁄extracellular signal-responsive kinase kinase 2 as a novel partner of the scaffolding protein human homolog of disc-large docx
... forward: 5¢-CCGAATTCGAAGAAATCACACTTGAAAGG-3¢, and reverse: 5¢GGATCCCCATCATTCATATACATACTTGT GGGTT-3¢; PDZ3, forward: 5¢CCGAATTCCTTGGAGA TGATGAAATTACAAGGG-3¢, and reverse: 5¢GGATCCA TTCTTCAGGTCGATATTGTGCAAC-3¢ ... from the reticulum to the plasma membrane The interaction of hDlg and various microtubule-associated proteins, such as adenomatous polyposis coli, and the motor proteins kinesin and dynein, has also ... screening and yeast protein extraction The yeast reporter strain AH109 was cotransformed by the Human Aorta MATCHMAKER cDNA Library plasmids (Clontech) and the pGKBT7-PDZ-1-2 vector in accordance...
- 11
- 419
- 0
Báo cáo hóa học: " A DISCRETE FIXED POINT THEOREM OF EILENBERG AS A PARTICULAR CASE OF THE CONTRACTION PRINCIPLE" pptx
... Moreover, there is also a variant of the BCP for self-maps of a non-Archimedean metric space proved by Prieß-Crampe [10] (also see Petalas and Vidalis [9]) It turns out that, in general, the contraction ... Finally, (1.1) is an immediate consequence of the fact that the mapping F is an α-contraction Corollary 3.2 ET is equivalent to BCP∗ , the restriction of the BCP to the class of nonArchimedean bounded ... obtain only some particular cases of the contraction principle via a discrete argument Finally, we discuss a variant of ET given by Rus [11] (cf Remarks 2.1 and 4.3) Proof of Eilenberg’s theorem...
- 6
- 268
- 0
Báo cáo khoa học: Salicylic acid and the hypersensitive response initiate distinct signal transduction pathways in tobacco that converge on the as-1-like element of the PR-1a promoter pot
... NPR1/NIM1 has been identified as a key regulator of SAR in Arabidopsis acting downstream of SA in the SAR signaling pathway [10,11,21], and analysis of npr1 mutant plants has established that efficient ... activator in transgenic plants in response to SA, and that this activity is abolished in the npr1 mutant [31] Taken together, substantial evidence has accumulated suggesting a prominent role for as- 1-type ... expression in plants were integrated into the binary vector pBin19, and Agrobacterium-mediated transformation was employed to introduce gene constructs into the genome of tobacco (Nicotiana tabacum...
- 11
- 452
- 0
báo cáo hóa học: " Quality of life data as prognostic indicators of survival in cancer patients: an overview of the literature from 1982 to 2008" pot
... http://www.hqlo.com/content/7/1/102 indicators: symptomatic history, performance status, weight loss and age Adjusting for stage, histological factors and treatment, the analysis showed that weight loss and performance status ... [http://www.biomedcentral.com/content/supplementary/14777525-7-102-S1.DOC] Acknowledgements The author wishes to thanks Mrs T Rostami and Mrs S Fathian and A Asadi for their secretarial assistance This was a piece of pure academic research work and the author ... loss are independent determinants of overall survival One found that a 40-point increase in the pain subscale of the EORTC QLQ-C30 was associated with a 27% increase in the rate -of- dying hazard...
- 21
- 717
- 1
Báo cáo sinh học: "An NIH intramural percubator as a model of academic-industry partnerships: from the beginning of life through the valley of death" pptx
... scenario may be an important feature of the percubator, particularly in light of today’s usual translational approach: a) academia hands off an application to the private sector only if and when ... translation researchers, helping to ensure that a distinguished past is an equally distinguished future Competing interests MRE-B is a translational researcher who has participated in many laboratory ... percubator [12,13] And as a practical matter, designating percubator investigators and their companies as ‘contractors and contract companies’ would be a simple route to initiating a pilot program in...
- 4
- 395
- 0
báo cáo hóa học:" An NIH intramural percubator as a model of academic-industry partnerships: from the beginning of life through the valley of death" ppt
... scenario may be an important feature of the percubator, particularly in light of today’s usual translational approach: a) academia hands off an application to the private sector only if and when ... translation researchers, helping to ensure that a distinguished past is an equally distinguished future Competing interests MRE-B is a translational researcher who has participated in many laboratory ... percubator [12,13] And as a practical matter, designating percubator investigators and their companies as ‘contractors and contract companies’ would be a simple route to initiating a pilot program in...
- 4
- 417
- 0
Báo cáo y học: "Report of three cases that received maintenance treatment with risperidone as a mood stabilizer" ppsx
... Until today, only olanzapine has received official approval as monotherapy for the maintenance phase of bipolar illness Our data suggest that further research is necessary to investigate the long ... Sanofi-Synthelabo and AstraZeneca to attend several conferences References Soares JC: Recent advances in the treatment of bipolar mania, depression, mixed states and rapid cycling International ... depressive phases of bipolar illness [5] After a year the patient discontinued any medication in an effort to stay pregnant Soon afterwards a new manic episode appeared After restarting medication,...
- 4
- 334
- 0
Báo cáo y học: "Identification of a SmD3 epitope with a single symmetrical dimethylation of an arginine residue as a specific target of a subpopulation of anti-Sm antibodies" ppsx
... (SMP) assay (a) Intra-assay and interassay variability, (b) linearity, and (c) receiver operating characteristic analysis The intra-assay and interassay variability, expressed as coefficient of variation ... based on the general protocol of the Varelisa® tests (Pharmacia Diagnostics) Assay performance characteristics To evaluate the performance of the assay, the precision, reproducibility and linearity ... specificity of the new peptide-based assay (99.8%; data not shown) Further studies are in progress to compare the assay performance of the anti-SMP assay with that of other commercially available anti-Sm...
- 11
- 593
- 0
Báo cáo y học: " Amino acid residues that are important for Hyal2 function as a receptor for jaagsiekte sheep retrovirus" potx
... human Hyal2 is important to confirm these predictions A soluble form of human Hyal2 has been made that can bind tightly to JSRV Env, as measured by surface plasmon resonance analysis, and that ... chimeric, and mutant receptors, analyzed the data, and drafted the manuscript All authors read and approved the final manuscript Additional material Additional File "Hyal2 DNA sequences.fasta" Bovine ... whereas mouse Hyal2 activity is reduced 1,000-fold from that of human Hyal2 We also made a human Hyal2 mutant that contained all three of these mutations, and this mutant had 6% of the activity of...
- 11
- 247
- 0
Realizing an AD+ model as a derived model of a premouse
... ✓ A $ L↵ [S, x] = [S, x] If is an ordinal and A ✓ ! , then A is determined if either of the two players has a winning strategy in the game GA Ordinal determinacy is the statement that for any ... A is determined, if either of the players has a winning strategy AD, or the axiom of determinacy, is the statement that for every A ✓ ! ! , GA is determined In this thesis, R refers to the Baire ... Woodin limit of Woodin cardinals assuming there is a Woodin limit of Woodin cardinals in V Steel [18] showed that the core model exists assuming there is no inner model with a Woodin cardinal...
- 164
- 281
- 0
Báo cáo y học: " Self-reported sickness absence as a risk marker of future disability pension. Prospective findings from the DWECS/DREAM study 1990-2004"
... on data from the Danish Ministry of Employment, the Ministry of Social Affairs and the Ministry of Education DWECS was conducted in 1990, and featured a random sample drawn from the Central Population ... environment variables The Cochran-Armitage trend test was performed in order to test if a gradual increase in sickness absence was associated with increase in risk of disability pension The SAS procedure ... 1990 as a continuous variable showed a clear trend of increase in disability pension risk with increase in absence days/yr A 10-day increase in absence days per annum (scale score ranging from...
- 6
- 578
- 0
An analysis of nouns formed by suffixes in english a case study of the textbook solutions pre intermedite
... morpheme may be defined as the minimal linguistics sign, a grammatical unit that is an arbitrary union of a sound and a meaning and that cannot be further analyzed This definition may be too simple, ... morphemes may be defined as the minimal meaningful language units and it cannot be divided any further into meaningful parts A morpheme has its sound form and meaning but unlike a word, it is not independent ... about an interesting theme It supplies for learners a large of vocabulary and grammar There are many reading texts and basing on these reading texts, learners have the chance to know about the...
- 63
- 988
- 3
Use of an extension of the park's transformation to determine control laws applied to a non sinusoidal permanent magnet synchronous motor
... PROPOSAL OF AN EXTENSION OF THE PARK'S TRANSFORMATION Classical Park's transformation is in fact the succession of two transfomations The torque is then given by: T, = p.(@~,.io+@'did+@'q.iq) For a ... under the form: p is a function of We can verify t a , in the sinusoidal case, ht p=O p depends only of the value of the variations of rotor fluxes, witch can be easily known through a measuring of ... force is so reduce to a two-phase system in the "a- p" kame For a non-sinusoidal machine can be not equal to zero, and then a zero-sequence current can be useful The Conmrdia's transfonnation has...
- 6
- 438
- 2
Tài liệu Interest on Excess Reserves as a Monetary Policy Instrument: The Experience of Foreign Central Banks ppt
... central bank balances are abundant The decrease in the quantity of balances demanded is larger in this case, indicating that the central bank would need to drain a considerably larger quantity of ... policy rate floor These five are the ECB, the Bank of Japan, the Bank of England, the Bank of Canada, and Norges Bank Of the five, the ECB and the Bank of Japan monitor a market rate corresponding ... operating what might be described as a “floor system.” These are the ECB, the Bank of Japan, the Bank of England, the Bank of Canada, and Norges Bank The remaining central banks— the Reserve Bank...
- 49
- 653
- 0
Tài liệu Effect modification of air pollution on Urinary 8-Hydroxy-2’-Deoxyguanosine by genotypes: an application of the multiple testing procedure to identify significant SNP interactions ppt
... with various cancers, cardiovascular diseases and respiratory diseases [62-64] Ahn et al [61] examined variations of 212 SNPs related to vitamin D metabolism and found that all four SNPs of GC ... analyses, visiting the clinic between January 2006 and December 2008 for measurement of urinary 8-OHdG and other covariates (no repeated measurements) 8-hydroxy-2’-deoxyguanosine and plasma analysis ... consumption, smoking status, use of statin medication and season as categorical variables We adjusted for temperature using three-day moving average of apparent temperature with linear and quadratic terms...
- 9
- 772
- 0
Tài liệu THE VALUE OF IMPROVED PUBLIC SERVICES: AN APPLICATION OF THE CHOICE EXPERIMENT METHOD TO ESTIMATE THE VALUE OF IMPROVED WASTEWATER TREATMENT INFRASTRUCTURE IN INDIA docx
... Working Paper 49/2009 MNEs and Export Spillovers: An Analysis of Indian Manufacturing Industries Chiara Franco and Subash Sasidharan * Working Paper 50/2010 Reforming Indirect Taxes in India: ... Direct Investment and Tourism: Empirical Evidence from India Saroja Selvanathan, E .A Selvanathan and Brinda Viswanathan * Working Paper 47/2009 Ecology, Environment and Sustainable Development in Indian ... ensure that the wastewater is treated with secondary treatment and the quality of the water discharged to the river is high They are willing to pay about half as much to increase the treatment capacity...
- 40
- 472
- 1
Comparison of the obstetric anesthesia activity index with total delivery numbers as a single denominator of workload demand in Israeli maternity units doc
... patient-controlled analgesia pumps The OAAI ignores clinical activities other than epidural analgesia and cesarean anesthesia (including anesthesia for retained placenta and complicated vaginal deliveries, antenatal ... Obstetric anesthesia workload demand in Israel has increased due to both an increase in the requests for labor analgesia and a marked increase in the cesarean delivery rate We propose a new workload-driven ... epidural labor analgesia and cesarean delivery The OAAI is a formula composite comprising data taken from the annual numbers of epidurals and cesareans in each institution In this study, these data...
- 14
- 610
- 0
Báo cáo khoa họcRe-engineering the discrimination between the oxidized coenzymes NAD+ and NADP+ in clostridial glutamate dehydrogenase and a thorough reappraisal of the coenzyme specificity of the wild-type enzyme docx
... NADP+ can arise If we assume the use of a commercial NADP+ containing 0.3% NAD+, as in the case of the Roche sample used in this study, then in a steady-state assay, as in the rapid-reaction ... slow and initially linear second phase of increase in absorbance, nally leading to the expected reaction equilibrium in over h Further analysis showed that the burst amplitude with NADP+ was dependent ... (concentrations after mixing) monitored at 340 nm over 250 The increase in absorbance was linear for the rst 3040 min; on this basis, the value for the specic activity was calculated as 1.84 nmolặmin)1ặmg)1,...
- 9
- 526
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng 9 tr 25