quot the arrest of christ quot a gothic relief in the metropolitan museum of art pp 67 90
cáo khoa học: " A knowledge translation collaborative to improve the use of therapeutic hypothermia in post-cardiac arrest patients: protocol for a stepped wedge randomized trial" pdf
... chart abstraction of the variables related to post -arrest care for each of the hospitals The data dictionary, containing all variables, definitions, and ranges specific to the study and abstraction ... is the Principal Investigator for the SPARC grant which was awarded peer reviewed funding from Heart and Stroke Foundation of Canada, CIHR and the Laerdal Medical Foundation The remaining authors ... Chair of the Advance Cardiac Life Support Committee of the American Heart Association and the Co Chair of the Advance Life Support Task Force of the International Liaison Committee on Resuscitation...
- 7
- 435
- 0
Báo cáo y học: " Use of the novel hemostatic textile Stasilon® to arrest refractory retroperitoneal hemorrhage: a case report" pps
... clinical advantages for the arrest of bleeding Consent Written informed consent was obtained from the patient’s family for publication of this case report and any accompanying images A copy of the ... fiberglass and bamboo yarns incorporated into a proprietary weave It has been cleared by the United States Food and Drug Administration for external and internal use and has been granted over -the- counter ... fibrinous inflammation of the intra-abdominal contents and omentum was identified as was extensive retroperitoneal necrosis of the pancreas and surrounding peri-pancreatic tissues An 80% pancreatic...
- 5
- 389
- 0
Báo cáo y học: " The early minutes of in-hospital cardiac arrest: Shock or CPR? A population based prospective study" pps
... preparation All authors read and approved the final manuscript Funding sources One may finally question the relevance and validity of observations approaching 10 years of age Clinical research in ... population of 630 000 with an annual admission rate of about 42 000 patients In- hospital medical emergencies including cardiac arrests are managed by a resuscitation team consisting of an anaesthesiologist, ... collection, had access to all data, performed statistical modelling and drafted the manuscript TN carried out final outcome analysis, cross-checked data quality and participated at all stages during manuscript...
- 9
- 234
- 0
A STUDY ON THE VIETNAMESE ENGLISH TRANSLATION OF EXHIBIT LABELS IN THE VIETNAM MUSEUM OF ETHNOGRAPHY
... should read as a contemporary of the original A translation should read as a contemporary of the translation A translation may add to or omit from the original 10 A translation may never add to ... target language Through modulation, the translator generates a change in the point of view of the message without altering meaning and without generating a sense of awkwardness in the reader of the ... cabinet for candidates taking the Mandarin examinations The translation of the concept ‘tủ sách thầy đồ’ is really clear and easy to understand ‘Candidates taking the Mandarin examinations’ fully...
- 48
- 1,216
- 3
Focus - A simplicity manifesto in the Age of Distraction
... inspiration in what others have done, you get ideas, you gather the raw materials for creating But consuming and communicating aren’t creating They aid creating, they lay the groundwork, but at some point ... general idea Again, start with half a day or a day — something manageable Do it once a week, and gradually expand the time you spend on the cleanse Reducing the Stream If you’ve done the cleanse, ... what are you afraid of? Then shine a light on these fears with actual facts — what harm has actually been caused so far? Try to a short test — an hour, a day, a few days, a week — and see what...
- 121
- 552
- 1
Tài liệu Báo cáo Y học: Soluble silk-like organic matrix in the nacreous layer of the bivalve Pinctada maxima A new insight in the biomineralization field pptx
... estimated by the Whiteman Alcian blue binding technique [28,29], using chondroitin sulfate as standard The assay was adapted to the estimation of GAG in more dilute samples by increasing the aliquot ... 269) Table Glycosaminoglycan analysis and calcium measurements of the water-soluble matrix, the EDTA-soluble matrix and the EDTA-insoluble matrix of Pinctada maxima nacre Sulfated and nonsulfated ... regard to soluble organic matrix of mollusk shells indicated that more than 80% of the aspartate and glutamate is in the form of aspartic and glutamic acid, respectively [34] In order to compare...
- 10
- 731
- 0
Tài liệu Báo cáo khoa học: A point mutation in the ATP synthase of Rhodobacter capsulatus results in differential contributions of DpH and Du in driving the ATP synthesis reaction pptx
... RESULTS The single point mutation aE210K was introduced into the atp2 operon of Rb capsulatus, containing the F0 genes, cloned in an E coli strain The mutated operon was then transferred into a broad-host-range ... When the assay contained valinomycin, the data reported in Fig 1B were obtained In this case, the ATP yield of both wild-type and mutant as a function of illumination time presented a lag phase ... (subunits a, c, b¢, b) leaving only a C-terminal truncated atpI gene (subunit i) After GTA transfer, kanamycin-resistant colonies appeared that could contain the kanamycin resistance cassette (i.e the...
- 9
- 580
- 0
Tài liệu Company ''''A'''', corps of engineers, U.S.A., 1846-''''48, in the Mexican war doc
... to chaparral | | Page 20 relinguished changed to relinquished | | Page 21 chapparal changed to chaparral | | Page 22 chapparal changed to chaparral | | Page 27 chapparal changed to chaparral | ... had acquired at Metz In the meantime we taught him, at the same place, the manual of arms and Infantry tactics which had been introduced into the army after he was graduated at the Military Academy ... necessary for the arrival of the captain commander in this city" Owing to casualties of service, I had almost continually commanded the company, its train, and the general engineer train of the army for...
- 48
- 504
- 0
Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf
... 5¢-d(TCAGAAATTAAAGCGG ATGCATTATTTGCATG)-3¢ The upstream primer containing the NdeI restriction site (underlined) was: 5¢-d(GCTAGCATATGAAGCTTAAA AAAATTG)-3¢ and the downstream primer containing the ... AGCCCAATCTATTTGAG)-3¢; Gly262 to Ala, upper primer 5¢-d(ATAGATTGGGGTGCCCATGCAAATAA TGCA)-3¢, lower primer 5¢-d(ATTATTTGCATGGGCA CCCCAATCTATTTG)-3¢; Tyr269 to Ala, upper primer Fig Partial alignment of alkaline ... clashes with the aromatic ring of Tyr269, and these unfavorable interactions could lead to a decrease of local flexibility and an increased Ea value The validity of the above interpretation was...
- 6
- 488
- 0
Báo cáo khoa học: A single mismatch in the DNA induces enhanced aggregation of MutS Hydrodynamic analyses of the protein-DNA complexes pot
... 5¢-TCACCATAGGCATCAAGGAATCGCGAATCCGCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCG ATTTCGACACAATTTATCAGGCGAGCACCAGATTCAGCAATTAAGCTCTAAGCC- 3¢ 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCC ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢ ... 5¢-GCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCGGATTTCGACACAATTTATCAGGCGA-3¢ 5¢-TCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCCATGTTACTTAGCCGGAACGAGGC-3¢ 5¢-TCGCCTGATAAATTGTGTCGAAATCCGCGACCTGCTCCATGTTACTTAGCCGGAACGAGGC-3¢ ... ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢ 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGACCTGCTCC ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢ 5¢-GCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCGGATTTCGACACAATTTATCAGGCGA-3¢...
- 16
- 397
- 0
Báo cáo khoa học: Trigger factor interacts with the signal peptide of nascent Tat substrates but does not play a critical role in Tat-mediated export pptx
... pC4Meth-100TorA/P2 was constructed by PCR, using pTorA/P2 [17] as a template and the primers RRTorA-SacI-fw (5¢-GCGCGGAGCTCAAGAAGGA AGAAAAATAATGAAC-3¢, SacI site underlined) and TorA/Lep2-BamHI-rv (5¢-GCATGGATCCCGCGCGC ... SufIHAXbaI+ClaI-rv (5¢-ACTGATCGATCTAGATTACGCAT AGTCAGGAACATCGTATGGGTAGCCGCCTGGCG GTACCGGATTGACCAAC-3¢, ClaI site underlined, XbaI site in italics, HA-epitope sequence in boldface) The resulting fragments ... immunoprecipitated (IP) with antiserum against the HA-epitope as indicated After translation, half of the sample was irradiated with UV-light to induce crosslinking and half was kept in the dark Crosslinked...
- 9
- 393
- 0
Báo cáo khoa học: The effect of replacing the axial methionine ligand with a lysine residue in cytochrome c-550 from Paracoccus versutus assessed by X-ray crystallography and unfolding ppt
... changes being minimal the trapping of two main-chain conformations and increased B-factors at 295 K suggests that the presence of the coordinating Lys in some way can in uence the dynamics of the ... atoms of 0.4 A Significant deviations for main- and side-chain atoms in the ligand loop containing the K100 are however, observed To accommodate K100 as a ligand a number of main-chain atoms are ... heme-iron [7] Interestingly, ligand exchange for the M100K variant at alkaline pH was not observed [7], suggesting that the ‘alkaline transition’ involving the dissociation of the axial ligand no longer...
- 15
- 509
- 0
Báo cáo Y học: The presence of a helix breaker in the hydrophobic core of signal sequences of secretory proteins prevents recognition by the signal-recognition particle in Escherichia coli doc
... obtained by P1 transduction using strain CE1224 as the recipient and strains IQ85 and strain MM152, respectively, as donor strains To obtain strain CE1513, strain MM88 was used as Table Bacterial ... [13] Quantification of the data indicated that the cross-linking efficiency of the mutant nascent chains was somewhat reduced (Fig 3B) In conclusion, our results show an increased affinity of the G-10C ... molecules may still rely on the SecB pathway, because of overloading of the SRP pathway The re-routing of (G-10L)prePhoE to the Sec translocon via the SRP instead of the SecB pathway could be explained...
- 8
- 546
- 0
The Carbon and Global Warming Potential Impacts of Organic Farming: Does It Have a Significant Role in an Energy Constrained World? pptx
... conducted a review of the sustainability of organic grain production on the Canadian Prairies, including many of the Canadian studies discussed in detail below Notably, the authors conclude that management ... Dairying in Maritime Canada; M.Sc Thesis; NSAC and Dalhousie University: Halifax, NS, Canada, 2001 57 Main, M.H.; Lynch, D.; Martin, R.C.; Fredeen, A Sustainability profiles of Canadian dairy farms ... potential for E and GHG gains (and again data for the Canadian food system is lacking) and a significant body of literature has examined relative E and GHG efficiency of various freight modes Ultimately,...
- 41
- 524
- 1
The Project Gutenberg EBook of A First Book in Algebra, pot
... remain in the tank at the end of five days? 18 Two men are 150 miles apart, and approach each other, one at the rate of x miles an hour, the other at the rate of y miles an hour How far apart ... number of apple trees How many are there of each kind? John and Mary gathered 23 quarts of nuts John gathered quarts more than twice as many as Mary How many quarts did each gather? To the double of ... − 7a − 3a From take 2a 5a − 3a To add 2a − 5a − 3a From take − 4a To − 4a − 3a add 3a a a The principle is clear; namely, The subtraction of any number gives the same result as the addition of that number...
- 189
- 432
- 0
Báo cáo khoa học: The antagonistic effect of hydroxyl radical on the development of a hypersensitive response in tobacco pot
... pretreatment; H + ParA1, ParA1 in ltration after H2O treatment; A4 00, 400 lM ABA pretreatment; A + ParA1, ParA1 in ltration after ABA treatment All the spectra were representative of at least three ... [50] ParA1, PR, PA (ParA1 plus adenine), PT (ParA1 plus thiourea), PV (ParA1 plus ascorbic acid) and PC (ParA1 plus catalase) were in ltrated into the same leaves of tobacco plants, which had been ... were in ltrated into tobacco leaves The upper part of the leaf was covered with aluminium foil (shaded area in the left-hand picture), and the lower part of the leaf was exposed to light The experiment...
- 15
- 479
- 0
Prevalence of presumed ocular tuberculosis among pulmonary tuberculosis patients in a tertiary hospital in the Philippines pdf
... cases It has been estimated to be under 1% in the USA, 4% in China, 6% in Italy, 7% in Japan, and 16% in Saudi Arabia [10] A Southeast Asian neighbor, Thailand, reported a 2.2% systemic TB involvement ... Page of Authors’ contributions PL carried out the coordination with the pulmonology department as well as the eye exam of the participants He also drafted the manuscript VO examined participants ... Patients and had combined findings in the anterior and posterior segments of the eye; VAi, best-corrected visual acuity (BCVA) prior to ATT; VAf, BCVA after weeks of ATT; GAU, granulomatous anterior...
- 4
- 517
- 0
Tìm thêm: xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25