profit analysis of the german credit data using sas em version 5 3
Báo cáo khoa học: "A Linguistic and Computational Analysis of the German "Third Construction"*" potx
... Figure a The unwrap in move 5afo corresponds to the adjunction of tree /~2 to tree ota at the root node of ~3 (shown by the arrow), and the unwrap in Move 6a/b to the adjunction of tree /31 to tree/~2 ... as the sum of the number of moves that input elements are stored in the stack) we predict that sentence 3In the interest of conciseness, VP nodes and empty categories have been omitted 298 3a 3b ... (the arrows again show the sequence of adjunctions): we see that the deferred incorporation of Na corresponds to the use of a tree set for the clause of V3 Finally, let us consider the extremely...
- 3
- 354
- 0
Báo cáo y học: " Psychometric analysis of the Self-Harm Inventory using Rasch modelling" ppsx
... -0.218 32 2.62 32 2.62 32 2.62 32 2.62 32 0.72 32 2.62 32 1.67 32 1.67 32 2.62 32 2.62 32 2.62 32 2.62 32 2.62 32 2.62 32 2.62 32 2.62 32 2.62 32 1.67 32 2.62 32 1.67 32 1.67 32 2.62 11.1 63 12.260 5. 171 4.119 6 .56 5 3. 897 ... Direct Discreet Discreet -1.916 -1.7 93 -1. 233 -0.892 -0.776 -0.6 95 -0.686 -0.414 -0.0 93 55 55 43 36 33 32 31 26 21 62 59 45 37 35 33 33 27 21 87 85 77 70 68 66 66 60 52 Interpersonal 0.000 20 20 49 ... Traumatology 2004, 10(4): 257 -266 Page of (page number not for citation purposes) BMC Psychiatry 2009, 9 : 53 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 Rasch G: Probabilistic...
- 9
- 363
- 0
Báo cáo sinh học: "Analysis of the real EADGENE data set: Comparison of methods and guidelines for data normalisation and selection of differentially expressed genes (Open Access publication)" potx
... who provided the data were RIBFA and the Roslin Institute Detection of differentially expressed genes 6 35 In this paper three main steps of microarray data analysis will be discussed: data quality ... Presentation of the data 2.1.1 Comparison of E coli vs S aureus elicited mastitis in cows using transcriptomic profiling The outcome of an udder infection (mastitis) is influenced by the species of the ... overview of these techniques Most of the teams used the spot quality indicators provided by the scanning software (Bluefuse) to make decisions about excluding spots from the analysis There are...
- 18
- 361
- 0
Báo cáo sinh học: " Analysis of the real EADGENE data set: Multivariate approaches and post analysis (Open Access publication)" doc
... classification (Fig 3) 1 0 5 15 15 Group 15 Group 15 Group 15 Group 5 15 Group 15 Group 15 Group Figure K-means aggregation of smooth profiles of the 147 E coli clones (Fisher test and FDR < 1%) on 15 microarrays ... between the genes and the phenotype of interest Although the purpose of these methods is the same they are quite different in terms of methodology and in the genes included in the analysis Despite the ... in 38 31 out of 58 40 query probe ID that were associated with human GO terms 3. 4 Differential expression of gene sets Based on these annotation sources the teams used either the Globaltest or the...
- 18
- 291
- 0
A critical discourse analysis of the news on north korean missile launches part 5
... Japan, the nature of their involvement and the roles they play in those processes reveal a positive representation of this coalition by VOA On the other hand, the transitivity analysis of the headlines ... verbal (58 .3% ) and material processes (41.7%) Apart from this similarity, there are differences between the two sources of news concerning the representation of North Korea Instead of the image of ... condemnation and punitive actions 3. 2 .3. 2 Nhan Dan Nhan Dan also over-lexicalizes the North Korea’s missile launches but not to build the image of an enemy like VOA The data in Table shows that the...
- 28
- 603
- 1
Báo cáo khoa học: "Treatment planning using MRI data: an analysis of the dose calculation accuracy for different treatment regions" ppt
... Mackay RI: Evaluation of the impact of dental artefacts on intensity-modulated radiotherapy planning for the head and neck Radiother Oncol 2009, 93 :55 3 -55 8 28 Schenck JF: The role of magnetic susceptibility ... Thorax Brain -0 .56 [-2.47; 0.46] 0.07 [-1.14; 0.60] -0 .36 [-0. 93; 0. 15] -0.01 [-1 .51 ; 0.42] Head & Neck 0.68 [-0 .50 ; 2.17] 0.27 [-0.21; 0.80] D 95 and D50 (dose covering 95% and 50 % of the ROI respectively) ... 0 .5 0.8 [0.1; 1.1] 0 .3 -1.6 [-2 .3; -1.6] 0.2 Thorax 0.2 [-0.6; 0.9] 0.4 0 .5 [0.0; 1.0] 0 .3 1.4 [-0.8; -6 .5] 2.1 Head&Neck - - -0 .3 [-0.8; 0.1] 0 .3 -0 .3 [-1.1; 0.6] 0 .5 Brain - - 0.0 [-0.7; 1 .5] ...
- 8
- 348
- 0
Spectral analysis of total ozone column variability using TOMS data over Baghdad, Iraq
... the mean at Baghdad from January 1997 to 31 December 2008 120 D to D V ay ay ariation (D ) U 100 80 60 40 20 -20 -40 -60 -80 -100 3 65 730 10 95 1460 18 25 2190 255 5 2920 32 85 3 650 40 15 Number of ... in contrast to the desert 37 36 35 34 Baghdad 33 32 31 30 39 40 41 42 43 44 45 46 47 48 Figure Map of Iraq showing study area (Baghdad city) Results and discussion Figure shows the daily TOC at ... ) n U 1980 30 8 TOC TOC regression line SSN SSN regression line 30 6 30 4 25 20 15 30 2 30 0 10 298 50 296 294 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 00 01 02 03 04 05 06 07 Year...
- 6
- 549
- 1
Báo cáo Y học: The analysis of the fine specificity of celiac disease antibodies using tissue transglutaminase fragments pot
... TTATGGAACTGGGCCACAGCA 1–7 140–147 454 –448 479–4 73 58 5 57 9 687–682 448– 4 53 269–2 75 37 6 38 2 269–264 37 6 37 1 Ó FEBS 2002 Epitope mapping of anti-tTG Igs (Eur J Biochem 269) 51 77 3, 3¢ ,5, 5¢-tetramethylbenzidine ... lengths of the core domain either at the 5 - or 3 -terminus (tTG/8 to tTG/12) Fig Schematic drawing of the cloning of 12 different tTG regions Reference numbers of the amino acid residues at the ends ... [10,12] and the catalytic triad formed by Cys277, His3 35 and Asp 35 8 [11] Interestingly, all three of these amino acids are comprised in the antigenic region we have identified During the course of inhibition...
- 7
- 506
- 0
Neighborhoods and the Health of the Elderly: Challenges in Using National Survey Data pot
... (176.19) $ 138 ,642 .39 (109,2 95. 47) 1968 (32 . 039 ) 19 93 (28.917) $ 138 ,6 65. 49 (112,262) 1967 ( 35 . 917) 19 93 (33 .261) $148 ,3 65. 00 ($108,8 95. 03) 1967 (52 .26) 1992 (50 .81) $ 139 , 056 .00 ($98 ,56 3. 74) 1967 ... (14.74) 19 93 (3 .59 ) 0.086 (0.090) 0.0 83 (0.0 85) 0.082 (0.084) 0.0 73 (0.0 75) 0.086 (0.090) 5, 30 7.10 (11,976) 2,166.70 (5, 259 .9) 1. 059 (0 .36 7) 5, 77. 05 (14,008) 2,488.17 (6 ,57 6. 85) 1.047 (0 .30 9) 6,047.27 ... Survey Data in Research on Neighborhoods and Elderly Health Page 12 Urban/Rural Status 0.2 23 (0 .37 4) 0.164 (0 .3 25) 0.149 (0 .31 1) 0. 151 (0 .31 1) 0.182 (0 .34 1) $ 133 ,58 5.70 (110 , 53 6) 1 951 (1 73. 08)...
- 19
- 371
- 0
The Rise and Fall of the U.S. Mortgage and Credit Markets: A Comprehensive Analysis of the Meltdown pot
... BBB(+/-) BB(+/-) B(+/-) Total 1, 032 3, 4 95 2,9 83 2, 954 789 11,261 156 1 ,33 0 1,886 2,248 6 83 6 ,31 0 Downgraded as a percentage of total 15. 1 38 .1 63. 2 76.1 86.6 87 .5 56.0 Sources: Inside Mortgage Finance, ... Congressional Budget Office, the Federal Reserve Bank of Atlanta, the Office of the Comptroller of the Currency, and the World Bank He is a member of the Advisory Council of George Washington University’s ... 2008) Basis points 50 0 450 October 10, 2008: 4 63. 6 bps Historical high before 2008 November 1987: 255 bps September 16, 2008: Fed rescues AIG for $ 85 billion 400 35 0 30 0 250 August 20, 2007:...
- 51
- 467
- 0
Báo cáo khoa học: Analysis of the CK2-dependent phosphorylation of serine 13 in Cdc37 using a phospho-specific antibody and phospho-affinity gel electrophoresis doc
... Nishida 62 47 33 WB: Anti-[pSer 13] -Cdc37 B 62 47 33 WB: Anti-Cdc37 C 62 47 33 WB: Anti-[pTEpY]-ERK D 62 47 33 WB: Anti-ERK Fig Effect of EGF treatment on the phosphorylation of Cdc37 KB cells incubated ... holoenzyme-dependent phosphorylation of Cdc37 in the presence of Mg2+–ATP FEBS Journal 274 (2007) 56 90 57 03 ª 2007 The Authors Journal compilation ª 2007 FEBS 56 95 A 60 30 15 EGF Cdc37 phosphorylation by CK2 ... (20 03) The raison d’etre of constitutively active protein kinase: the lesson of CK2 Acc Chem Res 36 , 37 8 38 4 24 Pinna LA (2002) Protein kinase CK2: a challenge to canons J Cell Sci 1 15, 38 73 38 78...
- 14
- 342
- 0
Economic Analysis of the House Budget Resolution by the Center for Data Analysis at The Heritage Foundation pot
... 3, 734 .8 3, 469.0 3, 692.1 53 .6 42.7 3, 9 15. 0 3, 872.0 43. 0 4,107.1 4, 055 .4 51 .7 4 ,32 3.7 4,2 65. 7 58 .0 4 ,56 4 .5 4,499.4 65. 1 36 ,477 .3 35 , 886.0 59 1 .3 3,604.6 3, 876.1 -271 .5 3, 636 .1 4,1 35 . 8 -499.6 3, 727 .3 ... 130 .1 133 .2 132 .1 136 .0 -2.1 -2.8 136 .3 139 .7 -3 .5 139 .5 1 43. 6 -4.1 1 43. 0 147.6 -4.6 146.8 151 .8 -5. 0 132 .3 134 .7 -2.4 3, 2 15. 2 3, 150 .5 64.7 3, 389.6 3, 319.6 70.0 Billions of Dollars 3 ,52 2.6 3, 734 .8 ... Dollars 32 ,780.4 35 , 568.6 32 ,0 25. 1 34 ,742.0 755 .3 826.6 38 ,4 45. 3 37,612.0 833 .3 41,401.0 40, 636 .1 7 65. 0 44,477.2 43, 851 .5 6 25. 8 47,6 95. 2 47,2 95. 1 400.2 34 ,881.2 34 ,30 2.9 57 8 .3 127.2 128 .5 -1.2...
- 19
- 466
- 0
Báo cáo y học: "Detailed analysis of the variability of peptidylarginine deiminase type 4 in German patients with rheumatoid arthritis: a case– control study" docx
... padi4_ 95 (G→C) padi4_96 (T→C) Controls 79 (38 .7%) 79 (38 .7%) 97 (47 .5% ) 79 (38 .7%) 63 (30 .9%) 63 (30 .9%) 69 (33 .8%) Patients 101 (49 .5% ) 101 (49 .5% ) 102 (50 %) 101 (49 .5% ) 71 (34 .8%) 71 (34 .8%) 72 ( 35 . 3% ) ... Haplotype 2 /3 Haplotype Haplotype Haplotype 1B Haplotype 2 /3 Haplotype Controls 119 (58 .3% ) (2.9%) 63 (30 .9%) 16 (7.8%) 84 (82.4%) (5. 9%) 51 (50 %) 14 ( 13. 7%) Patients 102 (50 %) (0 .5% ) 71 (34 .8%) 30 (14.7%) ... haplotype 2 /3 (median, 5. 0 [3. 9 5. 9] versus 5. 5 [4.6–6.4]; P = 0. 23) , and haplotype (median, 5. 2 [3. 9–6.6] versus 5. 2 [4.1 5. 9]; P = 0. 73) Frequencies of PADI4 SNPs and novel PADI4 variants The haplotype-specific...
- 6
- 408
- 0
báo cáo khoa học: "Association analysis of frost tolerance in rye using candidate genes and phenotypic data from controlled, semi-controlled, and field phenotyping platforms" potx
... - 25. 7 - 16 .3 - 5. 0 0 .51 -0 .51 - 0. 73 -0 .51 - 0.49 - 0.19 1 .36 - 0.12 3. 32 - < 0.001 -0 .31 - 0.12 -1. 43 - 0.74 0 .57 - Overall < 0.01 - 0.09 - 0.09 - 4.4 < 0.01 -0.22 - 0.04 -1.69 - 0.06 -3. 32 ... EKOAGRO, 0.0% in Petkus, 5. 3% in ROM1 03, and 6.7% in SMH 250 3) The proportion of genetic variation explained by the haplotypes ranged from 0% to 25. 7% with a median of 1.6% in the controlled platform, ... value of replicates for each genotype Boxes indicate the range of the middle 50 % of the data with a horizontal line representing the median and vertical lines beyond the boxes indicate the upper...
- 14
- 415
- 0
Báo cáo y học: " Therapeutic efficacy of alpha-1 antitrypsin augmentation therapy on the loss of lung tissue: an integrated analysis of 2 randomised clinical trials using computed " potx
... ± 3. 15 27/0 24.4 ± 2.70 34 /4 24 .3 ± 3. 3 35 / 4 24 .3 ± 3 .5 56/4 24.0 ± 3. 3 56 /3 24 .5 ± 3. 2 0.748 0. 35 5 FEV1 (L), median 1. 63 ± 0.49 1. 63 1.72 ± 0 . 53 1.61 1.44 ± 0.60 1.14 1. 35 ± 0.62 1.14 1 .55 ± ... 98 ± 23. 2 52 .2 ± 15. 2 50 .1 1 03. 1 ± 21.8 56 .3 ± 17 .3 56 .1 104.7 ± 23. 9 55 .7 ± 15. 9 56 .0 0.789 KCO % predicted Unadjusted PD 15 (g•L-1) 62.2 ± 17.62 71.41 ± 20.87 59 .9 ± 16.9 75. 56 ± 25. 53 55 .3 ± ... 19.07 56 .5 ± 14.8 45. 48 ± 16. 95 60.0 ± 18.9 58 .88 ± 23. 03 58 .6 ± 15. 5 59 .79 ± 25. 83 0.619 0.844 TLC-adjusted PD 15 (g•L-1) 59 .9 ± 11. 03 62.98 ± 13. 49 54 .6 ± 17.4 53 .9 ± 16.0 57 .1 ± 15. 2 58 .2 ± 15. 7...
- 8
- 257
- 0
Báo cáo y học: "Statistical methods and software for the analysis of highthroughput reverse genetic assays using flow cytometry readouts" pps
... MEST-CT-2004 -51 39 73, and a PhD fellowship of the German Cancer Research Center (DKFZ) 23 24 25 Genome Biology 2006, 7:R77 information Click here data dataset and the tational analysis of accompanying R data ... statistical analysis, the details of which can be displayed on demand by hyperlinking them to the corresponding well icons in the plate plot The reader is directed to the online complement [32 ] for ... as wellscreens ofof the individualfrom our interactions The following additional data are included with the online version of this article: The vignette of the accompanying R data package containing...
- 12
- 424
- 0
Analysis of the management and using the working capital in ltd hùng hà
... 33 ,081 44 .37 36 ,211 53 .09 35 , 121 43. 73 38, 934 46.12 Short term debt 37 ,076 56 .09 33 ,081 44 .37 36 ,211 53 .09 35 , 121 43. 73 38, 934 46.12 Permanent source 29,0 23 43. 91 41,471 55 . 63 31,991 46.91 45, 1 93 ... 40.02 24,8 13 41.26 27,072 52 . 73 32 , 53 8 54 .90 35 , 076 54 .70 Inventory 17,8 15 39 .58 33 , 4 53 55 .62 9,618 25, 769 43. 48 7 ,3 95 11 . 53 Other working capital 7,946 2.12 13, 740 26.76 252 0. 43 20 ,52 5 32 .01 Total ... 1, 239 601 9 13 7 05 -64 -1 .30 31 2 51 .91 Inventory 33 , 4 53 9,618 25, 769 7 ,3 95 15, 64 31 .91 - 23, 8 35 -71. 25 16, 151 167.92 -18 ,37 4 -71 .30 36 ,211 35 , 121 38 , 934 -4,00 -8. 15 3, 13 17,8 15 37 ,076 33 ,081 1,129...
- 54
- 560
- 1
Accep tability of the trend forecasting model using the time series analysis of stock indices
... follows: 3/ 2 = 1 .5; 5/ 3 = 1.67; 8 /5 = 1.6; 13/ 8 = 1.6 25; 21/ 13 = 1.6 15; 34 /21 = 1.619; 55 /34 = 1.618; 89 /55 = 1.618 An interesting characteristic of the Golden Ratio is that its inverse is equal to the ... mathematician, the Fibonacci retracement lines are based on the Fibonacci number sequence The sequence is as follows: 1, 2, 3, 5, 8, 13, 21, 34 , 55 , 89, etc Notice that each number is the sum of the previous ... conditions The Dow Theory is the grandfather of all technical market studies The Dow Theory on stock price movement is a form of technical analysis that includes some aspects of sector rotation The theory...
- 149
- 106
- 0
DSpace at VNU: Observation of the rare B-s(0)- mu(+)mu(-) decay from the combined analysis of CMS and LHCb data
... Topkar52, T Aziz 53, S Banerjee 53, S Bhowmik 53, 222, R.M Chatterjee 53, R.K Dewanjee 53, S Dugad 53, S Ganguly 53, S Ghosh 53, M Guchait 53, A Gurtu 53, 2 23, G Kole 53, S Kumar 53, M Maity 53, 222, G Majumder 53, ... Rodriguez Perez54, M Smith54, S.-F Cheung 55, D Derkach 55, T Evans 55, R Gauld 55, E Greening 55, N Harnew 55, D Hill 55, P Hunt 55, N Hussain 55, J Jalocha 55, M John 55, O Lupton 55, S Malde 55, E Smith 55, S Stevenson 55, ... Hall 53, M McCann 53, P Owen 53, M Patel 53, K Petridis 53, F Redi 53, I Sepp 53, E Smith 53, W Sutcliffe 53, D Websdale 53, R.B Appleby54, R.J Barlow54, T Bird54, P.M Bjørnstad54, S Borghi54, D Brett54,...
- 20
- 183
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25