Báo cáo Y học: The analysis of the fine specificity of celiac disease antibodies using tissue transglutaminase fragments pot

The analysis of the fine specificity of celiac disease antibodies using tissue transglutaminase fragments Daniele Sblattero 1 , Fiorella Florian 1 , Elisabetta Azzoni 1 , Trevin Zyla 3 , Min Park 3 , Valentina Baldas 2 , Tarcisio Not 2 , Alessandro Ventura 2 , Andrew Bradbury 3,4 and Roberto Marzari 1 1 Dipartimento di Biologia, University of Trieste, Trieste, Italy; 2 IRCSS, Burlo Garofolo, Trieste, Italy; 3 Biosciences Division; Los Alamos National Laboratory, Los Alamos, New Mexico, USA; 4 SISSA, Trieste, Italy Celiac disease is an intestinal malabsorption characterized by an intolerance to cereal proteins accompanied by immuno- logical responses to dietary gliadins and an autoantigen located in the endomysium. The latter has been identified as the enzyme tissue transglutaminase which belongs to a family of enzymes that catalyze protein cross-linking reac- tions and is constitutively expressed in many tissues as well as being activated during apoptosis. In a recent paper, we des- cribed the selection and characterization of anti-transglu- taminase Igs from phage antibody libraries created from intestinal lymphocytes from celiac disease patients. In this work, using transglutaminase gene fragments, we identify a region of tissue transglutaminase recognized by these anti- bodies as being conformational and located in the core do- main of the enzyme. This is identical to the region recognized by anti-transglutaminase Igs found in the serum of celiac disease patients. Keywords: autoimmunity; celiac disease; transglutaminase; epitope mapping; phage display. Celiac disease (CD) is a genetic disease strongly linked to HLA DQ2, with other genetic factors also thought to be important. It is characterized by flattening of the intestinal mucosa and malabsorption. The pathogenesis involves dietary exposure to wheat gluten and similar proteins in rye, barley and possibly oats [1], with gliadins, specific antigenic determinants found in glutens [2], playing a prominent role. The disease is characterized by the presence of specific antibodies recognizing gliadins, food proteins and an endomysial autoantigen, identified as being tissue transglutaminase (tTG) [3]. tTG or type 2 transglutaminase is a member of a family of seven isoforms of enzymes involved in protein cross-linking, including prostatic TGase and factor XIII. tTG is a Ca 2+ -dependent ubiquitous intracellular enzyme that catalyzes the covalent and irre- versible formation of gamma glutamyl-lysine bonds [4]. Furthermore, tTG plays a role in the transduction of extracellular signals, mediated by its additional GTP- hydrolyzing activity [5], analogous to that of G-proteins found in adrenergic receptor transduction pathways [6]. Finally, tTG seems to play a critical role in controlling cell and tissue homeostasis regulating the cell cycle through its involvement in proliferation, terminal differentiation and apoptotic processes [7]. The first TGase structure deter- mined has been that of human factor XIIIA [8]. On the basis of sequence homology with factor XIII and by computer modeling and experimental approaches, a structural model for tTG has been proposed by Casadio et al.[9]andvery recently, the X-ray structure of the human tTG complexed with GDP, determined [10]. Human tTG consists of four domains: the N domain, with a b-sandwich structure, the enzyme core domain, formed by a series of a-helices, and two C-terminal domains, C1 and C2, containing b-struc- tures arranged in barrel-like conformations. The catalytic site, the so called triad [11], formed by Cys277, His335 and Asp358, and also the Ca 2+ [12] and GTP binding sites are located in the core domain and in the nearby first b-barrel domain [10]. Phage display of human antibody fragments has proved to be an effective method to investigate in vivo antibody responses in autoimmune disease [13,14]. In this method, a patient’s antibody repertoire is expressed fused to the coat protein of a phage vector that carries the encoded protein gene [15], with each phage carrying a single antibody specificity. We have recently made and selected phage antibody libraries from lymphocytes of CD patients [16]. We were able to isolate single-chain antibody fragments (scFv) to tTG from all intestinal lymphocyte libraries but not from those obtained from peripheral lymphocytes. This is in contrast to antibodies against gliadin, which could be obtained from all libraries, indicating that the humoral response against transgluta- minase occurs at the intestinal level, whereas that against gliadin occurs both peripherally and centrally. IgA antibodies from three different patients recognized the same tTG epitopes and by ELISA competition experi- ments we demonstrated that the number of epitopic regions recognized was restricted to two. The antibodies recognizing one of these had a bias in favor of genes from Correspondence to D. Sblattero, Department of Biology, University of Trieste, via L Giorgieri, 10, 34127 Trieste, Italy. Fax: + 39 40 568855, Tel.: +39 40 558 3895, E-mail: daniele@icgeb.org Abbreviations: BCIP, 5-bromo-4-chloroindol-3-yl phosphate; CD, celiac disease; Ep, epitope; GP, guinea-pig; IPTG, isopropyl thio-b- D -galactoside; scFv, single-chain antibody fragment; TMB, 3,3¢,5,5¢-tetramethylbenzidine dihydrochloride; tTG, tissue transglutaminase. Enzymes: transglutaminase (EC 2.3.2.13). (Received 6 June 2002, revised 2 August 2002, accepted 29 August 2002) Eur. J. Biochem. 269, 5175–5181 (2002) Ó FEBS 2002 doi:10.1046/j.1432-1033.2002.03215.x the VH5 antibody family and were also able to recognize guinea-pig (GP) tTG, which the other was not. In this study, we report the cloning and expression of tTG gene fragments in order to map the antigenic regions recognized by these monoclonal phage antibodies as well as sera from CD patients. MATERIALS AND METHODS Bacterial strains DH5aF¢ {F¢/endA1 hsdR17 (r K– m K+ ) supE44 thi-1 recA1 gyrA (Nal r ) relA1 D (lacZYA-argF)U169 deoR [F 80 dLac- D(lacZ)M15]} was used for cloning, and HB2151 [K12, ara D(lac-pro),thi/F¢ proA + B + ,lacIqZDM15] was used to make soluble scFv. Plasmid pTrcHisB (Invitrogen) was used to express tTG domains. Molecular biology enzymes were purchased from New England Biolabs, Promega or Life Technologies. Antigens GP tTG was purchased from Sigma. Human tTG cDNA was obtained by amplifying cDNA from an intestinal biopsy with specific primers [17] and cloning into pTrcHisB. PCR amplification and cloning of tTG deletion mutants tTG fragments were obtained by PCR amplification from the cloned tTG gene. The primers used to amplify 12 tTG sequences are described in (Table 1). Upon amplification (30 cycles of 94 °C1min,60°C1min,72°C, 2 min), all tTG fragments contained a 5¢ Bgl II restriction site and a 3¢- EcoR I site used for cloning. The primary PCR amplifica- tion products were digested with Bgl II and EcoR I and gel purified to subclone into the pTrcHisB vector. After transformation of Escherichia coli DH5aF¢ cells, positive clones were identified by PCR using the same primers used for PCR amplification. tTG fragments expression and purification Bacteria were grown in 2xYT amp medium at 37 °Cto D 600 0.5, induced with 0.2 m M , isopropyl thio-b- D -galacto- side (IPTG) and incubated at 28 °C for an additional 5 h. The soluble cytoplasmic fraction was prepared by extraction of pelleted bacteria with lysozyme 1 mgÆg )1 bacteria in lysis buffer (20 m M Tris pH 8.0, 500 m M NaCl, 5 m M imidazole, 0.1% Triton X 100, 20 lgÆmL )1 DNase) followed by centri- fugation for 15 min at 27 000 g. The supernatant was col- lected and dialyzed against NaCl/P i (Na 2 HPO 4 /NaH 2 PO 4 10 m M pH 7.4, NaCl 0.15 M ). Purified fragments were obtained by affinity chromatography of the bacterial extract on Ni/nitrilotriacetic acid resin (Qiagen) which selectively binds the six histidines at the N-terminus of the fragments. Human sera and scFvs Human sera were obtained from 24 untreated celiac disease patients positive for anti-tTG and anti-endomysial Igs with positive histological analysis of the intestinal mucosa. A further 12 sera with antibodies to tTG were obtained from nonceliac patients affected by other pathologies and 20 from healthy donors. ScFvs to tTG from phage display libraries were obtained from bacterial culture supernatants. Briefly, phagemids from individual colonies were infected into E. coli HB2151, grown to D 600 ¼ 0.5, induced with 0.5 m M , IPTG and further grown overnight at 28 °C. ScFvs were used directly as supernatants of induced bacterial cultures. ELISA ELISA was performed by coating ELISA plates with purified tTG and tTG fragments at 10 lgÆmL )1 for 15 h at 4 °C. Wells were blocked with 2% nonfat milk in NaCl/P i (MPBS) and washed three times with NaCl/P i plus 0.1% Tween20 and three times with NaCl/P i . Primary antibodies used were CUB7402, a commercial anti-tTG Ig (Neo- marker), His-probe H3, an anti-histidine tag Ig (Santa Cruz), soluble cloned scFvs to tTG as previously described [16] and human sera. The antibodies were used as following: (a) CUB7402, diluted 1 : 1000 with MPBS and His-probe diluted 1 : 1000 followed by goat anti-(mouse IgG) conjugated with HRP (Dako) (b) scFvs, diluted 1 : 1, mAb recognizing the SV5 tag [18] found at the scFv C terminus followed by goat anti-(mouse IgG) conjugated with HRP (Dako); (c) human sera, diluted 1 : 200 followed by goat anti-(human IgA) conjugated with HRP (Sigma). All the immunocomplexes were revealed with Table 1. Primers used to amplify 12 tTG deletion mutants. Enzyme restriction sites for BglII and EcoRI are in italics. The bold sequences correspond to the tTG gene. Primer name Primer sequence Amino acids N back AGCTCG AGATCT ATGGCCGAGGAGCTGGTCTT 1–7 Core back AGCTCG AGATCT AACGCCTGGTGCCCAGCGGA 140–147 Core for TGAAGC GAATTC TTACTCCCTCTCCTCTGAGGACC 454–448 Loop for TGAAGC GAATTC TTAACGGATCCGCATGGCCATCC 479–473 C1 for TGAAGC GAATTC TTACTCCAGGTAGAGGTCCCTCT 585–579 C2 for TGAAGC GAATTC TTAGGCGGGGCCAATGATGAC 687–682 Loop back AGCTCG AGATCT GGGTCCTCAGAGGAGAGGAG 448–453 Core 269 back AGCTCG AGATCT TGCCAGCGCGTCAGGTATGGC 269–275 Core 376 back AGCTCG AGATCT GTTCGTGCCATCAGGGAGGGC 376–382 Core 269 for GAAGC GAATTC TTAGCCGTGGTTCTTCCAGCG 269–264 Core 376 for GAAGC GAATTC TTATGGAACTGGGCCACAGCA 376–371 5176 D. Sblattero et al. (Eur. J. Biochem. 269) Ó FEBS 2002 3,3¢,5,5¢-tetramethylbenzidine dihydrochloride (TMB) and H 2 O 2 as substrates and read at A 450 . Western blotting SDS/PAGE was performed according to standard tech- niques. Purified tTG fractions were separated by SDS/ PAGE and transferred onto nitrocellulose (Amersham) by semi-dry blotting using the Pharmacia Multiphor II. The membrane was blocked using MPBS for 1 h at room temperature. CUB7402 and His-probe were used as primary antibodies. After 2 h incubation at room temperature and extensive washing with NaCl/P i plus 0.1% Tween 20, the nitrocellulose was subsequently incubated with goat anti- (mouse IgG) conjugated with alkaline phosphatase and revealed by the chromogenic substrate BCIP (5-bromo-4- chloroindol-3-yl phosphate) and Nitro Blue tetrazolium. RESULTS Cloning strategy In a previous paper [16] we described the cloning of human tTG in the pTrcHisB expression vector. Although this cloning was effective, most of the tTG synthesized in bacteria was present as insoluble inclusion bodies and only a reduced amount of functional enzyme could be extracted and purified. The inclusion body fraction can be solubilized by 4 M urea but neither the enzymatic activity nor the antigenic functionality is recovered by renaturing proce- dures. Also the soluble fraction, treated with 4 M urea is no longer recognized by CD sera and CD phage display antibodies to tTG (unpublished results), strongly suggesting that the epitopes recognized by these antibodies are very sensitive to denaturation. These findings led us to investigate the epitope specificity of these antibodies with a rational approach in which PCR primers recognizing DNA sequences encoding amino acidic sequences at the ends of each of the putative four main tTG domains, as outlined by [9] and substantially confirmed by [10], were used to amplify these domains. The scheme of the tTG domains cloned is reported in Fig. 1. We cloned seven tTG regions combining different domains, here reported as tTG/1 to tTG/7, as well as sequences comprising different lengths of the core domain either at the 5¢-or3¢-terminus (tTG/8 to tTG/12). Cloning and expression of tTG regions The fragments representing different combinations of tTG domains were amplified by PCR using the primers described in Table 1 and cloned into pTrcHisB using BglII and EcoRI. Individual clones were screened by PCR using the cloning primers and restriction digestion of plasmid DNA. Clones were grown in liquid medium to D 600 ¼ 0.5, induced with IPTG for 5 h and fragments purified by Ni/nitrilotri- acetic acid chromatography. The eluted fractions were checked by SDS/PAGE and Western blotting. For this purpose, two commercial mAbs were used as primary antibodies: His-probe, a mAb directed to the six histidines inserted at the N-terminus of the tTG fragments and CUB7402, which recognizes a linear tTG epitope (amino acids 447–478) located at a sequence overlapping the C-terminal end of the core and the nearby loop. The results of the Western blotting are depicted in Fig. 2. Using His-probe, all the expressed tTG fragments showed elec- trophoretic bands corresponding to the predicted molecular weight (Fig. 2A). When the mAb CUB7402 was used (Fig. 2B), all fractions had the same pattern, with the exception of tTG/1, /4, /11 and /12 which lack the epitope recognized by this antibody. Although all the fragments showed bands with seemingly little or no proteolytic degradation, differences in the intensity of the bands were noted, probably reflecting different expression and/or purification efficiencies. In Coomassie blue-stained SDS/PAGE gels, all fractions showed a purity greater than 90% (not shown). tTG fragments recognition by cloned antibodies Full-length tTG and derived fragments were tested for their ability to be recognized by the previously selected human anti-tTG Igs [16]. Prior to that, the purified tTG fragments were quantified, diluted to 10 lgÆmL )1 , absorbed to the wells of a microtiter plate and tested by mAbs CUB7042 and His-probe, previously used for Western blotting. The results (not reported) showed that full-length tTG and all the fragments were recognized to a similar extent, with the exception of those not containing the linear epitope recognized by CUB7042. This result attested that the reactivity of the tTG fragments was similar and suitable for testing differences in the reactivity of anti-tTG Igs. The cloned human antibodies to tTG, expressed as scFv, were previously selected from phage antibody libraries obtained from intestinal biopsy lymphocytes from three untreated Fig. 1. Schematic drawing of the cloning of 12 different tTG regions. Reference numbers of the amino acid residues at the ends of the cloned sequences are shown. Ó FEBS 2002 Epitope mapping of anti-tTG Igs (Eur. J. Biochem. 269) 5177 CD patients and shown to recognize two distinct epitopes, epitope 1 (Ep1) and epitope 2 (Ep2). Ep1 antibodies predominantly belong to the VH5/DP73 gene family/ segment and also recognize GP tTG whereas Ep2 antibodies do not belong to any consistent V gene family and do not recognize GP tTG. Ten antibodies to tTG isolated from the three libraries were challenged against the tTG fragments by ELISA. All antibodies were previously titrated by ELISA on full-length tTG. The working dilution was calculated as the highest antibody dilution with an A value not lower than 90% of the saturating concentration. Remarkably, all the antibodies showed equivalent results confirming that a similar immune response arises in different CD patients. In fact, the 10 antibodies tested were cloned from three CD patients and this might be interpreted as a distinctive trait of CD. The responses of four antibodies belonging to Ep1/ GP+ and Ep2/GP– clusters are reported in Fig. 3 as examples. To avoid interference due to the different affinities of the antibodies for the antigen, the A values corresponding to interaction with full-length tTG have been set to 100 and the A values for the individual tTG fragments have been normalized as a corresponding percentage. From Fig. 3 it is clear that the antibodies recognize the fragments tTG/1, /2, /3, /7 and /11 but not tTG/4, /5, /6, /8, /9, /10 and /12. A difference in the level of recognition was registered for fragments tTG/2 and tTG/3, where the reactivity is, on an average, far lower for the Ep2/GP– than the EP1/GP+ antibodies, reaching a reduction of around 75% for tTG/2. All antibodies were tested on unrelated proteins such as BSA, gliadin and lysozyme giving A values not exceeding 0.08. Experiments in which the tTG was indirectly coupled to the ELISA plates using purified rabbit anti-tTG serum Igs gave similar results, indicating that significant denatur- ation upon binding to the plastic is not occurring (not shown). tTG fragments recognition by CD sera The tTG fragments were also tested with 24 sera from untreated CD patients. The results, reported as reactivity of the 24 sera against a given fragment are shown in Fig. 4A. Also in this case reactivity to full-length tTG, with ELISA A values comprised between 0.2 and 2, is set to 100% for simplicity. The overall recognition pattern of IgA antibodies show a trend very close to that of the cloned antibodies, with Fig. 3. ELISA of tTG, 12 tTG fragments and GP tTG. Full-length tTG are set to 100 and the A values for the individual tTG fragments normalized as a corresponding percentage. The upper table reports the absolute A values. The values correspond to the mean value of experiments in triplicate. Primary antibodies: four cloned scFvs to tTG. Secondary antibodies: mAb SV5 and goat anti-mouse Ig conjugated with peroxidase. Substrates: H 2 O 2 and TMB. Fig. 2. Western blots of 12 purified tTG fragments. (A) Primary antibody, mAb His-probe. (B) Primary antibody, mAb CUB 7042. Secondary antibody, goat anti-(mouse Ig) conjugated with alkaline phosphatase. Substrates were BCIP and Nitro Blue tetrazolium. Top right, full-length tTG reported for reference. 5178 D. Sblattero et al. (Eur. J. Biochem. 269) Ó FEBS 2002 tTG fragments tTG/1, /2, /3, /7 and /11 being clearly recognized. To further confirm the specificity of recognition of tTG fragments by CD serum antibodies, 12 sera from nonceliac patients with anti-tTG responses, were analyzed. These showed a scattered response against all fragments, unlike the CD patients. Here two fragments negative for CD patients (tTG/4 and 8) and two positive (tTG/7 and 11) are reported as examples. All these false positive sera were previously demonstrated to have low titer (A ranging from 0.2 to 0.6) anti-tTG Igs whereas the donors did not show any other CD marker such as CD associated HLA alleles or jejunal biopsy with mucosal lesion although with CD related symptoms such as recurrent abdominal pain and failure to thrive. The results are reported in Fig. 4B. In this case all the fragments, including tTG/4 and tTG/8, were recognized from most of the sera although to a different extent. The results of the two experiments were roughly the same for both IgA and IgG. No reactivity (A <0.2)was registered on all tTG fragments using control sera from 20 healthy donors. DISCUSSION The cloning of tTG fragments on the basis of the modeled three-dimensional structure [8–10] coupled with the map- ping of the residues involved in the functionality of the molecule [5,10,19] allowed us to express and purify stable tTG domain polypeptides. The low degree of protein degradation, as attested by Western blotting, probably reflects the fact that individual domains, which are likely to be resistant to bacterial proteases, were expressed. Although not examined formally, these fragments were found to be stable, as little or no degradation, as well as no change in ELISA A values, were registered after months of storage at )20 °C. By using mAbs recognizing the His tag and a linear epitope within tTG as positive controls for expression, we were able to normalize the coating of these fragments to ELISA wells for a better interpretation of the reactivity of cloned antibodies and patients’ sera. The overall response of the cloned antibodies indicates that the recognized region is located in the core of tTG spanning a sequence not exceeding 237 amino acids (amino acids 140–376), as proved by the reactivity of tTG/11, tTG/7, which overlap by this region only. However, this conclusion is slightly complicated by the lack of recognition of this core element by tTG/4,/5,/6, which nevertheless contain it. This suggests the epitope is a conformational one which requires full- length N or C terminal domains for either stability or correct folding, as shown by recognition of tTG/1, /2 and /3. The possibility that unfolding of the tTG on the plastic was responsible for these slightly discordant results was explored by doing an indirect ELISA with the tTG fixed using plates coated with purified rabbit anti-tTG poly- clonal Igs rather than by adsorption to the plastic. The results were identical to those presented. With respect to the two putative epitopes Ep1/GP+ and Ep2/GP–, appropriate antibodies show the same qualitative pattern of reactivity, with some quantitative differences. The Ep2/ GP– antibodies (in the example in Fig. 3, reported as 2.15 and 4.2) seem to be influenced by possible steric hindrance caused by the loop segment as proved by the difference in the level of recognition of tTG/1 and tTG/2. Because the loop has been shown to undergo structural changes when the tTG molecule is activated by calcium ions [9], we tested the reactivity of the tTG/1 and /2 fragments in the presence of either Ca 2+ or EDTA, but observed no effect. Comparison of human and GP tTG shows a limited number of differences in the amino acidic sequence, but these are scattered along the mapped antigenic region preventing reliable identification of the site recognized by Ep2 antibodies. No further information could be obtained from the analysis of the recognition of cloned rat and mouse tTG (data not shown), which gave a similar recognition pattern to GP tTG. Interestingly, all the serum antibodies from CD patients, tested individually showed the same reactivity pattern, attesting the presence of antibodies recognizing both Ep1 and Ep2, whereas no reactivity to all the tTG fragment was registered using sera from healthy donors. It has been proposed that phage antibody libraries may be used as surrogates for the humoral immune response of an autoimmune patient. In our case, agreement was almost perfect, confirming that the humoral autoimmune response in CD involves two main immunodominant epitopes, with no exceptions noted among the limited number of sera tested. A further control Fig. 4. ELISA of tTG and tTG fragments. Full-length tTG are set to 100 and the A values for the individual tTG fragments normalized as a corresponding percentage. (A) Primary antibody, 24 sera from untreated CD patients. (B) Primary antibody, 12 sera from non-CD patients affected by other pathologies and with a serum antibody response to tTG. Secondary antibodies, goat anti-(human IgA) conjugated with peroxidase. The dash represents the average of the values. Ó FEBS 2002 Epitope mapping of anti-tTG Igs (Eur. J. Biochem. 269) 5179 is given by the use of sera to tTG from nonceliac donors. All these patients were affected by non CD pathologies but with a detectable serum titer to tTG. In this case, all tTG fragments were recognized, including those not recognized by CD sera. This finding suggests that the epitope/s identified by the antibody clones are a distinctive marker of CD and raises the question whether they may play a role in the onset of the illness. In a recent work, Seissler et al. [20] analyzed the recognition pattern of CD sera by using tTG deletion mutants similar to those described in this work. The authors find similar results to ours, with the exception of their response to the C terminus, which was absent in our analyses. This is likely to be due to the differences in the methods used (immunoprecipitation of radioactive tTG instead of ELISA on plastic bound fragments), as well as the different fragments which are not identical. We cannot exclude the possibility that a CD serum response is directed to other epitopes, especially against the C terminal part of tTG, which may be hidden in the fragments we used. Conformational epitopes are not exclusive to CD. In autoimmune diabetes, the major autoantigen GA65 has recently been found to expose nonlinear autoantigenic sequences [21]. In our case, the minimal reactive antigenic region we managed to identify, spans 237 amino acids in the core domain, although it appears to require flanking sequences for stability. This domain is formed mainly by a-helices and harbors part of the putative calcium and GTP binding regions [10,12] and the catalytic triad formed by Cys277, His335 and Asp358 [11]. Interestingly, all three of these amino acids are comprised in the antigenic region we have identified. During the course of inhibition experiments [22], we have demonstrated that the cloned antibodies to tTG inhibit the in vitro enzymatic activity of tTG. We interpret this result as indicating either a direct interaction with the triad amino acids or a consequence of steric hindrance causing an interference in enzymatic activity. In conclusion, by analyzing individual phage antibodies isolated from patient libraries on the tTG fragments, we have been able to restrict the antigenic region recognized to the enzymatic core of tTG which is selectively recognized by all the cloned antibodies as well as CD serum antibodies. The role of the humoral response to tTG has not been clarified yet, and the possibility of in vivo inhibition of the enzymatic activity of tTG by CD autoantibodies should be carefully considered. CD is frequently accompanied by other autoimmune pathologies whose onset might be strictly related to CD, as in patients on gluten-free diet the risk of other autoimmune disorders drops dramatically [23]. Transgenic mice lacking tTG have been shown to exhibit altered thymocyte populations [24,25]. The question arises whether antibodies to tTG occurring in CD may cause autoimmune cell clones to escape negative selection and apoptosis as recently pro- posed [26]. Our procedure offers a novel approach for the characterization of conformational epitopes possibly involved in these mechanisms. ACKNOWLEDGMENTS This study was supported by grants n.E.1141 from Telethon and number 2001063713/002 from MIUR. REFERENCES 1. Goggins, M. & Kelleher, D. (1994) Celiac disease and other nutrient related injuries to the gastrointestinal tract. Am. J. Gas- troenterol. 89, S2–S17. 2. Wieser, H. (1996) Relation between gliadin structure and coeliac toxicity. Acta Paediatr. Suppl. 412, 3–9. 3. Dieterich, W., Ehnis, T., Bauer, M., Donner, P., Volta, U., Riecken, E.O. & Schuppan, D. (1997) Identification of tissue transglutaminase as the autoantigen of celiac disease. Nat. Med. 3, 797–801. 4. Greenberg, C.S., Birckbichler, P.J. & Rice, R.H. (1991) Trans- glutaminases: multifunctional cross-linking enzymes that stabilize tissues. FASEB J. 5, 3071–3077. 5. Iismaa,S.E.,Wu,M.J.,Nanda,N.,Church,W.B.&Graham, R.M. (2000) GTP binding and signaling by Gh/transglutaminase II involves distinct residues in a unique GTP-binding pocket. J. Biol. Chem. 275, 18259–18265. 6. Nakaoka, H., Perez, D.M., Baek, K.J., Das, T., Husain, A., Misono,K.,Im,M.J.&Graham,R.M.(1994)Gh:aGTP-binding protein with transglutaminase activity and receptor signaling function. Science 264, 1593–1596. 7. Melino, G., Annicchiarico-Petruzzelli, M., Piredda, L., Candi, E., Gentile, V., Davies, P.J. & Piacentini, M. (1994) Tissue trans- glutaminase and apoptosis: sense and antisense transfection studies with human neuroblastoma cells. Mol. Cell. Biol. 14, 6584– 6596. 8. Yee, V.C., Pedersen, L.C., Le Trong, I., Bishop, P.D., Stenkamp, R.E. & Teller, D.C. (1994) Three-dimensional structure of a transglutaminase: human blood coagulation factor XIII. Proc. Natl Acad. Sci. USA 91, 7296–7300. 9. Casadio, R., Polverini, E., Mariani, P., Spinozzi, F., Carsughi, F., Fontana, A., Polverino de Laureto, P., Matteucci, G. & Berga- mini, C.M. (1999) The structural basis for the regulation of tissue transglutaminase by calcium ions. Eur. J. Biochem. 262, 672–679. 10. Liu, S., Cerione, R.A. & Clardy, J. (2002) Structural basis for the guanine nucleotide-binding activity of tissue transglutaminase and its regulation of transamidation activity. Proc. Natl Acad. Sci. USA 99, 2743–2747. 11. Pedersen, L.C., Yee, V.C., Bishop, P.D., Le Trong, I., Teller, D.C. & Stenkamp, R.E. (1994) Transglutaminase factor XIII uses proteinase-like catalytic triad to crosslink macromolecules. Protein Sci. 3, 1131–1135. 12. Nakanishi, K., Nara, K., Hagiwara, H., Aoyama, Y., Ueno, H. & Hirose, S. (1991) Cloning and sequence analysis of cDNA clones for bovine aortic- endothelial-cell transglutaminase. Eur. J. Bio- chem. 202, 15–21. 13. McIntosh, R.S., Asghar, M.S., Watson, P.F., Kemp, E.H. & Weetman, A.P. (1996) Cloning and analysis of IgG kappa and IgG lambda anti-thyroglobulin autoantibodies from a patient with Hashimoto’s thyroiditis: evidence for in vivo antigen-driven rep- ertoire selection. J. Immunol. 157, 927–935. 14. Finnern, R., Bye, J.M., Dolman, K.M., Zhao, M.H., Short, A., Marks, J.D., Lockwood, M.C. & Ouwehand, W.H. (1995) Molecular characteristics of anti-self antibody fragments against neutrophil cytoplasmic antigens from human V gene phage dis- play libraries. Clin. Exp. Immunol. 102, 566–574. 15. Marks, J.D., Hoogenboom, H.R., Griffiths, A.D. & Winter, G. (1992) Molecular evolution of proteins on filamentous phage. Mimicking the strategy of the immune system. J. Biol. Chem. 267, 16007–16010. 16. Marzari, R., Sblattero, D., Florian, F., Tongiorgi, E., Not, T., Tommasini,A.,Ventura,A.&Bradbury,A.(2001)Molecular dissection of the tissue transglutaminase autoantibody response in celiac disease. J. Immunol. 166, 4170–4176. 17. Gentile, V., Saydak, M., Chiocca, E.A., Akande, O., Birckbichler, P.J., Lee, K.N., Stein, J.P. & Davies, P.J. (1991) Isolation and characterization of cDNA clones to mouse macrophage and 5180 D. Sblattero et al. (Eur. J. Biochem. 269) Ó FEBS 2002 human endothelial cell tissue transglutaminases. J. Biol. Chem. 266, 478–483. 18. Hanke, T., Szawlowski, P. & Randall, R.E. (1992) Construction of solid matrix–antibody–antigen complexes containing simian immunodeficiency virus p27 using tag-specific monoclonal anti- body and tag-linked antigen. J. Gen. Virol. 73, 653–660. 19. Di Venere, A., Rossi, A., De Matteis, F., Rosato, N., Agro, A.F. & Mei, G. (2000) Opposite effects of Ca(2+) and GTP binding on tissue transglutaminase tertiary structure. J. Biol. Chem. 275, 3915–3921. 20. Seissler, J., Wohlrab, U., Wuensche, C., Scherbaum, W.A. & Boehm, B.O. (2001) Autoantibodies from patients with coeliac disease recognize distinct functional domains of the autoantigen tissue transglutaminase. Clin. Exp. Immunol. 125, 216–221. 21. Myers,M.A.,Davies,J.M.,Tong,J.C.,Whisstock,J.,Scealy,M., Mackay,I.R.&Rowley,M.J.(2000)Conformationalepitopeson the diabetes autoantigen GAD65 identified by peptide phage display and molecular modeling. J. Immunol. 165, 3830–3838. 22. Esposito, C., Paparo, F., Caputo, I., Rossi, M., Maglio, M., Sblattero, D., Not, T., Porta, R., Auricchio, S., Marzari, R. & Troncone, R. (2002) Serum immunoglobulin A and G, and monoclonal antibodies anti-tissue transglutaminase from coeliac patients inhibit the catalytic activity both in vitro and in situ. Gut 51, 177–181. 23. Ventura, A., Magazzu, G. & Greco, L. (1999) Duration of exposure to gluten and risk for autoimmune disorders in patients with celiac disease. SIGEP Study Group for Autoimmune Disorders in Celiac Disease. Gastroenterology 117, 297–303. 24. Nanda, N., Iismaa, S.E., Owens, W.A., Husain, A., Mackay, F. & Graham, R.M. (2001) Targeted inactivation of Gh/tissue trans- glutaminase II. J. Biol. Chem. 276, 20673–20678. 25. De Laurenzi, V. & Melino, G. (2001) Gene disruption of tissue transglutaminase. Mol. Cell. Biol. 21, 148–155. 26. Piacentini, M. & Colizzi, V. (1999) Tissue transglutaminase: apoptosis versus autoimmunity. Immunol. Today 20, 130–134. Ó FEBS 2002 Epitope mapping of anti-tTG Igs (Eur. J. Biochem. 269) 5181 . The analysis of the fine specificity of celiac disease antibodies using tissue transglutaminase fragments Daniele Sblattero 1 ,. identical to the region recognized by anti -transglutaminase Igs found in the serum of celiac disease patients. Keywords: autoimmunity; celiac disease; transglutaminase; epitope