preparation of haloalkenes and alkenylboronic acid derivatives important building blocks for palladium mediated c c couplings carbocupration of alkynes
Reductive Cleavage of N-O Bonds in Hydroxylamines and Hydroxamic Acid Derivatives Using Samarium Diiodide pot
... success of these reactions using SmI2 prompted us to examine the reductive cleavage of the N-O bond of N-benzyl-N-acetylhydroxamic acid (Table 3, Entries and 2) Typically hydroxamic acids are cleaved ... quenched with acetic anhydride, dReaction was quenched with Irifluoroacetic anhydride Reductive cleavage of N-acyl derivatives typically afforded high isolated yields of the desired products, ... 1726, 1531 cm'l; Anal Calcd for CI9HsF3NO3: C, 48.59; H, 3.26; N, 5.67 Found: C, 48.57; H, 3.26; N, 5.66 General Procedure for the Reductive Cleavage o f N-O Bonds o f N-Acylhydroxamic Acid Derivatives...
- 18
- 173
- 1
Design of CMOS receivers and building blocks for ultra wideband radio
... Parasitic capacitance of transconductor C p _ OTA Parasitic capacitance of OTA C gm Equivalent capacitor in transconductor COTA Equivalent capacitor in integrator CCM Capacitor in common mode feedback ... Transconductance of transconductor Ro _ Gm Output resistance of transconductor Gm _ OTA Transconductance of OTA AOTA DC gain of OTA xv C2 , C1 Equivalent miller capacitors in integrator C p _ ... receiver architecture and the self-synchronized non-coherent UWB receiver architecture are proposed Chapter concentrates on design of UWB receiver building blocks for ultra-wideband application and...
- 114
- 495
- 0
Structure, Properties, and Preparation Of Boronic Acid Derivatives Overview of Their Reactions and Applications
... that of ammo- 10 Structure, Properties, and Preparation Of Boronic Acid Derivatives Table 1.2 Ionization constant (pKa) for selected boronic acids Boronic acid, RB(OH)2 pKa Reference Boric acid, ... “indirect” proton transfer that characterizes the acidity of most boronic acids in water Hence, the most acidic boronic acids possess the most electrophilic boron atom that can best form and stabilize ... the highly acidic conditions of ring nitration under fuming nitric acid and concentrated sulfuric acid [81] Kuivila and co-workers [81, 82] have studies the effect of acid, temperature, and ring...
- 100
- 556
- 0
Tài liệu Báo cáo Y học: The b-1,4-endogalactanase A gene from Aspergillus niger is specifically induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions pdf
... Enhanced Avian RT-PCR kit (Sigma) according to the suppliers instructions using galA-speci c oligonucleotides (5¢-GATGATCTACCCTCTGCTTC-3¢ and 5¢-GTC ACGGACGGACTGGGT-3¢) Northern analysis was performed ... DpgaB, goxC17 [42] [43] NW290 [44] CCACAACCAC-3¢, respectively) and used in PCRs under the following conditions: denaturing at 95 C, annealing at 50 C and amplification at 72 C, 30 cycles Chromosomal ... transgalactooligosaccharides (TOS) PCR cloning of a speci c fragment of galA Two oligonucleotides were designed based on the sequence of the A aculeatus b-1,4-endogalactanase encoding gene (5¢-CTCTTCTCTCTTGCTCTTG-3¢...
- 9
- 669
- 0
Báo cáo y học: " Preparation of RGD-modified Long Circulating Liposome Loading Matrine, and its in vitro Anti-cancer Effects"
... ×100% Cell culture The A375 melanoma cell line was purchased from the Shanghai Institute of Cell Biology, Chinese Academy of Sciences (Shanghai, China) The breast cancer Bcap-37 and colon cancer ... distal end of the PEG chain on the LCL and the -SH group in the cyclic RGD peptide (19) HPLC analysis of the coupling of RGD to LCL Free Cyclo-RGD (250μg/mL or 15μg/mL) and conjunctive RGD-LCL equivalent ... tumor-specificity and therapeutic efficacy The use of these specific “vector” molecules showing affinity toward certain receptors or antigens highly expressed on the surface of the target tumor cells...
- 12
- 635
- 0
Application of Hydrothermal Reaction to Biodegradability Improvement of Refractory Pollutants: Structural Conversion of Di- and Trichloroacetic Acid to Biodegradable Products
... % of glycolic acid and % of formic acid were detected in The amount of malic acid decreased, and was converted into more simple organic acids as reaction time increased Glycolic acid increased ... Glycolic acid Malic acid H2O O C CO2 + H2O H HCl H C O C OH O Hydrolysis, Dehydration HO C Cl C OH O TCAA H2O HCl H Hydrolysis, Thermal decomposition Thermal decomposition C C OH H Citric acid* * ... to glycolic acid by thermal decomposition After the production of glycolic acid, reaction pathway was not different from that of MCAA TCAA was rapidly converted to glycolic and formic acid by...
- 8
- 643
- 0
Characterization of the Carbon Stable Isotope Ratio and Fatty Acid Structure of Zostera japonica in Coastal Areas
... research shows the characteristics of carbon stable isotope and fatty acid structure of Z japonica Furthermore, we compared the characteristics of carbon stable isotope and fatty acid structure of ... quantity of lipid, the content ratios of all the fatty acids, and the ratio of each fatty acid RESULTS AND DISCUSSION Characteristics of carbon stable isotope in Z japonica The mean δ1 3C of Z japonica ... that of the roots and rhizomes For example, the δ1 3C of HCO3- is higher than δ1 3C of CO2 in sea water Characteristics of fatty acid structure in Z japonica We found about 30 kinds of fatty acids...
- 9
- 614
- 2
Tài liệu Báo cáo khóa học: Active-site residues and amino acid specificity of the bacterial 4¢-phosphopantothenoylcysteine synthetase CoaB pptx
... (forward) 5¢-GCCAGTTTTGAATTCTGGAAAGCGC CTCG-3¢ and (reverse) 5¢-CGGGTCCAAGATCTTAA CGTCGATTTTTTTC-3¢ as primers (introduced EcoRI and BglII sites are underlined) and the purified chromosomal DNA as template ... the C- terminal CoaB domain from 4¢-phosphopantothenic acid, CTP and cysteine The synthesis of PPC occurs in two half reactions starting with the formation of 4¢-phosphopantothenoyl-CMP (activation ... of His-CoaA and His-CoaB proteins For purification of His-CoaA and His-CoaB proteins, 500 mL of IPTG-induced E coli M15 (pREP4, pQE8 coaA/coaB) cells were harvested and disrupted by sonication...
- 10
- 490
- 0
Tài liệu Báo cáo khoa học: The SCO2299 gene from Streptomyces coelicolor A3(2) encodes a bifunctional enzyme consisting of an RNase H domain and an acid phosphatase domain pdf
... PCR using S coelicolor genomic DNA as a template The PCR primers were 5¢-CCTCCTC CTCATATGGCTGACCAGGCGCCCCGCCCCGCGC-3¢ (5¢-F primer) as 5¢-primer and 5¢-GGTGGTGGTAGAT CTTTATCAGCGCAGGTGGGACGTCTCGTTG-3¢ ... 3¢-primer for the full length gene; the 5¢-F primer as 5¢-primer and 5¢-GGCGCGAGATCTTTATTACGC GTCGAGCTCCGCCGTCGAGTC-3¢ as 3¢-primer for the RNase H domain; and 5¢-GGGCCGCCCCATATGGG CGCCCCCGCGACCTTC-3¢ ... Corynebacterium glutamicum; Cef, CE2133 of Corynebacterium efficiens; Cdi, DIP1678 of Corynebacterium diphtheriae; Mtu, Rv222 8c (or MT2287) of Mycobacterium tuberculosis; Mle, ML1637 of Mycobacterium...
- 10
- 561
- 1
Tài liệu Báo cáo Y học: Bivalent cations and amino-acid composition contribute to the thermostability of Bacillus licheniformis xylose isomerase doc
... activating cation for BLXI activity on glucose BLXI activity in the presence of Mn2þ and Mg2þ reached only 6% and 15%, respectively, of the activity in the presence of Co2þ (Fig 4A) Co2þ, Mn2þ, and ... (1997) Cloning, sequencing, and expression of the gene encoding extracellular a-amylase from Pyrococcus furiosus and biochemical characterization of the recombinant enzyme Appl Environ Microbiol ... presence of increasing concentrations of each cation (in the chloride form; Fig 4) In the absence of metal, the apoenzyme was completely inactive on both substrates Co2þ was by far the best activating...
- 11
- 478
- 0
Mechanical preparation of root canals: shaping goals, techniques and means potx
... manual Mac-Files, hand & rotary NiTi system Extracted teeth Resin blocks Resin blocks Extracted teeth Extracted teeth Resin blocks Resin blocks Resin blocks Resin blocks Resin blocks Resin blocks ... Mechanical preparation of root canals contradictory and no definite conclusions on the usefulness of hand and/ or rotary devices can be drawn, Major deficiencies of studies on quality of root canal ... preparation of simulated canals in resin blocks Apical blockage Apical blockage of the root canal occurs as a result of packing of tissue or debris and results in a loss of working length and of root canal...
- 47
- 924
- 0
Báo cáo " Preparation of nano-structural MnO2 in ethanol-water media coated on calcinated laterite and study of its arsenic adsorption capacity " docx
... Equilibrium in the form of D.K Loan et al / VNU Journal of Science, Natural Sciences and Technology 24 (2008) 227-232 C aq Cs = C aq + b .C m C m where Caq and Cs is arsenic equilibration concentration ... effect on nanoscale particles formation may caused by changing of property and structure of solution The changing property of solution may include firstly dielectric coefficient and surface tensity ... relation between Caq/Cs upon Caq is linear curve with angle coefficient 1/Cm and inverse value of this coefficient is Cmax 231 chemical precipitation was used for developing effectivity of nanodimensional...
- 6
- 516
- 0
Báo cáo khoa học: Involvement of NF-jB subunit p65 and retinoic acid receptors, RARa and RXRa, in transcriptional regulation of the human GnRH II gene pot
... Mut10 ACTAAGCTTAAAAGGGGACTTCTCTGGCATGGTTCAGGTTTGGAGGCACCTGGGA ACTAAGCTTAAAAGGGGACTTCTCTGGCATGGTTCCTGGGTGGAGGCACCTG ACTAAGCTTAAAAGGGGACTTCTCTGGCATGGGGCAGGGGTGGAGGCAC ACTAAGCTTAAAAGGGGACTTCTCTGGCAGTGTTCAGGGGTGGAGG ... ACTAAGCTTAAAAGGGGACTTCTCTGGCAGTGTTCAGGGGTGGAGG ACTAAGCTTAAAAGGGGACTTCTCTGTAATGGTTCAGGGGTGG ACTAAGCTTAAAAGGGGACTTCTAGGGCATGGTTCAGGGG ACTAAGCTTAAAAGGGGACTGATCTGGCATGGTTCAGGGG ACTAAGCTTAAAAGGGGCATTCTCTGGCATGGTTCAGGGG ACTAAGCTTAAAAGTTGACTTCTCTGGCATGGTTCAGGGG ... oligonucleotide, hGII-Sil (5¢-CCTCCACCCCTGAACCATGCCAGA-3¢), and nonspeci c L8 oligonucleotide were used For the supershift assay, speci c antibodies (rabbit polyclonal IgG; Santa Cruz Biotechnology...
- 12
- 399
- 0
preparation of wo3 nanoparticles and application to no2 sensor
... G Model APSUSC-18761; No of Pages D Meng et al / Applied Surface Science xxx (2009) xxx–xxx Fig Schematic diagram of the apparatus used for the formation of WO3 nanoparticles  10À6 kPa, ... introduced in the quartz tube as a reference gas, and then dry synthetic air including NO2 at a concentration of 200 ppm was added to the reference gas to obtain NO2 at a concentration of ppm ... 600, and 800 8C, respectively Please cite this article in press as: D Meng, et al., Preparation of WO3 nanoparticles and application to NO2 sensor, Appl Surf Sci (2009), doi:10.1016/j.apsusc.2009.05.075...
- 4
- 449
- 0
Báo cáo khoa học: Structural characterization of N-linked oligosaccharides of laminin from rat kidney: changes during diabetes and modulation by dietary fiber and butyric acid pdf
... mannose and galactose and amino sugar as N-acetylglucosamine, along with sialic acid which accounted for 22 and 35% of total carbohydrate content in SFC and SFD groups, respectively Purification of ... short-chain fatty acids like acetate and propionate [13] The bioactivities of butyric acid are related to its ability to modify nuclear architecture and induce apoptosis, changing the structure of ... was carried out in terms of total sugars, amino sugars and sialic acid (Table 2) The monosaccharide composition of oligosaccharides of laminin was determined by GLC after acid hydrolysis and...
- 13
- 336
- 0
Báo cáo khoa học: Glycan profiling of urine, amniotic fluid and ascitic fluid from galactosialidosis patients reveals novel oligosaccharides with reducing end hexose and aldohexonic acid residues ppt
... oligosaccharide and ceramide of neutral and acidic glycosphingolipids J Biol Chem 261, 14278–14282 37 Ito M & Yamagata T (1989) Purification and characterization of glycosphingolipid-speci c endoglycosidases ... (a1–6)Man(b1–4)GlcNAc Neu5Ac(a2–6)Gal(b1–4) GlcNAc(b1–2)Man(a1–3) Man(b1–4)GlcNAc Neu5Ac(a2–3)Gal(b1–4) GlcNAc Neu5Ac(a2–6)Gal(b1–4)Glc NAc Proposed structure Novel oligosaccharides in galactosialidosis C Bruggink ... aldohexonic acid were assumed A linkage of hexose to the C4 of aldohexonic acid is postulated The proposed structure for HX is Gal(b1–4)GluconA (gluconic acid) , which may be interpreted as the C1 -oxidized...
- 17
- 291
- 0
Báo cáo khoa học: Binding of hemolin to bacterial lipopolysaccharide and lipoteichoic acid An immunoglobulin superfamily member from insects as a pattern-recognition receptor doc
... inner-core and an outer-core subdomain The inner core is composed of KDO and heptoses, while the outer core contains hexoses, primarily glucose, galactose, and GlcNAc The O-speci c antigen consists ... specifically bound to the surface of · 105 E coli cells (Fig 2), indicating that 106 molecules of hemolin bound to each E coli cell Because Gram-negative bacteria contain 106 molecules of ... O-speci c antigen structure [25,26], this result suggests that hemolin can bind to the O-speci c antigen of 0111:B4 Ra-LPS, which lacks an O-speci c antigen, and Rc-LPS, which also lacks part of...
- 8
- 336
- 0
chemistry of superconductor materials; preparation, chemistry, characterization and theory, vanderah, 839pp
... calculated powder patterns for nearly all of the superconducting cuprates Two chapters cover structural and chemical characterization by electron microscopy, a technique particularly important for ... Introduction and Crystal Chemistry of Oxide Superconductors primarily by the chemical composition and the structural arrangement of atoms These two factors are of primary concern to the chemist and ... these metallic organic the phenomenon of superconductivity was detected The Historical Introduction and Crystal Chemistry of Oxide Superconductors TABLE OONORS ACCEPTORS TCNO CM CM TNAP Hoxrfluorophoophrtr...
- 839
- 286
- 0
CITY OF BEAUFORT REQUEST FOR PROPOSALS FINANCIAL STATEMENT PREPARATION (Part I) AND FINANCIAL AUDIT SERVICES (Part II) pdf
... Financial Auditing Services The successful offeror will be required to accept the terms and conditions of the City’s standard contract for these services The content of this RFP and the successful ... Guidance not specifically listed above 4.4 Certificate of Achievement for Excellence in Financial Reporting Auditor shall provide advice, consultation and assistance in connection with the preparation ... Governmental Accounting Standards Board and Auditor General and any amendments thereto with supplemental schedules for sub-funds and consistent with GFOA Certificate of Achievement Standards and Practices...
- 11
- 360
- 0
Báo cáo toán học: " Selective preparation of zero- and onedimensional gold nanostructures in a TiO2 nanocrystal-containing photoactive mesoporous template" pdf
... therefore, can reach the neighboring Au nanoclusters and are reduced on the surface of the nanoclusters by autocatalysis of Au [21,22], resulting in the formation of 1-D GNSs because the growth of ... Grants-in-Aid for Young Scientists (Start-up) 21860045 and Young Scientists (B) 22760539 from the Japan Society for the Promotion of Science (JSPS) Author details Department of Electrical and Electronic ... photocatalytic activity of periodic mesoporous nanocrystalline anatase thin films J Mater Chem 2007, 17:82 27 Aprile C, Corma A, Garcia H: Enhancement of the photocatalytic activity of TiO2 through...
- 8
- 370
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ lồng sóc đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25