Báo cáo khoa học: Involvement of NF-jB subunit p65 and retinoic acid receptors, RARa and RXRa, in transcriptional regulation of the human GnRH II gene pot

Involvement of NF-jB subunit p65 and retinoic acid receptors, RARa and RXRa, in transcriptional regulation of the human GnRH II gene Ruby L. C. Hoo 1, *, Kathy Y. Y. Chan 2 , Francis K. Y. Leung 1 , Leo T. O. Lee 1 , Peter C. K. Leung 3 and Billy K. C. Chow 3 1 School of Biological Sciences, University of Hong Kong, Pokfulam Road, Hong Kong, China 2 Department of Paediatrics, Chinese University of Hong Kong, Prince of Wales Hospital, Shatin, Hong Kong, China 3 Department of Obstetrics and Gynecology, University of British Columbia, Vancouver, Canada In humans, the genes for gonadotropin-releasing hor- mones (GnRH I and GnRH II) have the same modu- lar structure, harboring three introns and four exons. The exons encode a precursor polypeptide consisting of a signaling peptide, the GnRH decapeptide, and the GnRH-associated peptide (GAP) with unknown func- tion [1]. The promoter region of the human (h)GnRH II gene is located at the 5¢ flanking region, the untranslated exon 1, intron 1, and exon 2. The locations of exon 1, intron 1 and exon 2 are )793 ⁄ )750 (relative to the +1 translation start codon ATG), )749 ⁄ )8 and )7 to +154, respectively. Despite similar gene structures, GnRH I and GnRH II genes are regulated by different regulatory elements. Multiple regulatory sites have been identified in the promoter of the hGnRH II gene. In 2001, Chen et al. [2] identified a putative cAMP-response element (CRE) site at nucleotide sequence )860 to )853. The Keywords gonadotropin-releasing hormone II; NF-jB subunit p65; retinoic acid receptors; silencer; transcriptional regulation Correspondence B. K. C. Chow, School of Biological Sciences, University of Hong Kong, Pokfulam Road, Hong Kong, China Tel: +852 2299 0850 Fax: +852 2857 4672 E-mail: bkcc@hkusua.hku.hk *Present address Department of Medicine, Li Ka Shing Faculty of Medicine, University of Hong Kong, Queen Mary Hospital, Hong Kong (Received 1 November 2006, revised 19 March 2007, accepted 22 March 2007) doi:10.1111/j.1742-4658.2007.05804.x Gonadotropin-releasing hormone (GnRH) I and II are hypothalamic deca- peptides with pivotal roles in the development of reproductive competence and regulation of reproductive events. In this study, transcriptional regula- tion of the human GnRH II gene was investigated. By scanning mutation analysis coupled with transient promoter assays, the motif at )641 ⁄ )636 (CATGCC, designated GII-Sil) was identified as a repressor element. Mutation of this motif led to full restoration of promoter activity in TE671 medulloblastoma and JEG-3 placenta choriocarcinoma cells. Supershift and chromatin immunoprecipitation assays showed in vitro and in vivo binding of NF-jB subunit p65 and the retinoic acid receptors, RARa and RXRa, to the promoter sequences. Over-expression of these protein factors indicated that p65 is a potent repressor, and the RARa ⁄ RXRa heterodimer is involved in the differential regulation of the GnRH II gene in neuronal and placental cells. This was confirmed by quantitative real-time PCR. Treatment of cells with the RARa ⁄ RXRa ligands, all-trans retinoic acid and 9-cis-retinoic acid, reduced and increased GnRH II gene expression in TE671 and JEG-3 cells, respectively. Taken together, these data demon- strate the differential roles of NF-jB p65 and RARa ⁄ RXRa, interacting with the same sequence in the promoter of the human GnRH II gene to influence gene expression in a cell-specific manner. Abbreviations ATRA, all-trans retinoic acid; ChIP, chromatin immunoprecipitation; CRE, cAMP-response element; EMSA, electrophoretic mobility-shift assay; GAP, GnRH-associated peptide; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GnRH, gonadotropin-releasing hormone; HDAC, histone deacetylase; L-CoR, ligand-dependent corepressor; N-CoR, nuclear receptor corepressor; RA, retinoic acid; RAR, retinoic acid receptor. FEBS Journal 274 (2007) 2695–2706 ª 2007 The Authors Journal compilation ª 2007 FEBS 2695 same research group also demonstrated that GnRH II, but not GnRH I, is potently up-regulated by a cAMP analog in human neuronal medulloblastoma cells TE671. From deletion and mutation analysis, it was concluded that the CRE site is responsible for both the basal activity and cAMP induction of the hGnRH II promoter. Similarly to the case of cAMP stimulation, it has been reported that estrogen regulates the expres- sion of GnRH I and GnRH II differentially. Estrogen treatment down-regulates the promoter activity of GnRH I but up-regulates GnRH II promoter activity. Indeed, analysis of the promoter sequence has revealed a partial putative estrogen-responsive element site and an SP1 site at positions )1252 ⁄ )1256 and )1726 ⁄ )1717, respectively [3]. In addition to cAMP and estrogen, other hormonal regulation of GnRH II expression has been investigated. In human granulolu- teal cells, treatment with follicle-stimulating hormone or human choriogonadotropin was reported to increase GnRH II mRNA level but decrease GnRH I mRNA level [4]. It is of interest that GnRH II was reported to be self-regulated in the same study. Significant decrea- ses in GnRH II and GnRH receptor mRNA levels were observed in cells treated with GnRH II or its agonist. Our research group has previously identified a min- imal promoter and two enhancer elements (E-boxes) and Ets-like element in the untranslated first exon functioning co-operatively to achieve full promo- ter activity [5]. A silencing element in the first intron, which has a significant repressive effect on the GnRH II gene, has also been reported [6]. The present study aimed to define the cis-acting element and investigate the protein factors involved in regulation of the hGnRH II gene in TE61 and JEG-3 cells. These cell lines, which endogenously co-express GnRH I and GnRH II, are valuable models for examining tran- scriptional regulation of the GnRH II gene [7,8]. Results Fine mapping of the cis-acting element at )650 ⁄ )620 To characterize the hGnRH II intronic silencer and to identify the location of the cis-acting element(s) within this region, a series of mutant constructs, scanning mutants Mut1 to Mut10 as shown in Fig. 1A, were generated from the wild-type pGL2-()2103 ⁄ )620) con- struct. The 30 base pairs at )650 ⁄ )620 was a potent silencing element in both cell lines, significantly repressing promoter activity to 17.6 ± 0.7% and 31.2 ± 1.6% in TE671 and JEG-3 cells, respectively. In TE671 cells, Mut3, Mut4, Mut5 and Mut6 signifi- cantly [P < 0.001 versus pGL2-()2103 ⁄ )620) (wild- type)] restored promoter activity to 44.0%, 87.1%, 85.1% and 42.0% (compared with full promoter activ- ity), respectively (Fig. 1B). Mut4 and Mut5 restored almost full promoter activity (87.1% and 85.1%). Sim- ilar results were observed in JEG-3 cells (Fig. 1C): Mut3, Mut4, and Mut5 significantly [P < 0.001 versus pGL2-()2103 ⁄ )620) (wild-type)] restored promoter activity to 44.9%, 81.9% and 84.8%, respectively, with Mut4 and Mut5 restoring almost full promoter activity (81.9 ± 4.9% and 84.8 ± 9.8%, respectively). In con- trast, Mut6 did not show significant restoration of pro- moter activity in JEG-3 cells. It is interesting to note that Mut1 led to further significant [P < 0.001 versus pGL2-()2103 ⁄ )620) (wild-type)] repression in both cell lines. hGII-Sil is a novel silencing element of the hGnRH II gene Mutational analysis of the putative silencing element residing at )650 ⁄ )620 demonstrated the functional significance of the Mut4 and Mut5 region (CATGC- CAG, hGII-Sil). Electrophoretic mobility-shift assays (EMSAs) using the radiolabeled hGII-Sil oligonucleo- tide as DNA probe were then performed to identify whether there is any specific DNA–protein binding Complex in this region. Although the hGII-Sil region had a similar gene-repressive effect in both cell lines, slightly different DNA–protein binding patterns were observed in EMSAs using TE671 and JEG-3 nuclear extracts (Fig. 2A). Three obvious DNA–protein com- plexes were observed in the EMSA with TE671 nuclear extract (Fig. 2A). Formation of Complex A and Com- plex B were dose-dependently inhibited by the unlabe- led DNA probe, and Complex A was completely diminished in 200-fold excess unlabeled competitor. This implies that the binding of protein factors in Complex A and Complex B with the putative silencer is specific. In JEG-3 cell lines, three retarded DNA– protein complexes were also observed (Fig. 2A). Of these, only Complex C showed a specific interaction because it was the only Complex that was dose-depend- ently inhibited by self competition. Furthermore, when a nonspecific unlabeled oligonucleotide (L8 oligonuc- leotide) was applied as the unlabeled competitor (Fig. 2B), formation of Complex A and Complex B was not inhibited. The presence of mutant oligonucleo- tides with mutations at the Mut4 and Mut5 region (Mut4+5 oligonucleotide) as the unlabeled competitor in the binding reaction fails to inhibit the formation of both Complex A and Complex B (Fig. 2B). Differential regulation of the GnRH II gene R. L. C. Hoo et al. 2696 FEBS Journal 274 (2007) 2695–2706 ª 2007 The Authors Journal compilation ª 2007 FEBS NF-jB subunit p65 and retinoic acid receptors, RARa and RXR, interact with hGII-Sil in TE671 cells According to the results of supershift assays, NF-jB p65 subunit antibody and RAR antibody abolished the formation of Complex A, indicating that the p65 subunit and members of the RAR family are involved in the DNA–protein Complex in TE671 cells. Intrigu- ingly, along with the abolition of Complex A forma- tion by RAR-specific antibody, there was a concomitant increase in the intensity of Complex B (Fig. 3A). Subsequent supershift assays using antibod- ies against different isoforms of RAR (RARa, RARb, RARc) and RXR were performed to identify which members of the RAR family were present in the DNA–protein Complex (Fig. 3B). Only RARa-specific antibody and RXR-specific antibody successfully abol- ished the formation of Complex A, indicating the involvement of RARa and RXR in the DNA–protein complex. Similarly to the supershift assay described in Fig. 3A, abolition of Complex A formation by RARa- specific antibody and RXR-specific antibody was accompanied by enhancement of Complex B. To show in vivo binding of p65, RAR and RXR to the hGII-Sil region, chromatin immunoprecipita- tion (ChIP) assays were performed (Fig. 4). We observed no PCR signals from the negative controls (No immunoprecipitation, lane 3; anti-rabbit IgG, lane 7; and PCR negative, lane 8). These controls indicate that there was neither nonspecific precipita- tion nor PCR contamination. Positive PCR signals A pGL2-Basic pGL2–(-2103/-650) pGL2–(-2103/-620) pGL2–(-2103/-620) Mut1 pGL2–(-2103/-620) Mut2 pGL2–(-2103/-620) Mut3 pGL2–(-2103/-620) Mut4 pGL2–(-2103/-620) Mut5 pGL2–(-2103/-620) Mut6 pGL2–(-2103/-620) Mut7 pGL2–(-2103/-620) Mut8 pGL2–(-2103/-620) Mut9 pGL2–(-2103/-620) Mut10 pGL2-Basic pGL2–(-2103/-650) pGL2–(-2103/-620) pGL2–(-2103/-620) Mut1 pGL2–(-2103/-620) Mut2 pGL2–(-2103/-620) Mut3 pGL2–(-2103/-620) Mut4 pGL2–(-2103/-620) Mut5 pGL2–(-2103/-620) Mut6 pGL2–(-2103/-620) Mut7 pGL2–(-2103/-620) Mut8 pGL2–(-2103/-620) Mut9 pGL2–(-2103/-620) Mut10 0 20 40 60 80 100 120 Relative promoter activity (% change) 0 20 40 60 80 100 120 Relative promoter activity (% change) TE671 B C JEG-3 Fig. 1. Fine mapping of the putative silencing element in the first intron of the hGnRH II gene. The series of mutational constructs (A) were cotransfected (1 l g each) with 0.5 pSV-b-gal vector into TE671 cells (B) and JEG-3 cells (C) using Lipofection Reagent GeneJuice. At 48 h post-transfection, cell lysate was prepared and used for luciferase and b-galactosidase assays. Luciferase values are normalized by b-galac- tosidase expression and are shown as percentage changes in relative promoter activities compared with that of pGL2-()2103 ⁄ )650), the hGnRH II promoter region with the putative 30-bp silencing element deleted, which is designated as having 100% promoter activity. Values are mean ± S.E.M. from at least three independent experiments each in triplicate. *Significant difference (P<0.001) versus control pGL2-()2103 ⁄ )620). R. L. C. Hoo et al. Differential regulation of the GnRH II gene FEBS Journal 274 (2007) 2695–2706 ª 2007 The Authors Journal compilation ª 2007 FEBS 2697 were detected using p65, RAR and RXR antibodies (lane 4–6) and in the positive control (lane 2). In summary, data from the ChIP assays indicate in vivo interaction of p65, RAR and RXR with the hGII-Sil promoter. Over-expression of NF-jB p65 subunit down-regulated hGnRH II gene expression Functional assays were carried out to identify the effect of these trans-acting elements on expression of A Nuclear extract Competitor (fold) Nuclear extract (µg) Complex A Complex B Non- specific binding Free probe Complex C Non- specific binding Non- specific binding Free probe TE671 JEG-3 0× 50× 100× 200× 0× 50× 100× 200× 15µg 0 µg B Nuclear extract Competitor (fold) Nuclear extract (µg) Complex A Complex B Non- specific binding Free probe 0× 0× 200× TE671 L8 non-specific oligo Mutant oligo 50× 100× 200× 15µg 15µg 0 µg 15µg 0 µg Fig. 2. Specific interaction of nuclear factors from TE671 and JEG-3 cells with the Mut4 and Mut5 (hGII-Sil) region in the putative silencer. (A) EMSAs to characterize the pro- tein factor(s) binding to the Mut4 and Mut5 (hGII-Sil) region in the putative intronic silen- cing element in TE671 and JEG-3 cells. Syn- thetic oligonucleotides of hGII-Sil were annealed to form dsDNA before radiolabe- ling with c 32 P. The radiolabeled 24-bp DNA probe (0.2 omol, 200 000 cpm) was incuba- ted with 15 lg nuclear extracts from TE671 or JEG-3 cells during the binding reaction. Increasing concentrations (0–200-fold excess) of unlabeled hGII-Sil oligonucleo- tides were applied as unlabeled competitors to allow self-competition. (B) L8 nonspecific oligonucleotide and mutant oligonucleotide (Mut4+5 oligonucleotide) were used as competitors. Probe hGII-Sil A Nuclear extract TE671 Nuclear extract (µg) 0µg 15µg Antibody -ve +ve p65 c-Jun RAR Complex A Complex B Non-specific b inding Free probe B Probe Nuclear extract Nuclear extract (µg) hGII-Sil TE671 0µg 15µg Antibody -ve +ve RARα RARβ RARγ RXR Complex A Complex B Non-specific binding Free probe Fig. 3. Protein factors NF-jB subunits p65, RARa and RXR family interact with the putative silencer in TE671 cells. Supershift assay to iden- tify protein factors that bind to the Mut4 and Mut5 (hGII-Sil) region in the putative intronic silencing element in TE671 cells. Synthetic oligo- nucleotides of hGII-Sil were annealed to form dsDNA before radiolabeling with c 32 P. In each reaction, 15 lg TE671 nuclear extract was incubated with specific antibodies against different transcription factors to allow specific protein–antibody interactions. The radiolabeled 24-bp DNA probe (0.2 omol, 200 000 cpm) was then incubated with the nuclear extracts for the binding reaction. –ve, No antibody incuba- tion; + ve, 0.2 lg BSA applied as positive control. Differential regulation of the GnRH II gene R. L. C. Hoo et al. 2698 FEBS Journal 274 (2007) 2695–2706 ª 2007 The Authors Journal compilation ª 2007 FEBS the hGnRH II gene in vivo. These were conducted by transient transfection coupled to luciferase assay using TE671 and JEG-3 cells. Co-transfection of the silencer-containing promoter constructs pGL2- ()2103 ⁄ )620) with p65 expression vector (pCMV4- p65) led to a dramatic decrease in promoter activity in both cell lines in a dose-dependent manner (Fig. 5). Even 0.1 lg of the p65 expression vector produced a significant (P<0.001) decrease in promoter activity in both cell lines, indicating the strong potency of repression induced by p65. Effect of unliganded RARa and RXRa and retinoic acid (RA) treatments on GnRH II promoter activity To investigate the in vivo effect of RARa and RXR on the transcriptional regulation of the hGnRH II gene, the expression vector of human RARa (pCMX- hRARa) and ⁄ or human RXRa (pCMX-hRXRa) were cotransfected with the silencer-containing promoter construct pGL2-()2103 ⁄ )620) into TE671 and JEG-3 cells. Neither the transfection of RARa or RXRa nor the cotransfection of both receptors had a significant effect on the GnRH II promoter activity in TE671 cells (Fig. 6). In contrast, transfection of RARa and cotransfection of RARa and RXRa significantly (P < 0.001) alleviated the gene repression of the silen- cer-containing promoter constructs in JEG-3 cells (Fig. 6). Surprisingly, RXRa alone might not be responsible for the repression, as its over-expression, without RARa, did not have any significant effect on promoter activity. To further elucidate the regulation of GnRH II gene by RARs, TE671 and JEG-3 cells were treated with all-trans retinoic acid (ATRA; a ligand of RARs) and ⁄ or 9-cisRA (a ligand of RXRs) before the meas- urement of GnRH II promoter activity. In TE671 Marker Input No IP p65 RAR RXR IgG -ve 12345678 274bp Antibody Fig. 4. ChIP assay of GnRH II promoter on TE671 cells. It shows binding of p65, RAR and RXR to GnRH II promoter in the context of chromatin. Chromatin from TE671 cells was formaldehyde cross- linked and immunoprecipitated with p65, RAR and RXR antibodies (lanes 4–6). After reversal of the cross-linking, the purified DNA fragments were subjected to PCR using primers to amplify a 274- bp segment spanning the hGII-Sil region of the GnRH II promoter. Immunoprecipitation without antibody (No IP, lane 3) and using a nonspecific antibody against rabbit IgG (IgG, lane 7) was carried out as negative controls. Lane 8, a negative control for PCR (without any DNA template). Input DNA from fragmented chromatin before immunoprecipitation was used as a positive control (lane 2). Lane 1, DNA size standards (100-bp DNA ladder; Invitrogen). 120 100 80 60 40 20 pGL2-(-2103/-620) pCMV4- p65 0 + 0µg + 0.1µg + 0.25µg + 0.5µg + 1µg * * * * TE671 JEG-3 Relative promoter activity (% change) Fig. 5. In vivo dose-dependent effect of over-expressing NF-jB p65 subunit on the promoter activity of hGnRH II gene in TE671 and JEG-3 cells. pCMV4-p65 expression vector was transfected to each sample at different doses, and their effects on pGL2- ()2103 ⁄ )620) were evaluated. Values are shown as percentage changes in relative promoter activities compared with that of the positive control [pGL2-()2103 ⁄ )620) without over-expression of p65]. The promoter activity of the positive control is regarded as 100%. Values are mean ± S.E.M. from at least three independent experiments each performed in triplicate. *P<0.001, significant difference from control pGL2-()2103 ⁄ )620). p65, pCMV4-p65 expression vector. 200 180 160 140 120 100 80 60 40 20 0 pGL2-(-2103/-620) + + + + hRARa+ hRXRa hRXRahRARa– * * TE671 JEG-3 Retinoic Acid Receptors Relative promoter activity (% change) Fig. 6. Effects of unliganded RARa and RXRa on hGnRH II promo- ter activity in TE671 and JEG-3 cells. Supershift assay to identify which members of the RAR family bind to the Mut4 and Mut5 (hGII-Sil) region in the putative intronic silencing element in TE671 cells. Synthetic oligonucleotides of hGII-Sil were annealed to form dsDNA before radiolabeling with c 32 P. In each reaction, 15 lg TE671 nuclear extract was incubated with specific antibodies against RARs to allow specific protein–antibody interactions. The radiolabeled 24-bp DNA probe (0.2 pmol, 200 000 cpm) was then incubated with the nuclear extracts for the binding reaction. –ve, No antibody incubation. + ve, 0.2 lg BSA applied as positive control. R. L. C. Hoo et al. Differential regulation of the GnRH II gene FEBS Journal 274 (2007) 2695–2706 ª 2007 The Authors Journal compilation ª 2007 FEBS 2699 cells, the application of both ATRA and 9-cisRA sig- nificantly down-regulated the promoter function to 61.8 ± 5.0% and 57.5 ± 3.3%, respectively (Fig. 6) (P < 0.001). Interestingly, cotreatment with ATRA and 9-cisRA had a similar repressive effect (54.1 ± 0.8%; P < 0.001). In contrast with the repres- sive effect in TE671 cells, neither cotreatment nor treatment with ATRA or 9-cisRA alone had an obvi- ous effect on the promoter activity of hGnRH II gene in JEG-3 cells (Fig. 7). Differential effects of ligand-activated RARa and RXRa on the promoter activity of the hGnRH II gene in TE671 and JEG-3 cells Over-expression of RARs together with the application of RAs led to significant (P < 0.001) down-regulation of the promoter activity in TE671 cells (Fig. 8). A synergistic repressive effect was observed in cells when compared with cells only treated with retinoic acid (RAs) (Figs 7 and 8) (P < 0.05 or P < 0.001). It was also demonstrated that RARs alone have no effect on the promoter activity of hGnRH II in TE671 cells (Fig. 6). The repressive effect of RAs and the synergis- tic effect observed in Fig. 7 therefore imply that lig- and-bound RAR and RXR are responsible for the repression of GnRH II gene in TE671 cells. On the other hand, over-expression of RARs together with the application of RAs in JEG-3 cells led to significant (P < 0.001) alleviation of the promoter activity from the repressed state (Fig. 8). When compared with the samples that were only transfected with RARa and ⁄ or RXRa (without RA treatment), simultaneous ligand activation of RARa and RXRa (cotransfection of RARa and RXRa together with treatment of both ATRA and 9-cisRA) provided further up-regulation of the promoter activity (P < 0.001). Although a syner- gistic effect was observed in simultaneous ligand-acti- vated RARa and RXRa, RXRa alone, in either its unliganded or ligand-bound state, had no effect on the promoter activity. Finally, the endogenous transcript levels of the GnRH II gene in TE671 and JEG-3 cells were further evaluated by quantitative RT-PCR. Con- sistent with the results obtained from luciferase assays, ligand-bound RARa and RXRa led to a significant (P < 0.05) decrease in endogenous GnRH II gene expression in TE671 cells. In contrast, ligand-bound RARa and RXRa led to a significant (P < 0.001) increase in GnRH II gene expression in JEG-3 cells (Fig. 9). Discussion The hGnRH II gene was first identified by White and his colleagues in 1998 [9]. Although GnRH II and its 140 ** ** 120 100 80 60 40 20 pGL2-(-2103/-620) + + + + ATRA + 9-cisRA TE671 JEG-3 9-cisRAATRA–Retinoic Acids Treatment 0 Relative promoter activity (% change) Fig. 7. Differential effects of RA treatment on the promoter activity of the hGnRH II gene in TE671 and JEG-3 cells. In vivo effect of over-expressing RARa and RXRa on the promoter activity of the hGnRH II gene in TE671 and JEG-3 cells. Values are shown as per- centage changes in relative promoter activities compared with that of the positive control [pGL2-()2103 ⁄ )620) without over-expression of transcription factors]. The promoter activity of the positive con- trol is regarded as 100%. Values are mean ± S.E.M. from at least three independent experiments each performed in triplicate. *Signi- ficant difference (P<0.001) versus control pGL2-()2103 ⁄ )620). hRARa, pCMX-hRARa expression vector; hRXRa, pCMX-hRXRa expression vector. 250 TE671 JEG-3 200 150 100 50 pGL2-(-2103/-620) Retinoic Acids Receptor – –– hRARa* hRXRa ** * * ♦ ♠ ♦ ♦ ♦ hRARa ATRA 9-cisRA 9-cisRA AT R A hRXRa hRARa* hRXRa Retinoic Acids Treatment +++ ++ 0 Relative promoter activity (% change) Fig. 8. Differential effects of ligand-activated RARa and RXRa on the promoter activity of the hGnRH II gene in TE671 and JEG-3 cells. In vivo effect of RARa and RXRa with their ligands, ATRA and 9-cisRA, on the promoter activity of the hGnRH II gene in TE671 cells and JEG-3 cells. Values are shown as percentage chan- ges in relative promoter activities compared with that of the posit- ive control [pGL2-()2103 ⁄ )620) without treatment]. The promoter activity of the positive control is regarded as 100%. Values are mean ± S.E.M. from at least three independent experiments each performed in triplicate. *, r, “ represent significantly different val- ues (* and “, P < 0.001; * and r, P < 0.01; “ and r, P < 0.05 or above). hRARa, pCMX-hRARa expression vector; hRXRa, pCMX- hRXRa expression vector. Differential regulation of the GnRH II gene R. L. C. Hoo et al. 2700 FEBS Journal 274 (2007) 2695–2706 ª 2007 The Authors Journal compilation ª 2007 FEBS first isoform share 70% homology, they are encoded by different gene loci and possess distinct tissue expres- sion patterns and biological functions. It is widely expressed in various parts of the brain and the periph- eral tissues. Its expression and potent antitumor activ- ity in various normal and cancerous cells have received much attention [10,11]. In contrast with the well-stud- ied GnRH I, the gene regulation, expression patterns and biological role of GnRH II are still largely unclear. Several studies have focused on the gene activation mechanisms of hGnRH II. It has been demonstrated that expression of GnRH II can be up- regulated by cAMP [2], gonadotropins [4] and estrogen [3]. Two AP-4-interacting E-boxes, and an Ets-like ele- ment have been identified in the untranslated first exon and found to be responsible for the minimal promoter activity of GnRH II [5]. In addition to these activating elements, our research group has located a putative silencer-like element in the first intron at )650 ⁄ )620 (relative to the +1 translation start site) [6]. In the present study, a novel cis-acting element was first iden- tified by deletion analysis and designated hGII-Sil (GATGCC, position at )641 ⁄ )636). It was found to be a major responsible element that mediates the repressive effect, which, when mutated, led to a almost complete restoration of promoter activity in two GnRH II-expressing cell lines: medulloblastoma TE671 and placental cell JEG-3. The hGII-Sil site does not show significant homo- logy with any known consensus repressor binding site. The highest similarity was suggested on comparison with a novel repressive element SNOG (AATGG GGG) of human growth-associated protein 43 gene (hGAP43) with 50% homology [12]. The nucleotides, ATG, in the hGAP43 SNOG element, which have been reported to be crucial for the repressive effect, coincide with the core sequence hGII-Sil identified in our study. Although the protein factors of hGAP43 SNOG have not yet been identified, it is possible that the two repressive elements in hGAP43 and GnRH II gene have the same or a very similar mechanism. EMSAs and supershift assays performed in this study indicated specific protein factors that bind to the hGII-Sil region in a cell-specific manner. It was dem- onstrated that NF-jB p65, RARa and RXR are responsible for forming Complex A, or, at least, are members of the Complex in TE61 cells. This was con- firmed by ChIP assays which provided evidence for in vivo interaction of these protein factors (p65, RAR and RXR) with the hGII-Sil region. It is noteworthy that, when Complex A was abolished by RAR anti- body and RXR antibody, another specific Com- plex (Complex B) increased in intensity. This may imply competition binding between RAR and ⁄ or RXR and Complex B on the hGII-Sil silencing element. Sim- ilar results have been reported in other in vitro mam- malian promoter studies of the Fas gene, in which multiple protein factors and cofactors were involved [13]. NF-jB subunit p65 was demonstrated in this study to act as a potent repressor of hGnRH II promoter in both neuronal and placental cells. NF-jB com- plexes comprise homodimers or heterodimers of the family including p65 (RelA), c-Rel, RelB, p50 (p105 ⁄ NF-jB1), and p52 (p100 ⁄ NF-jB2). Different heterodimers bind to their specific promoters to regu- late transcription of a wide range of genes to control immune responses, cell apoptosis ⁄ survival and tissue repair [14–16]. A classic model of NF-jB activation involves the p50 ⁄ p65 heterodimer, which interacts with the jB site and the CRE of the promoters. Being the active partner of the heterodimer in the nucleus, p65 is able to establish interactions with various transcription factors such as CBP ⁄ p300 and histone deacetylases (HDACs) [17]. It has also been reported that NF-jB is involved in gene repression through differential 6 TE671 JEG-3 5 4 3 2 1 0 No treatment Ligand-bound (RARαRXRα) dimer ‡ ‡ ‡ GnRH II mRNA / GAPDH mRNA (ratio against untreated cells) Fig. 9. Effects of ligand-activated RARa and RXRa on hGnRH II gene expression. The effect of ligand-bound RARa and RXRa on the endogenous hGnRH II transcript level in TE671 and JEG-3 cells, using quantitative real-time PCR analysis. Cells were treated with ATRA and 9-cisRA 24 h after the transfection of expression vectors of RARa and RXRa. The transcript level of untreated cells is defined as 1.0. Total RNAs were harvested 24 h after drug treatment. First- strand cDNAs were prepared from total RNAs as described and used for quantitative PCRs. The hGnRH II transcript level of cells treated with ligand-bound RARa ⁄ RXRa was compared with that of untreated cells. The GnRH II mRNA ⁄ GAPDH mRNA ratio was calculated by the 2 –DDCt method, using the GAPDH mRNA concen- tration measured by quantitative PCR as the internal control. Data are the mean ± SEM from three experiments, each performed in duplicate. R. L. C. Hoo et al. Differential regulation of the GnRH II gene FEBS Journal 274 (2007) 2695–2706 ª 2007 The Authors Journal compilation ª 2007 FEBS 2701 phosphorylation of p65 [15] or the association of CBP ⁄ p300 to form a repressor Complex [18–20]. Other studies have suggested that the binding of p65 to the cofactors renders them unavailable for gene activation [20–22]. In the context of the GnRH II promoter, there is a cluster of enhancing elements, including a functional CRE, within 200 bp upstream of the hGII- Sil site. The enhancers have been suggested to be responsible for the basal and stimulatory transcription level of the gene [5,7]. Accordingly, it is possible that p65 is an active member of the repressor Complex at the hGII-Sil site, which then interacts with the activa- tors involved to down-regulate promoter activity. Furthermore, the nuclear receptor RAR ⁄ RXR het- erodimer was found to be involved in the regulation of GnRH II gene in both cells, yet, differential response occurs in the two cell types in the presence of the receptor’s ligands. Ligand-activated RARa and RXR were found to contribute to the repressed expression of GnRH II in the neuronal TE671 cells; ligand-activated RARa, on the other hand, up-regulated gene expres- sion in JEG-3 cells. To our knowledge, this study is the first to demonstrate the presence of differential transcriptional regulation of the GnRH II gene in dif- ferent GnRH II-expressing human cell types. RAs play important roles in development, differentiation, and homeostasis in a tissue-specific manner [23,24]. The actions of RAs are highly diversified because their sig- nals can be transduced through different RARs. In addition, the nuclear receptors are able to cross-talk with cell surface receptor signaling pathways, and the RARs and RXRs can interact with multiple coactiva- tors and ⁄ or corepressors. These combinatorial effects result in the pleiotropic effects of RAs. For RA- induced genes, unliganded RAR ⁄ RXR heterodimers bind to corepressors such as the silencing mediator of retinoid and thyroid hormone receptor (SMRT) and ⁄ or nuclear receptor corepressor (N-CoR). SMRT and N-CoR in turn function as bridging factors that recruit other coregulator proteins to form a larger corepressor Complex [25,26]. Conversely, addition of hormone agonist leads to the release of corepressor Complex by the receptor, which then recruits a series of coactivator proteins, such as steroid receptor coactivator 1 (SRC-1), gluco- corticoid receptor interacting protein 1 (GRIP1), acti- vator of thyroid and retinoic acid receptor (ACTR) and p300 ⁄ cAMP response element binding protein- binding protein (CBP ⁄ p300) [26–28]. This may explain the up-regulation (alleviation of the repressing effect of GII-Sil) of the hGnRH II promoter by the ligand-acti- vated RAR⁄ RXR heterodimer in JEG-3 cells. It is noteworthy that RXR, even in its ligand-activated state, did not induce up-regulation of the gene without over-expression of RAR. In contrast, ligand-activated RAR itself was able to up-regulate the gene to a signi- ficant level without the aid of RXR. This phenomenon of RXR acting as the silent or ‘nonpermissive’ partner in an RXR⁄ nuclear receptor heterodimer has often been observed. These dimers do not respond to RXR ligands but are only sensitive to RAR ligand activation [23,29–31]. In the case of RAR ⁄ RXR, it was observed that RXR can acquire the ability to respond to its own ligand only if RAR is activated by ATRA before- hand. In this situation, simultaneous addition of lig- ands for both RAR and RXR leads to synergistic activation of the heterodimer [31,32], which agrees with the observation in the present study. Moreover, quantitative RT-PCR analysis demonstrated this up- regulation by ligand-activated RAR ⁄ RXR at the tran- scriptional level of the hGnRH II gene. Therefore, the RAR ⁄ RXR heterodimer interacts with the hGII-Sil silencer and is probably responsible for its gene-repres- sive effect in JEG-3 placental cells. However, contrary to the results observed in placen- tal cells and the current paradigm of the role of RA-induced activation, the application of RAs and introduction of ligand-activated RAR ⁄ RXR hetero- dimer further down-regulated the hGnRH II gene in TE61 cells. In fact, there are examples of ligand-bound nuclear repressors exerting transrepression, rather than activation, over their regulating genes. For instance, thyroid hormone receptor b, which is closely related to RARs, is found to markedly repress the thyroid-stimu- lating hormone b promoter after being bound by its cognate ligand thyroid hormone, via HDAC recruit- ment [33,34]. Indeed, there is increasing evidence that the ligand–nuclear receptor–corepressor relationship is often not a simple switching on–off model. The func- tions of the ‘corepressors’ may depend on cell type, combinations of neighboring regulatory factors, and the phase of the cell cycle [35]. Most corepressors have been found to be promiscuously but not specifically expressed [24,36]. It has also been reported that coacti- vators can act as corepressors of liganded RAR and thyroid hormone receptor in the context of epidermal keratin genes, and vice versa [24]. It has long been known that the interaction between coregulators and nuclear receptors (liganded versus unliganded) is deter- mined by the cis-acting elements. Hence, different tran- scriptional responses can be elicited in various promoter contexts even when the same ligands and receptors are involved [24,37–39]. Another possible hypothesis on the ligand-dependent transrepression mechanism of hGnRH II observed here may involve the newly discussed theory of ligand-dependent Differential regulation of the GnRH II gene R. L. C. Hoo et al. 2702 FEBS Journal 274 (2007) 2695–2706 ª 2007 The Authors Journal compilation ª 2007 FEBS corepressor (L-CoR). L-CoR is a distinct class of core- pressor which causes gene repression through ligand- bound nuclear receptors [35,40,41]. Fernandes et al. [35] found a wide expression pattern of L-CoR in var- ious human adult and fetal tissues, including kidney, placenta, cerebellum and corpus callosum of the brain at the transcription level. L-CoR interacts with both HDAC2 and another corepressor C-terminal binding protein, mediating strong gene repression through both HDAC-dependent and HDAC-independent mecha- nisms. Such a ligand-induced repression mechanism is important as a means of attenuating and counterbalan- cing hormone-induced transactivations, acting transi- ently as part of a cycle of cofactors at the target promoters, and allowing hormone-induced target gene repression [35,41]. The present study discusses the transcriptional regu- lation of the hGnRH II. It is also the first report of differential regulation of the gene in two GnRH II- expressing cell types. It may give useful cues about the expression pattern of the largely unknown GnRH II. We also provide evidence of the newly discussed mech- anism of L-CoR. Little is still known about the molecular basis of ligand-induced transrepression [35,41,42]. As knowledge on this topic accumulates, a more detailed elucidation of GnRH II transcriptional regulation is expected. Methods and Materials Cell lines TE671 (human medulloblastoma cell line) and JEG-3 (human placental cell line) were maintained in Dulbecco’s modified Eagle’s medium (Gibco-BRL, Invitrogen, Grand Island, NY, USA) and Medium 199 (Gibco-BRL, Invitro- gen), respectively, supplemented with 10% fetal bovine serum (Gibco-BRL, Invitrogen). All cells were incubated at 37 °C with 5% CO 2 in medium supplemented with 100 UÆmL )1 penicillin G and 100 lgÆmL )1 streptomycin (Life Technologies, Carlsbad, CA, USA). Promoter-luciferase constructs The full-length hGnRH II promoter construct pGL2- 2103 ⁄ +1-Luc was generated by PCR amplification from human genomic DNA using sequence-specific primers followed by subsequent cloning into the promoter-less pGL2-Basic vector (Promega, Madison, WI, USA) [5]. The deletion mutants p-2103 ⁄ )650 Luc, which contains the core promoter region and enhancing elements but lacks a silen- cing element, and p-2103 ⁄ )620 Luc, which also includes the silencing element, were generated by PCR amplification using sequence-specific primers with p-2103 ⁄ +1 Luc as the template. All mutant clones of the 30-bp silencer (scanning mutants Mut 1–10) were generated by PCR amplifications using mutagenic reverse primers and GLprimer1 forward primer with wild-type pGL2-()2103 ⁄ )620) construct as the template (Table 1). The purified PCR products were sub- cloned into a pGL2-Basic vector (Promega) at KpnI and HindIII restriction sites. All mutant plasmids were verified by big dye terminator DNA sequencing analysis. Plasmid DNAs used for transfection experiments were prepared using the Nucleobond AX preparation kit (Macherey- Nagel, Duren, Germany). Enzymes and oligoprimers were purchased from Life Technologies and the Genome Research Centre, University of Hong Kong, respectively. Transfection and drug treatments Two days before transfection, cells were seeded on to a 35-mm well (six-well plate; Costar, San Diego, CA, USA). The seeding densities used for TE671 and JEG-3 were 1.5 · 10 5 cells ⁄ well and 2.5 · 10 5 cells ⁄ well, respectively. The transfection mixture containing 1 lg promoter–lucif- erase constructs, 0.5 lg pSV-b-gal or pCMV4-b-gal, an appropriate amount of GeneJuice Transfection Reagent (Novagen, Darmstadt, Germany) and 500 lL serum-free medium was prepared. For assays of the effect of NF-jB Table 1. Primer sequences for construction of scanning mutants. The mutated nucleotides are underlined. Mutant Sequence (5¢) to 3¢) Mut1 ACTAAGCTTAAAAGGGGACTTCTCTGGCATGGTTCAGG TTTGGAGGCACCTGGGA Mut2 ACTAAGCTTAAAAGGGGACTTCTCTGGCATGGTTC CTGGGTGGAGGCACCTG Mut3 ACTAAGCTTAAAAGGGGACTTCTCTGGCATGG GGCAGGGGTGGAGGCAC Mut4 ACTAAGCTTAAAAGGGGACTTCTCTGGCA GTGTTCAGGGGTGGAGG Mut5 ACTAAGCTTAAAAGGGGACTTCTCTG TAATGGTTCAGGGGTGG Mut6 ACTAAGCTTAAAAGGGGACTTCT AGGGCATGGTTCAGGGG Mut7 ACTAAGCTTAAAAGGGGACT GATCTGGCATGGTTCAGGGG Mut8 ACTAAGCTTAAAAGGGG CATTCTCTGGCATGGTTCAGGGG Mut9 ACTAAGCTTAAAAG TTGACTTCTCTGGCATGGTTCAGGGG Mut10 ACTAAGCTTAA CCGGGGACTTCTCTGGCATGGTTCAGGGG R. L. C. Hoo et al. Differential regulation of the GnRH II gene FEBS Journal 274 (2007) 2695–2706 ª 2007 The Authors Journal compilation ª 2007 FEBS 2703 on promoter activity, 0.25 lg pCMV4-p50 and ⁄ or pCMV4-p65 was cotransfected per well. For assays inves- tigating the effect of RAR and RXR on promoter activ- ity, 0.5 lg pCMX-hRARa and ⁄ or pCMX-hRXRa was cotransfected per well. Appropriate amounts of the empty vector, pcDNA3.1, were cotransfected so that the same amounts of DNA were transfected in each sample. The 500 lL transfection mixture was added to 1.5 mL 10% fetal bovine serum supplemented medium per well. After 37 °C incubation for 48 h, cell lysates were prepared by first washing the cells twice with ice-cold NaCl ⁄ P i followed by the addition of 200 lL reporter lysis buffer according to the manufacturer’s protocol (Promega). For assays investigating the effect of RAs on promoter activity, 1 lm ATRA and ⁄ or 9-cisRA were added to the seeded cell cul- tures in 35-mm wells, 24 h after the transient transfection of promoter–luciferase constructs and ⁄ or human RA expression vectors (0.5 lg pCMX-hRARa and ⁄ or pCMX- hRXRa). After 24 h of drug treatment, cell lysates were harvested as described previously. Luciferase assay A 100-lL sample of luciferase substrate solution (Promega) was automatically injected into 20 lL cell lysate, and luciferase activity was measured as light emission using a luminometer (Lumat LB9507; EG & G Berthold, Bad Wildbad, Germany). b-Galactosidase activity was deter- mined by incubating the cell lysate (50 lL) in 100 mm sodium phosphate buffer, pH 7.3, containing 1 mm MgCl 2 , 50 mm 2-mercaptoethanol and 0.7 mgÆmL )1 o-itrophenyl galactoside for 15 min at 37 °C. A 420 was measured using a spectrophotometer (U-2800; Hitachi High-Technologies Corporation, Tokyo Japan). For each transfection assay, luciferase activity was determined and normalized on the basis of b-galactosidase activity. Each plasmid was tested at least nine times in three separate experiments. Electrophoretic mobility-shift and supershift assays Nuclear proteins were extracted from TE671 cells and JEG- 3 cells as described previously [43]. The double-stranded probe corresponding to hGII-Sil was end labeled using the Ready-To-Go T4 polynucleotide kinase labeling kit (Amer- sham Pharmacia Biotech, Arlington Heights, IL, USA) with [c- 32 P]ATP (5000 CiÆnmol )1 ; Amersham Pharmacia Bio- tech). Unlabeled nucleotides were removed by passing the sample through a microspin column G-25 (Amersham Pharmacia Biotech) at 3000 g. Binding reactions were per- formed by incubating the 10 mg nuclear extracts with the binding buffer (10 mm Tris ⁄ HCl, pH 7.5, 0.1 mm EDTA, 1mm magnesium acetate, 0.1 mm dithiothreitol, 5% gly- cerol, 60 mm KCl), 1 l g poly(dI-dC), and 0.5 pmol (200 000 cpm) labeled probe for 15 min at room tempera- ture. For competition assays, 50-fold, 100-fold and 200-fold molar excess of the unlabeled wild-type oligonucleotide, hGII-Sil (5¢-CCTCCACCCCTGAACCATGCCAGA-3¢), and nonspecific L8 oligonucleotide were used. For the supershift assay, specific antibodies (rabbit polyclonal IgG; Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA) against known transcription factors were incubated with the nuclear extract in the presence of 1 · binding buffer at room temperature for 45 min before binding to the labeled probe. Free and bound probes were separated by electro- phoresis for 2 h at 200 V in a 5% nondenaturing poly- acrylamide gel in 0.5 · Tris ⁄ borate ⁄ EDTA buffer (45 mm Tris-borate, 0.1 mm EDTA). After electrophoresis, the gel was dried and autoradiographed (Biomax MR film; East- man Kodak Co., Rochester, NY, USA) for 16 h at )70 °C with intensifiers (Amersham Pharmacia Biotech). ChIP assay ChIP assays were performed essentially as described by Lee et al. [44]. TE671 cells were cross-linked with 1% formal- dehyde. Cells were harvested by centrifugation and resus- pended in lysis buffer (1% SDS, 10 mm EDTA, 50 mm Tris ⁄ HCl, pH 8.1, 1 mm phenylmethanesulfonyl fluoride, 1 lgÆmL )1 aprotinin and 1.5 lgÆmL )1 pepstatin A). After sonication in Sonifier 450 (Branson, Danbury, CT, USA), 4 lg antibody and 20 lL Protein G ⁄ agarose (Santa Cruz Biotechnology) were added to precipitate the DNA–protein complex. Precipitated DNA–protein Complex was washed in the ChIP buffer (0.1% SDS, 1% Triton X-100, 0.1% sodium deoxycholate, 140 mm NaCl, 1 mm phenylmethanesulfonyl fluoride, 1 lgÆmL )1 aprotinin and 1.5 lgÆmL )1 pepstatin A) and eluted in the elution buffer (1% SDS and 0.1 m NaH- CO 3 ). The mixture was incubated at 65 °C for 4 h to reverse the formaldehyde cross-linking. Protein was removed by pro- teinase K digestion (200 lgÆmL )1 ) and phenol ⁄ CHCl 3 extraction. The extracted DNA was used for PCR using forward (GnRH II-F, 5¢-GGGTGGAGCTGCCTGGTC TATA-3¢) and reverse (GnRH II-R, 5¢-CAGGGGCAACA AGCACAAGA-3¢) primers. Quantitative RT-PCR Transfected cells were treated with the drug 1 day after transfection for 24 h as described above, and total RNA was isolated using the TriPure Isolated Reagent (Roche Molecular Biochemicals, Basel, Switzerland). Total RNA (5 lg) was reverse-transcribed with an oligo-dT primer and Superscript III reverse transcriptase (Invitrogen). One-fifth of the first-strand cDNA was used for real-time quantita- tive PCR. The transcript levels of GnRH II were measured with the SYBR Green Master Mix (Applied Biosystems, Foster City, CA, USA) with specific primers; for GnRH, forward primer 5¢-GCCCACCTTGGACCCTCAGAG-3¢ and reverse primer 5¢-CGGAGAACCTCACACTTTAT Differential regulation of the GnRH II gene R. L. C. Hoo et al. 2704 FEBS Journal 274 (2007) 2695–2706 ª 2007 The Authors Journal compilation ª 2007 FEBS [...]... regulatory elements in the untranslated exon 1 stimulates the basal transcription of the human GnRH- II gene Mol Endocrinol 17, 1175–1191 6 Hoo RL, Ngan ES, Leung PC & Chow BK (2003) Two Inr elements are important for mediating the activity of the proximal promoter of the human gonadotropinreleasing hormone receptor gene Endocrinology 144, 518–527 Differential regulation of the GnRH II gene 7 Chen Z, Zheng... role of the nuclear receptor co-regulators in the suppression of epidermal genes by retinoic acid and thyroid hormone receptors J Invest Dermatol 124, 1034–1043 Hong SH & Privalsky ML (1999) Retinoid isomers differ in the ability to induce release of SMRT corepressor from retinoic acid receptor-a J Biol Chem 274, 2885– 2892 Farboud B & Privalsky ML (2004) Retinoic acid receptor-a is stabilized in a... grants from CRCG HKU7501 ⁄ 05M and HKU7384 ⁄ 04M to B.K.C.C References 1 Limonta P, Moretti RM, Marelli MM & Motta M (2003) The biology of gonadotropin hormone-releasing hormone: role in the control of tumor growth and progression in humans Front Neuroendocrinol 24, 279– 295 2 Chen A, Laskar-Levy O, Ben-Aroya N & Koch Y (2001) Transcriptional regulation of the human GnRH II gene is mediated by a putative... Endocrinology 142, 3483–3492 3 Chen A, Zi K, Laskar-Levy O & Koch Y (2002) The transcription of the hGnRH-I and hGnRH -II genes in human neuronal cells is differentially regulated by estrogen J Mol Neurosci 18, 67–76 4 Kang SK, Tai CJ, Nathwani PS & Leung PC (2001) Differential regulation of two forms of gonadotropinreleasing hormone messenger ribonucleic acid in human granulosa-luteal cells Endocrinology... Collins T (1998) Nuclear integration of glucocorticoid receptor and nuclear factor-jB signaling by CREB-binding protein and steroid receptor coactivator-1 J Biol Chem 273, 29291–29294 Chambon P (1996) A decade of molecular biology of retinoic acid receptors FASEB J 10, 940–954 Jho SH, Vouthounis C, Lee B, Stojadinovic O, Im MJ, Brem H, Merchant A, Chau K & Tomic-Canic M (2005) The book of opposites: the. .. Nuclear hormone receptor co-regulators Curr Opin Drug Discov Dev 6, 692–701 37 Mangelsdorf DJ, Umesono K, Kliewer SA, Borgmeyer U, Ong ES & Evans RM (1991) A direct repeat in the cellular retinol-binding protein type II gene confers differential regulation by RXR and RAR Cell 66, 555–561 38 Chambon P (1995) The molecular and genetic dissection of the retinoid signaling pathway Recent Prog Horm Res 50, 317–332... regulation of Fas gene expression by GA-binding protein and AP-1 in T cell antigen receptor CD3 complex-stimulated T cells J Biol Chem 274, 35203–35210 14 Bonizzi G & Karin M (2004) The two NF-jB activation pathways and their role in innate and adaptive immunity Trends Immunol 25, 280–288 15 Campbell KJ & Perkins ND (2004) Post-translational modification of RelA (p65) NF-jB Biochem Soc Trans 32, 1087–1089... Identification of negative and positive estrogen response elements in human GnRH upstream promoter in the placental JEG-3 cells Mol Cell Endocrinol 184, 125–134 8 Chen A, Yahalom D, Laskar-Levy O, Rahimipour S, Ben-Aroya N & Koch Y (2001) Two isoforms of gonadotropin-releasing hormone are coexpressed in neuronal cell lines Endocrinology 142, 830–837 9 White RB, Eisen JA, Kasten TL & Fernald RD (1998) Second gene. .. heterodimers by an antagonist of RXR homodimers Nature 383, 450–453 Mangelsdorf DJ & Evans RM (1995) The RXR heterodimers and orphan receptors Cell 83, 841–850 2706 33 Sasaki S, Lesoon-Wood LA, Dey A, Kuwata T, Weintraub BD, Humphrey G, Yang WM, Seto E, Yen PM, Howard BH, et al (1999) Ligand-induced recruitment of a histone deacetylase in the negative-feedback regulation of the thyrotropin b gene EMBO J 18, 5389–5398... binding protein) integrates NF-jB (nuclear factor-jB) and glucocorticoid receptor physical interactions and antagonism Mol Endocrinol 14, 1222–1234 20 Burkhart BA, Hebbar PB, Trotter KW & Archer TK (2005) Chromatin-dependent E1A activity modulates NF-jB RelA-mediated repression of glucocorticoid FEBS Journal 274 (2007) 2695–2706 ª 2007 The Authors Journal compilation ª 2007 FEBS 2705 Differential regulation . Involvement of NF-jB subunit p65 and retinoic acid receptors, RARa and RXRa, in transcriptional regulation of the human GnRH II gene Ruby L vivo binding of NF-jB subunit p65 and the retinoic acid receptors, RARa and RXRa, to the promoter sequences. Over-expression of these protein factors indicated