paragraphs 5 and 6
unit 5 and 6
... depend……species diversity to have food, clean air and water, and fertile soil agriculture a.for b.in c before d on 10 At first year at college was probably the best and most………year of my life a challenge ... watch the signs The latest train leaves at about 00. 15 36 A at B in C from D to 37 A journey B visit C picnic D street 38 A such B or C so D and 39 A on B in C at D for 40 A buses B trains C planes ... have / would buy c had/ will buy d had/ would buy 15. If I ……………you, I …………….do that a am/ will b were /would c were/ will d had been/ would 16. If I were offered the job, I think I ……… it a take...
- 4
- 267
- 0
Tài liệu Báo cáo khoa học: Peptides corresponding to helices 5 and 6 of Bax can independently form large lipid pores pdf
... Bax-a5 Buffer 20% TFE 60 % TFE 0 .5 mM SDS mM SDS 23 62 61 63 61 5 15 26 27 19 25 2 3 10 0 1 0 0 1 1 19 4 1 26 11 13 10 6 Bax-a6 Buffer 20% TFE 60 % TFE 0 .5 mM SDS mM SDS 13 27 40 33 42 4 10 15 22 16 ... PtdCho:lysoPtdCho ( 95 : 5) PtdCho:lysoPtdCho (90 : 10) PtdCho:PtdEtn ( 75 : 25) PtdCho:PtdEtn (50 : 50 ) 158 .7 59 .3 37 .6 35. 3 2 15. 1 238.1 198.0 1 75. 4 35. 2 15. 8 13.8 5. 7 53 .1 69 .4 28.3 16. 3 B Fig Calcein ... ⁄ C50 values were 8–12% CL, cardiolipin Activity, ⁄ C50 (lM)1) Lipid composition Bax-a5 Bax-a6 PtdCho PtdCho:PtdSer ( 75 : 25) PtdCho:PtdSer (50 : 50 ) PtdCho:CL (90 : 10) PtdCho:lysoPtdCho (95...
- 11
- 586
- 0
Báo cáo " The development of financial systems of ASEAN-5 and Vietnam: A comparative analysis " potx
... 413.3 440.2 489.0 55 4.1 63 6.1 721.9 8 35. 3 1040.4 1019.0 55 1.7 66 69 .6 7111 .57 6 959 .6 55 08 56 31.1 6 155 .7 56 17 58 31 62 74.2 71 85. 1 7 769 87 45. 6 101 26 11 068 1 051 1 7410.9 0.04 0. 05 0. 05 0.07 0.07 0.07 0.07 ... 11. 85 11.43 9. 86 9 .58 9. 85 9.99 9.91 9.34 9.29 9.14 9.19 10 .5 Vietnam 14.99 15. 18 16. 48 17. 15 17 .69 18 . 56 19.78 20 .58 20. 45 20.34 20 .67 21.29 22.30 22 .60 19.1 ASEAN -5 25. 62 25. 91 26. 02 25. 88 26. 80 ... 0.1 9 .5 9.3 8.2 5. 8 4.8 6. 8 6. 9 7.1 7.3 7.8 8.4 8.2 8 .5 6. 2 3.3 7.2 8.0 7 .5 4.8 -6. 6 4.4 7.0 1.1 4.8 5. 3 6. 8 5. 6 6.1 6 .5 3.8 -3 .5 4.1 Vietnam 16. 9 5. 6 3.1 8.1 4.1 -1.8 -0.3 4.1 3.3 9.4 8.4 7 .5 8.3...
- 13
- 505
- 0
Báo cáo khoa học: Biochemical properties of the human guanylate binding protein 5 and a tumor-specific truncated splice variant Mark Wehner and Christian Herrmann doc
... 0.01 – 44 ± 4* hGBP5ta mant-GDP 0. 066 ± 0.004 0.13 ± 0.01 0.23 ± 0.01 3 .5 ± 0.3 mant-GTPcS 0.072 ± 0.0 06 1.4 ± 0.1 1. 15 ± 0.05a 16 ± 0.20 ± 0.03b 2.8 ± 0.7 mant-GTP 0.0 25 ± 0.0 05 0.72 ± 0.07 – 30 ... GDP and GppNHp [guanosine 5 -(b,c-imino)-triphosphate], with Kd values of 11 and lm for hGBP5ta and 7.2 and 2 .6 lm for hGBP5a ⁄ b, respectively For the non-hydrolysable analog GTPcS [guanosine 5 -O-(c-thio)triphosphate], ... performed at 25 °C using an SFM 25 fluorospectrometer (Kontron, Zurich, Switzerland) and mant-labeled nucleotides (Jena Biosciences) The excitation and emission wavelengths were 366 and 4 35 nm, respectively...
- 9
- 462
- 0
Báo cáo khoa học: The Rab5 effector Rabaptin-5 and its isoform Rabaptin-5d differ in their ability to interact with the small GTPase Rab4 doc
... pPC97-Rab5, pPC97-Rab5Q79L and pPC97Rab5S34N, the respective cDNAs were excised from pLexA-Rab5, pLexA-Rab5Q79L and pLexA-Rab5S34N FEBS Journal 272 (20 05) 37– 46 ª 2004 FEBS Rabaptin -5 isoform ... regions of Rabaptin -5 and Rabaptin-5d were obtained by cloning of ApaI-EcoRV internal fragments from pRn5 and pRn5d, respectively, into the p53Rn5 plasmid (plasmids pRn5NF and pRn5dNF) Finally, the ... Rabaptin -5 was described previously [23] pPC 86- Rabaptin-5d was constructed in a similar way To obtain pPC97-Rabaptin -5 and pPC97-Rabaptin-5d, the respective cDNAs from pPC 86- Rabaptin -5 and pPC86Rabaptin-5d...
- 10
- 411
- 0
Báo cáo khoa học: Structures of the O-polysaccharides and classification of Proteus genomospecies 4, 5 and 6 into respective Proteus serogroups ppt
... 3.27 73 .5 3 .69 56 .6 3 .54 77.2 4. 36 49.0 3 .53 72.9 4. 05 58.0 3 .54 74.9 3.71 74.1 4. 25 77 .5 3.74 74.1 3 .52 77 .5 3 . 56 70.7 3.80 81.8 4.23 68 .8 3. 45 70 .6 3 .68 73 .5 3 .59 75. 7 3. 85 76 .5 4.29 72.4 4.20 ... and 1 05. 1 (d 99 .6, 100.0, 102 .5 and 1 05. 3 in P vulgaris O8), two OCH2-C groups at d 62 .2 and 63 .3 (d 62 .4 and 63 .4 in P vulgaris O8), two nitrogen-bearing carbons at d 50 .4 and 55 .4 (d 50 .6 and ... 102.9 and 104.1 (d 101.9, 102.0, 102.7 and 104.0 in P penneri 25) , two OCH2-C groups at d 61 .8 and 68 .7 (d 61 .9 and 68 .8 in P penneri 25) , two nitrogenbearing carbons at d 55 .4 and 56 .1 (d 55 .3 and...
- 8
- 349
- 0
UP TO SPEED ON HTML 5 and CSS3: Short Guide
... canvas.getContext("2d"); ctx.fillStyle = "rgb(200,0,0)"; ctx.fillRect (10, 10, 55 , 50 ); ctx.fillStyle = "rgba(0, 0, 200, 0 .5) "; ctx.fillRect (30, 30, 55 , 50 ); } } canvas Sunday, July 19, 2009 Browser Support: The ... is a degree on a color wheel (0- 360 ), saturation is a percentage, and lightness is a percentage div { color: hsl(240 ,50 % ,50 %); } div { color: hsla(240 ,50 % ,50 %,0 .5) ; } HSLA is like HSL color, but ... the color being applied div { color: rgb(0, 255 ,0); } div { color: rgba(0, 255 ,0,0 .5) ; } Like opacity, the alpha value is between 0.0 (fully transparent) and 1.0 (fully opaque) RGBA color Sunday,...
- 67
- 276
- 0
GRAMMAR 2 - Chapter 5 and 6 pdf
... GRAMMAR: CHAPTER BE GOING TO, WILL, and THE PRESENT CONTINUOUS Be going to and the Present Continuous as FUTURE: A INTENTIONS AND PLANS: Use BE GOING TO and THE PRESENT CONTINUOUS to talk about ... FUTURE with WILL and BE GOING TO: A Predictions with WILL and BE GOING TO + Use WILL or BE GOING TO to make predictions You can also use PROBABLY and other adverbs with WILL and BE GOING TO to ... statements and YES/NO questions It comes at the end of a sentence For example: They haven’t arrived yet / Have you met him yet? + STILL means “UP TO NOW” STILL is used in negative statements and comes...
- 3
- 184
- 0
Báo cáo toán học: "Constructing Hypohamiltonian Snarks with Cyclic Connectivity 5 and 6" pot
... 13 15 16 17 11 23 24 25 26 22 18 16 17 19 20 21 15 13 12 14 10 6 359 87 12 10 14 18 16 15 13 11 17 19 25 24 26 22 20 21 23 23 21 15 16 17 19 20 22 18 14 12 26 24 25 11 10 23 24 25 26 22 18 16 17 ... 15 16 17 19 25 24 26 22 18 14 10 11 12 13 23 24 25 26 22 20 19 17 11 12 13 15 16 18 14 10 6 359 87 23 21 20 19 17 11 12 13 15 16 18 26 24 25 14 10 1 453 10 14 12 13 11 17 19 20 21 15 16 18 22 26 ... 18 16 15 13 12 11 17 19 25 24 26 22 20 21 23 12 26 22 20 21 23 24 25 19 17 11 12 13 15 16 18 14 10 23 21 15 16 18 22 20 19 17 11 26 24 25 13 12 14 10 23 21 15 16 17 19 20 22 18 14 10 26 24 25 13...
- 21
- 302
- 0
Báo cáo khoa học: "Comparative study of PM2.5 - and PM10 - induced oxidative stress in rat lung epithelial cells" pptx
... sense 5' -GATGTGTGGAGCACGCTTACT-3' and antisense 5' -CACAATGTCACTCCTCTCCGAATTA-3', Catalase ( 763 bp): sense 5' -TTACTTTCTTGTTCAGCGAC CGA-3' and antisense 5' -C ACCTTCGTATAGAATGTCCG CA-3', Cu/Zn-SOD (54 1 ... DNA and PM10treated DNA (P
- 8
- 442
- 1
Báo cáo toán học: "The Loebl–Koml´s–S´s conjecture for trees of o o diameter 5 and for certain caterpillars" pptx
... contradiction to (1) and thus establishes ( 16) We shall finally bring ( 16) to a contradiction We use (5) , (9), (10) and ( 16) to obtain that the electronic journal of combinatorics 15 (2008), #R1 06 |D| k ≥ ... vertex v ∈ N has degree degL (v) < k (6) Then, (5) and (6) together imply that |B| k k ≤ e(N, B) ≤ |N | , and hence, |N | ≥ 2|B| (7) In order to see (6) , suppose otherwise, i e., suppose that ... deg(v) ≥ k} and set S := V (G) \ L We may assume that S is independent, and that that a, e = Because of Theorem 5, we may moreover assume that b, d > (and thus ≥ 2), and by Lemma 6, that c is...
- 11
- 271
- 0
Báo cáo khoa học: "Phylogenetic characterization of genes encoding for glycoprotein 5 and membrane protein of PRRSV isolate HH08" docx
... 20 06 2007 2007 2008 20 06 2004 2009 1999 2008 2007 GQ184822 AY03 262 6 EF 153 4 86 FJ 5 56 871 EU0977 06 AF331831 EF112447 AY 262 352 EU0 866 04 EU144079 FJ89 7 56 7 FJ5 361 65 DQ2 46 451 EU200 961 EF517 962 EF0 759 45 ... 1999 DQ 355 7 96 AY881994 EU0 767 04 U89392 M 962 62 AY3 950 79 AY3 950 81 AY3 950 80 EF5233 46 DQ1 760 20 AY 569 974 AF1 763 48 U 754 43 DQ 864 7 05 DQ 0 56 373 AY0 359 44 AY0 359 43 FJ194 950 FJ349 261 AB288 3 56 AB023782 AF 159 149 ... EF112447 AY 262 352 AY74 759 6 Dq2 65 7 39 AY737282 DQ 355 7 96 GQ128443 AY 450 301 EU480 753 EU480 754 EU880443 DQ2 46 451 EF517 962 EF0 759 45 AY74 759 5 FJ947000 FJ919342 DQ379479 AY51 361 1 FJ 361 891 FJ8 953 29 EF398 052 EU480749...
- 7
- 384
- 0
Báo cáo y học: "Divergent expression of claudin -1, -3, -4, -5 and -7 in developing human lung" potx
... 13 16 16 20 20 20 22 23 24 26 26 28 28 30 30 35 35 35 39 40 41 42 A dult* 13 13 16 16 20 20 20 22 23 24 26 26 28 28 30 30 35 35 35 39 40 41 42 Adult* W eeks 13 13 16 16 20 20 20 22 23 24 26 26 ... 3. 65 , SD 2 .61 ) and alveolar (mean 3. 65 , SD 2 .61 ) periods RNA level of claudin-4 appeared to increase from pseudoglandular period (mean 2.21, SD 1.04) to canalicular period (mean 4.17, SD 2. 85) ... Cycling conditions were: at 95 C for three minutes, 40 cycles of amplification (each 95 C for 10 seconds and 56 °C for 30 seconds), one minute at 95 C, one minute at 55 °C and melt data acquisition...
- 10
- 319
- 0
Báo cáo y học: " Impact on respiratory tract infections of heptavalent pneumococcal conjugate vaccine administered at 3, 5 and 11 months of age" potx
... 744) 63 7 39.2 1 56 38.4 1 95 48.0 144 35. 5 142 35. 0 69 8 46. 9 1 56 41.9 220 59 ,1 162 43 .5 160 43.0 RR 95% CI P 0.83 0 .61 –1.02 0.02 0.91 0. 75 1.20 0. 06 0.81 0. 76 1.02 0.04 0.82 0 .62 –1.24 0.04 0.81 0 .61 –1.20 ... 340 (328– 361 ) 55 1 (67 .9) 82 ( 76 103) 143 (130– 158 ) 343 (331– 364 ) 4 76 (64 .1) 0. 96 0.93 0.92 0.11 52 7 ( 65 . 0) 33 (24–49) 35 (21 50 ) (2–4) 498 (66 .9) 33 (20– 46) 35 (21 51 ) (2–4) 0.44 0. 96 0.99 1.00 ... 239.0 1,0 35 255 .2 1,1 85 292.2 998 2 46. 1 65 9 162 .5 3, 460 232 .5 928 249.4 9 86 2 65 . 0 872 234.4 67 4 181.1 Total number of RTIs during follow-up Episodes/100 child-years RTIs in children aged 6 12 months...
- 9
- 284
- 0
Báo cáo y học: "Human defensins 5 and 6 enhance HIV-1 infectivity through promoting HIV attachment" ppsx
... Immunol 1991, 1 46( 8): 257 8- 258 7 35 Szyk A, Wu Z, Tucker K, Yang D, Lu W, Lubkowski J: Crystal structures of human alpha-defensins HNP4, HD5, and HD6 Protein Sci 20 06, 15( 12):2749-2 760 36 Ericksen B, ... of HD5 and HD6, [Abu]HD5 and [Abu]HD6 [24] We have previously shown that [Abu]HD5 and [Abu]HD6 not exert any HIV enhancing effect [17] The virus-defensin mixture was added to HeLa-CD4-CCR5 cells ... structures and electrostatic surface potentials ([ 35] and Figure 7) The electrostatic surface potentials of HD5 and HD6 monomers were previously described [ 35] We note that the HD5 and HD6 homodimers...
- 10
- 236
- 0
Báo cáo y học: " Comparison of the McGrath® Series 5 and GlideScope® Ranger with the Macintosh laryngoscope by paramedics" pptx
... 21 81 .5 ± 24 .5 68 .5 ± 22.9 87.2 ± 22.9 85. 0 ± 19.7 76. 7 ± 19.9 68 .7 ± 23 .6 96. 3 ± 6. 1 90 .5 ± 16 .5 83 .5 ± 20.3 84 ± 18.2 62 .7 ± 27.2 92.7 ± 10.8 79 .5 ± 28 .6 59 .2 ± 24 .5 92.7 ± 10.7 80 ± 25. 2 Mean ... Resuscitation 1999, 41 :63 -69 Russi CS, Wilcox CL, House HR: The laryngeal tube device: a simple and timely adjunct to airway management Am J Emerg Med 2007, 25: 263 - 267 Wackett A, Anderson K, Thode ... Med 20 05, 29: 253 - 257 doi:10.11 86/ 1 757 -7241-19-4 Cite this article as: Piepho et al.: Comparison of the McGrath® Series and GlideScope® Ranger with the Macintosh laryngoscope by paramedics Scandinavian...
- 5
- 327
- 0
Functional role of low density lipoprotein receptor related protein 5 and 6 in alzheimers disease
... between apoE4 and LRP5 /6 in a dosedependent manner 93 5. 3 .5 Dissociation of apoE4 and LRP5 /6 restores perturbed mitochondrial dynamics 96 5. 3 .6 Knockdown of LRP5 /6 abolishes ... LRP5 /6 AND APOLIPOPROTEIN E PROTEINS 56 4.1 Introduction 56 4.2 Materials and Methods 57 4.2.1 Cell culture and reagents 57 4.2.2 Mutagenesis 58 4.2.3 ... RECEPTOR-RELATED PROTEIN 5/ 6 IN SHSY5Y CELLS 75 5.1 Introduction 75 5.2 Materials and Methods 78 5. 2.1 Cell culture and reagents 78 5. 2.2 Polymerase Chain...
- 157
- 264
- 0
Vertical distribution of traffic generated PM2 5 and NO2 in a tropical urban environment
... Study 4)……………….…… 155 Table 5. 4 Daily Wind Speed for a Typical Week at Block 401 (Case Study 5) …….… 155 Table 5. 5 Weekly Mean Wind Speed at Block 401 (Case Study 5) ………………… 155 Table 5. 6 Daily Wind Speed ... (Case Study 6) ……… 1 56 Table 5. 7 Weekly Mean Wind Speed at Block 93 (Case Study 6) ……………………. 1 56 Table 5. 8 Weekly Mean Indoor and Outdoor temperatures for Case Studies - 6 157 Table 5. 9 Weekly Mean ... Direction …………………………………………………… 153 1 56 1 65 168 171 1 76 5. 2.3 Temperature and RH…………………………………………………………… 5. 2.4 Distribution Profile of NO2 Concentration 5. 2.4.1 Horizontal Distribution Profile...
- 272
- 269
- 0
The role of paxillin superfamily members hic 5 and leupaxin in b cell antigen receptor signaling 1
... 2 .6. 1 Buffers and solutions 2 .6. 2 Immunoprecipitation 2 .6. 3 Western blotting 2 .6. 4 Isolation of membrane fraction 45 46 47 47 50 50 51 52 53 54 55 55 56 56 57 58 58 59 59 59 60 61 62 62 62 62 63 ... Leupaxin Rationale and aims of this project 1 10 12 13 17 20 23 26 26 26 28 29 29 31 32 32 33 35 35 36 36 39 40 42 43 CHAPTER 2: MATERIAL AND METHODS 2.1 2.2 2.3 2.4 2 .5 2 .6 List of antibodies ... 47 50 50 51 52 53 54 55 55 56 56 57 58 58 59 59 59 60 61 62 62 62 62 63 63 64 65 65 66 67 68 CHAPTER 3: THE ROLE OF HIC -5 IN B CELL RECEPTOR SIGNALING 3.1 Introduction 3.2 Results 3.2.1 Yeast-two-Hybrid...
- 191
- 553
- 0
The role of paxillin superfamily members hic 5 and leupaxin in b cell antigen receptor signaling 2
... Shapiro, M J., and Shapiro, V S (20 06) Mol Cell Biol 26, 60 05 60 15 50 Yu, T C., Liu, Y., Tan, Y., Jiang, Y., Zheng, X., and Xu, X (2004) Acta Biochim Biophys Sin 36, 741–748 51 Cantrell, D (2002) ... Immunol 20, 6 75 67 8 10 Plas, D R., and Thomas, M L (1998) J Mol Med 76, 58 9 59 5 11 Lowell, C A (2004) Mol Immunol 41, 63 1– 64 3 12 Nishizumi, H., Horikawa, K., Mlinaric-Rascan, I., and Yamamoto, ... S L., and Gold, M R (19 95) Ann N Y Acad Sci 766 , 1 95 201 Hutchcroft, J E., Harrison, M L., and Geahlen, R L (1992) J Biol Chem 267 , 861 3– 861 9 Burg, D L., Furlong, M T., Harrison, M L., and Geahlen,...
- 11
- 334
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng 9 tr 25