mendler z sudaric b fazekas j knapic a bidin s 1997 etoflok injection solution in prophylaxis and therapy of m m a sydrome in swons praxis veterinaria zagreb 45 3 pp 261 265
Effect of injection timing on combustion and performance of a direct injection diesel engine running on Jatropha methyl ester
... India and masters degree in business administration from Faculty of Management Studies, Sukhadia University, Udaipur, India Presently serving as Associate Professor at College of Technology and ... India, 20 03 S Jindal, B. P Nandwana, N .S Rathore Comparative evaluation of combustion, performance and emissions of Jatropha methyl ester and Karanj methyl ester in a direct injection diesel engine ... Engineering, Volume 30 , Issues 2 -3, February 2010, Pages 245- 249 M Badami, F Mallamo, F Millo and EE Rossi Influence of multiple injection strategy on emissions, combustion noise and BSFC of a...
- 10
- 828
- 1
báo cáo hóa học: " In vitro and in vivo pre-clinical analysis of a F(ab’)2 fragment of panitumumab for molecular imaging and therapy of HER1-positive cancers" pot
... was again analyzed by SDSPAGE and SE-HPLC: the LMW was no longer present as shown in Figure 2b A final yield of 37 .3 mg of Page of 15 panitumumab F(ab’) was obtained as determined by protein quantitation ... panitumumab fragment was compared to intact panitumumab Trastuzumab F(ab’)2 was used as a negative control All values were corrected for on a nanomolar basis The immunoreactivity of the 111 In- panitumumab ... represents the first in vitro and in vivo characterization of panitumumab F(ab’) fragment with an emphasis on its evaluation towards both imaging and therapeutic applications Materials and methods Preparation...
- 15
- 452
- 0
BMJ volume 348 issue may23 1 2014 doi 10 1136%2fbmj g3284 ravi, b ; jenkinson, r ; austin, p c ; croxford, r ; wasserstei relation between surgeon volume and risk of complications after total hi
... Copyright of BMJ: British Medical Journal is the property of BMJ Publishing Group and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder 's ... to a listserv without the copyright holder 's express written permission However, users may print, download, or email articles for individual use ...
- 2
- 439
- 0
DSpace at VNU: Study of the production of A(b)(0) and (B)over-bar(0) hadrons in pp collisions and first measurement of the A(b)(0)- J psi pK(-) branching fraction
... M Martinelli39 , D Martinez Santos37 , F Martinez Vidal66 , D Martins Tostes2 , A Massafferri1 , R Matev38 , A Mathad48 , Z < /b> Mathe38 , C Matteuzzi20 , A Mauri40 , B Maurin39 , A Mazurov45 , M McCann 53 ... Saborido Silva37 , N Sagidova30 , P Sail51 , B Saitta15,e , V Salustino Guimaraes2 , C Sanchez Mayordomo66 , B Sanmartin Sedes37 , R Santacesaria25 , C Santamarina Rios37 , M Santimaria18 , E Santovetti24,k ... Artamonov35 , M Artuso59 , E Aslanides6 , G Auriemma25 ,m , M Baalouch5 , S Bachmann11 , J. J Back48 , A Badalov36 , C Baesso60 , W Baldini16 ,38 , R .J Barlow54 , C Barschel38 , S Barsuk7 , W Barter38...
- 17
- 137
- 0
Tài liệu Appendix B: Job Aid – Planning a Data Center Environment doc
... areas Airlocks Clean rooms Cages Smart cards and biometric devices Fingerprints Retina Other security devices Video cameras Electronic motion detectors Security alarms Guard patrols Staffing ... on site 24 hours a day, days a week Process Security Admitting personnel Admitting hardware Functional testing Admitting software Testing for viruses Testing for compatibility Analysis Capacity ... planning Performance monitoring System tuning Appendix B: Job Aid – Planning a Data Center Environment Change Management Change management process Identify issue Justification for change Approval...
- 4
- 248
- 0
Tài liệu Báo cáo khoa học: The role in the substrate specificity and catalysis of residues forming the substrate aglycone-binding site of a b-glycosidase docx
... Mendonca and S R Marana ¸ Results and Discussion Role of residues E190, E194, K201 and M4 53 in aglycone binding The spatial structures of ZmGlu1, SbDhr1 and BglB revealed groups of amino acid residues ... Nevertheless, just recently the structures of b- glycosidases (ZmGlu1 from Zea mays, SbDhr1 from Sorghum bicolor and BglB from Paenibacillus polymyxa) containing ligands in their aglycone-binding site ... Molecular basis for specificity of a b- glycosidase L M F Mendonca and S R Marana ¸ Namchuck NM & Withers SG (1995) Mechanism of Agrobacterium b- glucosidase: kinetic analysis of the role of noncovalent...
- 12
- 731
- 0
Tài liệu THE ENCYCLOPEDIA OF HOLLYWOOD: AN A TO Z GUIDE TO THE STARS, STORIES, AND SECRETS OF HOLLYWOOD docx
... Broadway Melody of 1 936 (1 935 ) and The Big Broadcast of 1 937 (1 936 ) and genuine starring roles in films such as Artists and Models (1 937 ) and Artists and Models Abroad (1 938 ) 36 BERGMAN, INGRID Jack Benny s ... is doing Yet an animal that becomes a star for any length of time is almost always an amazing creature capable of responding to an enormous number of commands In addition, such animals, just like ... II, actually) was still making movies when MGM made the words collie and Lassie almost synonymous The film was Lassie Come Home (19 43) , and a new dog star was born Lassie, whose real name was Pal...
- 561
- 659
- 0
Tài liệu Báo cáo Y học: The b-1,4-endogalactanase A gene from Aspergillus niger is specifically induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions pdf
... D-galactose and 6.6% L-arabinose, while soy arabinogalactan consists of 57% D-galactose and 38 % L-arabinose Methylation analysis demonstrated that a substantial amount of the L-arabinose residues ... Using potato and onion arabinogalactan as substrate, a small increase in all four products is observed during the incubation The product formation using soy arabinogalactan as a substrate is ... residues (14%) in soy arabinogalactan is present as terminal residues [21], suggesting that of these arabinogalactans, soy arabinogalactan is the most highly branched substrate Fig Expression of galA...
- 9
- 669
- 0
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C ppt
... Response, and Services, Massachusetts Department of Health, Jamaica Plain, Massachusetts Alison A Evans, Assistant Professor, Department of Epidemiology and Biostatistics, Drexel University School ... injections in health care settings (Hauri et al., 2004) Hepatitis B is also a major basis for social injustice in some endemic countries For example, myths and misinformation about modes of HBV transmission ... transmission in hospital and nonhospital health-care settings Information about discrimination and stigma associated with hepatitis B and hepatitis C and guidance on reducing them Information about...
- 191
- 457
- 0
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C doc
... Infectious Disease Prevention, Response, and Services, Massachusetts Department of Health, Jamaica Plain, Massachusetts Alison A Evans, Assistant Professor, Department of Epidemiology and Biostatistics, ... recombinant immunoblot assay ribonucleic acid respiratory syncytial virus SAMHSA SARS SEP STD STRIVE Substance Abuse and Mental Health Services Administration severe acute respiratory syndrome syringe ... year are due to unsafe injections in health-care settings (Hauri et al., 2004) Hepatitis B is also a major basis for social injustice in some endemic countries For example, myths and misinformation...
- 253
- 369
- 0
Báo cáo khoa học: Identification and characterization of B¢¢-subunits of protein phosphatase 2 A in Xenopus laevis oocytes and adult tissues Evidence for an independent N-terminal splice variant of PR130 and an extended human PR48 protein pot
... 1 03 75 87 157 49 90 177 119 107 2850 AACGAGgtaggc ATCAAGgtaaga ACACAGgtttga GCAAAGgtaatg GAGAAAgtaagt CTTCAGgtaatt ACCACGgtaggc TTGCAAgtatgc ACCAGGgtaagt AACAAGgtaaga TACCAGgtatga TTGATGgtgaga ... Hemmings, B. A (19 93) Analysis of subunit isoforms in protein phosphatase 2A holoenzymes from rabbit and Xenopus J Biol Chem 268, 733 0– 733 7 Bosch, M. , Cayla, X., Van Hoof, C., Hemmings, B. A. , Ozon, ... XPR 130 , the primers 5¢-GTTCCTGAGCAAAGTCTTCAATG -3 and 5¢-GG AATTCAGTGGAAAAACTTTACAT -3 for XN 73, and the primers 5¢-GGAATTCATGCCGACCACAACCGTT TTAAG -3 and 5¢-GGAGACAGTGACAAGTTATCTA GTGCT -3 for XPR70...
- 12
- 507
- 0
Báo cáo khoa học: Broad antibiotic resistance profile of the subclass B3 metallo-b-lactamase GOB-1, a di-zinc enzyme potx
... between subclasses B2 and B3 , as previously suggested (Garau et al [35 ]), but rather a new subclass B3 enzyme using a slightly smaller, more flexible, chelating residue Surprisingly, this glutamine ... Lamotte-Brasseur J, Rossolini GM, Spencer J, Dideberg O & Frere JM (2001) Standard numbering scheme for class B beta-lactamases Antimicrob Agents Chemother 45, 660–6 63 Valladares MH, Kiefer M, ... & Bennett PM (1996) Enzyme kinetics and biochemical analysis of ImiS, the metallo-beta-lactamase from Aeromonas sobria 16 3a J Antimicrob Chemother 37 , 4 23 431 15 Ullah JH, Walsh TR, Taylor IA,...
- 12
- 406
- 0
Chương 6 QU N TR CHI N LƯ CChi n lư c c p công tyTi n sĩ Nguy n Văn S.nM c tiêu nghiên c u1. Làm rõ t m quan tr ng c a chi n lư c c p công ty. 2. Tìm hi u n i dung cơ b n mà chi n lư c c p công ty ph i ñ t ra và gi i quy t. 3. N m ñư c các lo i hình potx
... thu h p ph m vi: Ch p nh n gi m s lư ng SBU, rút lui kh i m t s ngành (thu h p ph m vi ho t đ ng gi m qui m c a doanh nghi p) Theo đó, m nh tay đóng c a hay b n b t m t s ñơn v kinh doanh không ... (Integrative Growth Strategy) Strategy) Các chi n lư c tăng trư ng h i nh p: Chi n lư c h i nh p ph a sau (Backward Integrative Strategy) Chi n lư c h i nh p ph a trư c (Forward Integrative Strategy) ... a d ng h a đ ng t m M c tiêu: tăng doanh l i qua phát hành s n ph m m i (ñ ng d ng v i s n ph m hi n t i) th trư ng m i Bi n pháp: khai thác t t l c hi n có v cơng ngh s n xu t, marketing… Lưu...
- 17
- 426
- 0
Chương 8 QU N TR CHI N LƯ CChi n lư c c p ch c năngTi n sĩ Nguy n Văn S.nM c tiêu nghiên c u1. Làm rõ t m quan tr ng c a chi n lư c c p ch c năng. 2. Tìm hi u n i dung cơ b n mà chi n lư c c p ch c năng ph i ñ t ra và gi i quy t. 3. N m ñư c các lo pptx
... lư ng M c tiêu: T p trung c i ti n nâng cao ch t lư ng s n ph m, d ch v ð mb os n ñ nh ch t lư ng, ñ m b o v sinh, an toàn th c ph m K t h p ñ m b o trách nhi m xã h i c a s n ph m x lý m i trư ... n tr s n xu t M c tiêu: S n xu t hàng h a, d ch v ñáp ng ñ y ñ yêu c u c a c a k ho ch kinh doanh ð m b o trình s n xu t liên t c, khai thác t i a cơng su t m y m c thi t b , nâng cao su t, ... nhu c u (mong mu n m c c u) c a khách hàng m c tiêu Nâng cao s c c nh tranh, m r ng th ph n, t o s ñ phát tri n b n v ng 8-16 Qu n tr marketing Bi n pháp: Nghiên c u m i trư ng marketing, nhu...
- 16
- 524
- 0
Báo cáo khoa học: Detection and characterization of a novel extracellular fungal enzyme that catalyzes the specific and hydrolytic cleavage of lignin guaiacylglycerol b-aryl ether linkages pdf
... Pseudomonas paucimobilis enzyme that cleaves beta-aryl ether J Bacteriol 1 73, 7950–7955 14 Masai, E., Katayama, Y., Kubota, S. , Kawai, S. , Yamasaki, M & Morohoshi, N (19 93) A bacterial enzyme degrading ... cleavage enzyme from 2BW-1 Isolation of microorganisms that can cleave b- aryl ether linkages A very sensitive assay was necessary for isolation of microorganisms that can cleave b- aryl ether linkages, ... low-molecular mass lignins that retain benzene rings Such lignins would have enormous biomass and be useful as an industrial material Therefore in this study, we tried to detect and characterize...
- 10
- 670
- 0
synthesis of single-crystalline hollow b-feooh nanorods via a controlled
... agreement with the data from IR spectra The first weight loss in Figure 5a and b may be attributed to the emission of absorbed alcohol and H2O The last weight loss in two samples may be ascribed ... solid nanorods There was still some amorphous Fe(OH )3 remained within the b- FeOOH solid nanorods At the same time, chitosan and n-propanol absorbed onto the surfaces of Fe(OH )3 and b- FeOOH nanoparticles ... 2004 Synthesis of single-crystalline ZnO polyhedral submicrometer-sized hollow beads using laser-assisted growth with ethanol droplets as soft templates Adv Mater 16, 904–907 Kanno R., T Shirane,...
- 8
- 355
- 0
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C pdf
... Response, and Services, Massachusetts Department of Health, Jamaica Plain, Massachusetts Alison A Evans Assistant Professor, Department of Epidemiology and Biostatistics, Drexel University School ... National Institutes of Health, Bethesda, Maryland Randall R Mayer Chief, Bureau of HIV, STD, and Hepatitis, Iowa Department of Public Health, Des Moines, Iowa Margaret L Brandeau Professor, Department ... of specific at-risk populations room as soon as they are stable and washed School-entry mandates have been shown to increase hepatitis B vaccination rates and to reduce disparities in vaccination...
- 4
- 404
- 1
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25