0

lt style type quot text css quot gt a link color blue text decoration none a active color red text decoration none a visited color blue text decoration none a hover color green text decoration underline lt style gt

Báo cáo khoa học:

Báo cáo khoa học: "The effect of domain and text type on text prediction quality" pptx

Báo cáo khoa học

... of the algorithm (Garay-Vitoria and Abascal, 2006) The performance that can be obtained by text prediction algorithms depends on the language they are evaluated on Lower results are obtained for ... We save the training data as a classification data set: each character in the buffer fills a feature slot and the word that is to be predicted is the classification label Figures and give examples ... neurological damage may have communicative disabilities because their speaking and writing skills are impaired For these patients, existing online care platforms are often not easily accessible Aphasia,...
  • 9
  • 465
  • 0
Nghị luận "Độc Tiểu Thanh ký" của Nguyễn Du

Nghị luận "Độc Tiểu Thanh ký" của Nguyễn Du

Ngữ văn

... Thanh ba trăm năm trước giọt lệ chân thành trái tim đồng điệu, dòng suy tưởng đ a nhà thơ đến ba trăm năm sau mối hồ nghi khó giải t a Tiểu Thanh có lòng tri kỷ Nguyễn Du tìm đến để r a oan khiên ... người đời sau ẩn ch a khát khao tìm gặp lòng tri âm tri kỷ đời (Đó tâm trạng Khuất Nguyên – “người đời say ta tỉnh”, cách Nguyễn Du hai nghìn năm; Đỗ Phủ, cách Nguyễn Du nghìn năm : “Gian nan khổ ... đạo cao nhà thơ Độc Tiểu Thanh ký có ngh a “đọc tập Tiểu Thanh ” nàng Tiểu Thanh Đó người gái có thật, sống cách Nguyễn Du ba trăm năm trước đời Minh (Trung Hoa) Tương truyền Phùng Tiểu Thanh...
  • 5
  • 455
  • 1
Phân tích nhân vật ông Hai trong tác phẩm "Làng" của Kim Lân

Phân tích nhân vật ông Hai trong tác phẩm "Làng" của Kim Lân

Ngữ văn

... Nhã Nam , Bố Hạ, Cao Thượng… đâu nghe đến người làng chợ Dầu người ta đuổi đuổi hủi” Còn muốn ch a chấp người dân làng Việt gian chứ? Trước mắt ông Hai có hai đường Ở lại không Còn làng… V a chớm ... người anh hùng kháng chiến, ông Hai trước thất bại địch: Chỗ giết tên Pháp với hai tên việt gian, chỗ phá đổ xe tăng xe díp “ruột gan lão m a lên, vui quá” Nhưng đâu đớn, tủi nhục cho ông Hai nghe ... Lòng trung thành cha ông, hàng triệu nông dân Việt Nam lãnh tụ vô sâu sắc Vẻ đẹp đáng tự hào ca ngợi Đến giây phút này, từ bi kịch ông Hai, ta lại thấy sáng ngời lên tình cảm cao đẹp khác Đó tinh...
  • 4
  • 839
  • 1
Phân tích đoạn trích "Chị em Thúy Kiều" của Nguyễn Du

Phân tích đoạn trích "Chị em Thúy Kiều" của Nguyễn Du

Ngữ văn

... nhà thơ v a miêu tả nhan sắc , v a ca ngợi tài : Sắc đành tài , đành hoạ hai Như vậy, sắc đành có Thúy Kiều tài may ra, h a hoằn có người thứ hai Thứ trí thông minh sẵn có tạo h a ban tặng: Thông ... sẵn tính trời Pha nghề thi h a đủ mùi ca ngâm Cung thương lầu bậc ngũ âm , Nghề riêng ăn đứt hồ cầm trương Khúc nhà tay l a nên chương Xét riêng tài đánh đàn Thúy kiều vượt xa người khác Những ... nàng Kiều cần ngoảnh lại thành người ta bị xiêu, ngoảnh lại nước người ta bị đổ Chao ôi ! Thúy Kiều tuyệt giai nhân Nhưng qua nghệ thuật miêu tả vẻ đẹp lộng lẫy ,đài các, kiêu , có sức hút mãnh...
  • 3
  • 319
  • 2
Báo cáo khóa học: Type 2 isopentenyl diphosphate isomerase from a thermoacidophilic archaeon Sulfolobus shibatae potx

Báo cáo khóa học: Type 2 isopentenyl diphosphate isomerase from a thermoacidophilic archaeon Sulfolobus shibatae potx

Báo cáo khoa học

... extracting GGPP, was washed with water saturated with NaCl, and the radioactivity in 100 lL of the butanol layer was measured NADH dehydrogenase assay The standard assay mixture for the NADH ... basis of the nucleotide sequence of pGGPS1, the ORF3 was amplified using the PCR primers 5¢-TAAATCATGATAACGG GCATGACTGG-3¢ and 5¢-TTAAGGGATCCATATT CTTCTCTTTCTAAC-3¢ The genome of S acidocaldarius, ... Smit, A & Mushegian, A (2000) Biosynthesis of isoprenoids via mevalonate in Archaea: the lost pathway Genome Res 10, 1468– 1484 Kaneda, K., Kuzuyama, T., Takagi, M., Hayakawa, Y & Seto, H (2001) An...
  • 7
  • 164
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " Oligomerization of the human immunodeficiency virus type 1 (HIV-1) Vpu protein – a genetic, biochemical and biophysical analysis" ppt

Hóa học - Dầu khí

... R5TM-F, CATGGAGATGTTAAATTTAGATTATAAATTAGGAGTAGG AGCATTGATAGTAGCACTAATCATAGCAATAGTCGTGTGGACCATAGTATATATAGAATAGG and R5-TM-R, AATT CCTATTCTATATATACTATGGTCCACACGACTATTGCTATGATTAGTGCTA CTATCAATGCTCCTACTCCTAATTTATAATCTAAATTTAACATCTC ... CATGGAGATGCAACCTATAATAGTAGCAATAGTAGCATT AGTAGTAGCAATAATAATAGCAATAGCTGTGTGGTCCATAGTAATCATAGAATAGG and NL-TM-R, AATTCCTATTCTATGATTACTATGGACCACACAGCTATT GCTATTATTATTGCTACTACTAATGCTACTATTGCTACTATTATAGGTTGCATCTC; for the ... italics): For the NL4-3 vpu gene, Vpu-NL-F, GGATCCATGCAACCTATAATAGTA GCAATA and VpuNL-R, GAATTCACTACAGATCATCAATATCCCAAG; for the R5 vpu gene, Vpu-R5-F, GGATCCATGTTAAATTTAGATTATAAATTAGGAGTA GG and...
  • 11
  • 436
  • 0
Báo cáo toán học:

Báo cáo toán học: "A Gessel–Viennot-Type Method for Cycle Systems in a Directed Graph" doc

Báo cáo khoa học

... doctoral dissertation [6] A preliminary version of this article appeared as a poster at the 2005 International Conference on Formal Power Series and Algebraic Combinatorics in Taormina, Italy The author ... determinantal method to calculate #APn , the sequence of determinants is not calculable by a J-factor expansion, as was the case in Brualdi and Kirkland’s work Using the same method as for Aztec diamonds, ... some walk of Wm either at vi , at wk+i, or both So there are four cases: Case ci intersects a walk cχβ at vi and no walk at wk+i Case ci intersects a walk cχγ at wk+i and no walk at vi Case ci...
  • 28
  • 227
  • 0
Enterovirus type 71 2A protease functions as a transcriptional activator in yeast ppsx

Enterovirus type 71 2A protease functions as a transcriptional activator in yeast ppsx

Báo cáo khoa học

... (5’-CATAATGACTGGGCAAACTCATCTACCACTGCTCAA-3’) L30/43-AS 2AY-AS101 (5’-TTGAGCAGTGGTAGATGAGTTTGCCCAGTCATTATG-3’) (5’-CCGCTCGAGTTACTGATCATCCAACCACAGAAG-3’) 2A- AS301 (5’-GCTCTAGACTGATCATCCAACCACAGAAG-3’) CoxB2AY-S ... (5’-CCGCTCGAGTTACTGCTCCATGGCTTC-3’) 2AY-21S (5’-GGAATTCCATCTTGCTACTCATAA-3’) 2AY-41S (5’-GGAATTCCTCGTATCATCTACCAC-3’) 2AY-61S (5’-GGAATTCGGAGTGTATTATTGTAA-3’) 2AY-90AS (5’-TTATTAATAATACTCGCTGGCCTC-3’) ... 2AY-110AS (5’-TTATTAGCAATCCCCTGGTTCCGA-3’) 2AY-130AS VP1/ 2A- S (5’-TTATTAGCAATCCCCTGGTTCCGA-3’) (5’-CCATCGATATGATGGGTACGTTC-3’) 2A- S10 (5’-GGAATTCATGGGGAAATTTGGACAGCAG-3’) 2A- AS2 (5’-GCTCTAGACTACTGCTCCATGGCTTCATCATC-3’)...
  • 9
  • 244
  • 0
báo cáo khoa học:

báo cáo khoa học: " Duodenal gastrointestinal stromal tumor resembling a pancreatic neuroendocrine tumor in a patient with neurofibromatosis type I (von Recklinghausen’s disease): a case report" potx

Báo cáo khoa học

... 3-9-Fukuura, Kanazawa-ku Yokohama 236-0004, Japan 2Gastroenterological Surgery Division, Yokohama City University Hospital, Yokohama, Japan 3Pathological Division, Yokohama City University Hospital ... arthritis and NF1 was admitted to our hospital for the treatment of a tumor of a pancreas She had no symptoms, but an abdominal ultrasonography screening examination had revealed a hypoechoic mass ... GISTs are hypervascular and may have cystic and necrotic components combined with intramural and extramural tumor growth and signs of malignancy Small tumors are depicted on CT scans as sharply marginated...
  • 4
  • 170
  • 0
báo cáo khoa học:

báo cáo khoa học: "A possible new syndrome with double endocrine tumors in association with an unprecedented type of familial heart-hand syndrome: a case report" ppsx

Báo cáo khoa học

... Graduate School of Medical Science, Kanazawa University Graduate School of Medical Science, Kanazawa University, 13-1 Takara-machi, Kanazawa, 920-8641, Japan 4Division of Rheumatology, Department ... Science, Kanazawa Universit, 13-1 Takara-machi, Kanazawa, 920-8641, Japan 2Department of Internal Medicine, Komatsu Municipal Hospital, HO-60 Mukai Moto-ori-machi, Komatsu, Japan Department of ... with heart-hand syndrome and cardiac pacemaker Congenit Heart Dis 2008, 3(3):219-222 Demura R, Naruse M, Isawa M, Onoda N, Naruse K, Yamakado M, Demura H: A patient with a prolactinoma associated...
  • 4
  • 270
  • 0
Báo cáo khoa hoc:

Báo cáo khoa hoc:" Applying the Stages of Change model to Type 2 diabetes care in Trinidad: A randomised trial" pptx

Báo cáo khoa học

... Stratton IM, Adler AI, Neil HA, Matthews DR, Manley SE, Cull CA: Association of glycemia and macrovascular and microvascular complication of type diabetes (UKPDS 35): prospective observational ... outcome variable measured was HbA1c level All HbA1c samples were tested at the same laboratory in the San Fernando hospital, Southwest Regional Health Authority in Trinidad Other variables recorded ... intervention resulted in a greater reduction of HbA1c than standard care, but this did not reach statistical significance [13] So this paper adds to the literature by illustrating that a statistically significant...
  • 8
  • 260
  • 0
báo cáo khoa học:

báo cáo khoa học:" Prevalence of chronic complications of type 2 diabetes mellitus in outpatients - a cross-sectional hospital based survey in urban China" docx

Báo cáo khoa học

... study had an above-average rate of vascular complications Microvascular conditions in particular markedly increased over time since diabetes had been diagnosed As a result, the estimated case burden ... (males: 31.1%; females: 35.1%) had at least one macrovascular complication and 34.7% (males: 28.9%; females: 38.8%) had at least one microvascular complication Geographic and demographic stratification ... Inc., Cary, USA) Continuous variables were summarized with mean and median, and categorical variables as percentages Pearson and trend χ2-tests were used to explore associations in categorical and...
  • 9
  • 330
  • 0
Báo cáo y học:

Báo cáo y học: "Two discrete events, human T-cell leukemia virus type I Tax oncoprotein expression and a separate stress stimulus, are required for induction of apoptosis in T-cells" pptx

Báo cáo khoa học

... through NF-kappaB in apoptosis-resistant T-cell transfectants with Tax J Virol 1999, 73:7981-7987 Kawakami A, Nakashima T, Sakai H, Urayama S, Yamasaki S, Hida A: Inhibition of caspase cascade by ... 273:6698-6703 Tanaka A, Takahashi C, Yamaoka S, Nosaka T, Maki M, Hatanaka M: Oncogenic transformation by the tax gene of human T-cell leukemia virus type I in vitro Proc Natl Acad Sci U S A 1990, 87:1071-1075 ... in ApoAlert caspase colorimetric assay kits (Clontech, Palo Alto, CA) or caspase-9 colorimetric protease assay kit (Panvera/Takara) Cell lysates were microcentrifuged at 12,000 rpm for at 4°C and...
  • 12
  • 240
  • 0
MATH TYPE  6.7 giúp soạn g/a toán

MATH TYPE 6.7 giúp soạn g/a toán

Toán học

... vài thao tác sau: - Chọn chế độ tất file ẩn cho Windows - Vào thư mục theo đường dẫn C:\Program files\Mathtype\Office Support Chép tệp tin MathType Commands For Word.dotm(nhớ dotm, ẩn ta không ... MathPage.wll - Mở thư mục C:\Program Files\Microsoft Office\Offce14\Startup dán file vào - Mở Word ta thấy thông báo bảo vệ trước Macro là, nháy vào dòng thông báo chọn chấp nhận (trust)tất Macro ... bảng (Chủ yếu mục Organization Product Key) Với Office 2010 thông báo Vào Word ta thấy chương trình tạo Tab (2003 2007 phải thêm công đoạn chấp nhận Macro) Một mẹo nhỏ để gõ nhanh công thức toán...
  • 4
  • 101
  • 0
Vận dụng tư tưởng sư phạm tích hợp trong dạy học một số kiến thức về "Hạt nhân nguyên tử" lớp 12

Vận dụng tư tưởng sư phạm tích hợp trong dạy học một số kiến thức về "Hạt nhân nguyên tử" lớp 12

Thạc sĩ - Cao học

... Vinh, Chu Văn An, Đ Hỷ (Thái Nguyên), s GV tham gia vấn 45 ồng ố (Trong có 27 GV nữ, 18 GV nam) * Có 31 GV có thời gian tham gia dạy lớp 12 từ 10 năm trở lên * Có 11 GV có thời gian dạy lớp 12 ... http://www.lrc-tnu.edu.vn P.L.Kapitsa … Đ trình bày nhng kh a cạnh trình sáng tạo ã ữ khoa học dạng chu trình sau [30]: Mô hình giả định trừu tượng Các hệ lôzic Những kiện khởi đầu Thí nghiệm kiểm tra Ta có th mô ... hoá lý thuyết diễn qua giai đoạn sau: * Quan sát nh thu thập liệu thực nghiệm, giai đoạn ằm HS phải mô tả lời tượng quan sát điều kiện tượng diễn * Khái quát hoá nh ững kết quan sát làm bật chung,...
  • 120
  • 1,772
  • 4
Thiết  kế tiến trình hoạt động dạy học một số kiến thức  " chất khí"

Thiết kế tiến trình hoạt động dạy học một số kiến thức " chất khí"

Thạc sĩ - Cao học

... http://www.lrc-tnu.edu.vn Chúng ta minh h a cách thức hai học sinh (A B) giải vấn đề góc khác Góc dành cho HS có tốc độ học nhanh A B Đƣờng HS A Đƣờng HS B Sơ đồ 1.3 Hoạt động học theo góc hai học sinh A, B Trong trƣờng ... không hay bị bắt buộc gia đình, bạn bè, xã hội… + Thực nhiệm vụ GV giao mức độ thấp hay cao + Tích cực thời hay thƣờng xuyên, liên tục + Tích cực ngày tăng hay giảm dần + Có kiên trì vƣợt khó hay ... từ sau quan sát mức độ tham gia lực học sinh lớp Nếu GV có đƣợc nhận định đầy đủ lực mức độ tham gia học sinh, hoạt động tự cho em hội quý giá để khai thác sâu thêm kiến thức bên Thời gian đầu,...
  • 134
  • 1,332
  • 8
Tài liệu mới  về "kinh doanh sức khỏe"

Tài liệu mới về "kinh doanh sức khỏe"

Tài liệu khác

... liên doanh Nexsan (Hàn Quốc) khí Yên Viên; Công ty Liên doanh Nexsan-Lioa, liên doanh Nexsan (Pháp) Công ty TNHH Lioa; Công ty Liên doanh TSC, liên doanh Taihan (Hàn Quốc) Công ty Cổ phần Sacom ... điện Taya Việt Nam (Đài Loan), Công ty Cáp điện Evertop (Đài Loan); công ty liên doanh gồm: Công ty LG-Vina, liên doanh Hàn Quốc Công ty Điện nước lắp máy Hải Phòng; Công ty Cáp điện Deaung-Vina, ... khoản phí tối thiểu (50 nghìn đôla Singapore) tối a (200 nghìn đôla Singapore) cố định tương ứng Phí hàng năm từ 25 nghìn đôla Singapore đến 100 nghìn đôla Singapore Quy định cổ phiếu quỹ, cổ...
  • 71
  • 372
  • 0

Xem thêm