lamata 2006 consistency in the analytic hierarchy process a new approach international journal of uncertainty fuzziness and knowledge based systems vol 14 no 4
... first, then to start drawing thehierarchy model Guidelines for formulation ofahierarchy are available inthe literature and numerous proven ready-made hierarchies are also available Saaty and ... application on overall linkage as well as individual linkage The first part ofthe work involves fixation of objective, actors, factors, andthe linkage alternatives and then structuring ofhierarchy to ... Individual Linkage 18 Figure I .4 : Flows of linkage factors inthe Innovation Triangle 19 Table 1 .4 : An example ofinand out flow of factors inthe innovation triangle 21 Figure I.5 : Hierarchy...
... RECOMMENDATIONS TURN OUT LIKE THIS? BUT BOSS THAT WAS MY BEST GUESS! GUESS AGAIN MAYBE YOU NEED ANEWAPPROACH another way of decision making I THINK I ‘LL TRY THEANALYTICHIERARCHYPROCESS (AHP) ... WHAT ABOUT FUEL ECONOMY? ANOTHER GOOD QUESTION 31 SKEPTIC-GATOR AS STATED EARLIER, AHP CAN COMBINE BOTH QUALITATIVE AND QUANITATIVE INFORMATION FUEL ECONOMY INFORMATION IS OBTAINED FOR EACH ALTERNATIVE: ... Saturn Escort Clio WHAT ABOUT THE ALTERNATIVES? I’M GLAD YOU ASKED 28 SKEPTIC-GATOR Page 1414IN TERMS OF STYLE, PAIRWISE COMPARISONS DETERMINES THE PREFERENCE OF EACH ALTERNATIVE OVER ANOTHER...
... necessarily the best method of reading data into an analysis All leading latent variable programs are capable of reading raw data as text files, and many can read data saved in other software formats ... factors andthe pattern of indicator–factor loadings in advance, as well as other parameters such as those bearing on the independence or covariance ofthe factors and indicator unique variances The ... contains a series of defaults that automatically specify marker indicators, free and fixed factor loadings, factor variances and covariances, and so forth, ina standard CFA model) On a related note,...
... Chem 279, 1 143 2– 1 144 3 Eki T, Naitou M, Hagiwara H, Ozawa M, Sasanuma SI, Sasanuma M, Tsuchiya Y, Shibata T, Hanaoka F & Murakami Y (1996) Analysis ofa 36.2 kb DNA sequence including the right ... (lanes and 4) material were separated by centrifugation, and analyzed by SDS ⁄ PAGE and protein staining with Coomassie Brilliant Blue The protein ladder was run on the same gel (lane 5) ATPase ... for the facts that about 50% ofthe luminal proteins leak out ofthe organelle during tissue homogenization and that the inner volume ofthe RM is small as compared to the total volume of the...
... :'V-' VOLUME 21, NUMBER 1, FALL 1985 THEINTERNATIONALJOURNALOF ACCOUNTING EDUCATION AND RESEARCH UNIVERSITY OF ILLINOIS AT URBANA-CHAMPAIGN CENTER FOR INTERNATIONAL EDUCATION AND RESEARCH IN ACCOUNTING ... and research inthe accounting discipline, to provide a base for theinternational exchange of ideas and materials relating to accounting education, to encourage and assist both accounting faculty ... University of Illinois at Ur- bana-Champaign The graduate training ofa substantial number ofinternational students has been an important activity ofthe department for many One ofthe years specific...
... while the permanent runoffs are closely related to rainfall The features of drainage density play an important role in inducing landslide phenomena in this area The drainage network ofthe ULRC has ... dissected and inclined terrain It comprises high mountains inthe north andthe west, in which karst landscapes are the particular features ofthe north The Lo River is the main channel system in these ... (10) agricultural and other land, and (11) settlements and barren land The land cover map is shown in Fig 5f Factor weighting and susceptibility index The analyses for weighting and ranking of the...
... in Thailand (Meeampol and Ogunlana, 2006) Improper planning was the first cause of delays in construction in Malaysia (Sambasivan and Soon, 2007) 5 .4 Infrastructural complexity Infrastructural ... (Ghosh and Jintanapakanont, 20 04) The number of contract/work packages determined the size of each work package andthe number, specialties, and experience of contractors involved ina project The ... Fuzzy AHP to deal with uncertaintyin judgment ofthe practitioners and imprecision in pairwise comparisons in AHP Fuzzy AHP is a practical method for dealing with fuzzinessanduncertaintyin MCDM...
... by the manufacturer Inthe preliminary step to nawwor down the species of NOB, the primer set FGPS872f, CTAAAACTCAAAGGAATTGA and FGPS1269r , TTTTTTGAGATTTGCTAG (Degrange and Bardin, 1995) was ... sedimentation tank Influent was 60L/day pH was 8.0-8.5 inthe anoxic tank, and 7.0-7.5 inthe aerobic tank The water temperature was 25oC-30oC The sludge retention time (SRT) was maintained at 50days until ... buffer at pH8.0, and stored at -20oC Another was for FISH analysis and was stored at -80oC The extraction of DNA was performed with Fast DNA SPIN Kit for Soil (Qbuiogene, USA) according to the instruction...
... Brigliadoria , P Capiluppia,b , A Castroa,b , F.R Cavalloa , M Cuffiania,b , G.M Dallavallea , F Fabbria , A Fanfania,b , D Fasanellaa,1 , P Giacomellia , C Grandia , S Marcellinia , G Masettia , ... Italy N Amapanea,b , R Arcidiaconoa,c , S Argiroa,b , M Arneodoa,c , C Biinoa , C Bottaa,b , N Cartigliaa , R Castelloa,b , M Costaa,b , N Demariaa , A Grazianoa,b , C Mariottia,1 , S Masellia , ... Migliorea,b , V Monacoa,b , M Musicha , M.M Obertinoa,c , N Pastronea , M Pelliccionia , A Potenzaa,b , A Romeroa,b , M Ruspaa,c , R Sacchia,b , A Solanoa,b , A Staianoa , P.P Trapania,b , A Vilela...
... molecular mass markers Lanes 1–3: SDS ⁄ PAGE stained with Coomassie R250 Lanes and 5: immunostaining with mAb III-10D Lanes and 7: immunostaining with mAb I-3B Lanes and 9: immunostaining with mAb ... formation) is carried out by the intermolecular pairing ofAanda polymerization sites of fibrin monomers Site A (Aa17–19) is exposed inthe N-terminal region ofthe Aa-chain by the splitting ... remained unresolved as to when during fibrin polymerization BbArg 14 plays a role Our results with mAbs 2d) 2a [15] andthe data obtained by Moen et al [ 14] with the fibrinogen variant BbArg14His...
... forearm A tourniquet was used, and standard disinfection and draping carried out A distal Henry approach was carried out inthe interval between the flexor carpi radialis tendon andthe radial artery ... In most cases, the proximal part ofthe plate was placed under the main body ofthe pronator quadratus muscle The brachioradialis tendon was partially released from the radial aspect ofthe styloid; ... Radiological analysis included fracture AO-classification Preoperatively and postoperatively, joint inclination inthe lateral view, radial inclination inthe anteroposterior view, loss of radial...
... Tang Integrated Geographic Information SystemsBased Suitability Evaluation of Urban Land Expansion: A Combination ofAnalyticHierarchyProcessand Grey Relational Analysis 24 Vahidniaa, Alesheikhb, ... on AHP and GIS in Changzhou City, China Guillermo A Mendoza A gis -based multicriteria approaches to land use suitability assessment and allocation Fu Yang, Guang-Ming Zeng, Chunyan Du, Lin Tang ... Alesheikhb, Alimohammadic, Bassirid fuzzy analytical hierarchyprocessin gis application Pentti Hyttinen and Artur Nilson Integrating Environmental Values into Forest Planning – Baltic and Nordic...
... decisive factors, and customers can aware about the car by brand name, functionality and how the safe of car, the quality, style, and packaging does, and how the service after sale does, they are can ... developing Key research area - Object of study: The organizing marketing activities in automobile industry in generally, and especially in member of VAMA The main contents are including organizing the ... country, capable of meeting the highest demand of local market and joining regional andinternational market From the customers expectation that Vietnam will has the developed automobile market and...
... nhân tố ma trận ý kiến chuyên gia C A1 A2 A3 … An A1 A1 2 A1 3 … A1 n A2 1 /a1 2 A2 3 … A2 n A3 1 /a1 3 1 /a2 3 … A3 n … … … … … An 1 /a1 n 1 /a2 n 1 /a3 n … (A1 , A2 , A3 , …., An nhân tố) Trong ma trận A này, phần ... cột ma trận: a ij Bảng 3.2: Ma trận so sánh nhân tố C A1 A2 A3 … An A1 A1 2 A1 3 … A1 n A3 1 /a1 2 A2 3 … A2 n A3 1 /a1 3 1 /a2 3 … A3 n … … … … … An 1 /a1 n 1 /a2 n 1 /a3 n … ∑ n a 1j n n a 2j a 3j ... ERSI Learning visual basic for application for Arcgis developers 199 papes [2] Kang –Tsung Chang Programming Arcobject with VBA 341 papes [3] Michael Zeiler, ESRI, 2001 Exploring ArcObjects, Volume...
... Footer Page 18 of 161 15 Header Page 19 of 161 Bảng 3.1: Các nhân tố ma trận ý kiến chuyên gia C A1 A2 A3 … An A1 A1 2 A1 3 … A1 n A2 1 /a1 2 A2 3 … A2 n A3 1 /a1 3 1 /a2 3 … A3 n … … … … … An 1 /a1 n 1 /a2 n 1 /a3 n ... cột ma trận: a ij Bảng 3.2: Ma trận so sánh nhân tố C A1 A2 A3 … An A1 A1 2 A1 3 … A1 n A3 1 /a1 2 A2 3 … A2 n A3 1 /a1 3 1 /a2 3 … A3 n … … … … … An 1 /a1 n 1 /a2 n 1 /a3 n … ∑ n a 1j n n a 2j a 3j ... Nguyên, Khoa Công Nghệ Thông Tin Tiếng Anh [1] ERSI Learning visual basic for application for Arcgis developers 199 papes [2] Kang –Tsung Chang Programming Arcobject with VBA 341 papes [3] Michael Zeiler,...
... “Physical hazard” sau: III AHP TRONG QUẢN LÝ RỦI RO AN TOÀN XÂY DỰNG Các cặp ma trận so sánh tiêu chí tiêu chuẩn “Chemical hazard” sau: III AHP TRONG QUẢN LÝ RỦI RO AN TOÀN XÂY DỰNG Các cặp ma trận ... XÂY DỰNG III AHP TRONG QUẢN LÝ RỦI RO AN TOÀN XÂY DỰNG Các cặp ma trận so sánh tiêu chí tiêu chuẩn “Accident hazard” sau: III AHP TRONG QUẢN LÝ RỦI RO AN TOÀN XÂY DỰNG Các cặp ma trận so sánh ... ro an tồn trình bày d a mơ hình COS AHP Tác động ngành: báo cung cấp công cụ cho người định xác định khoản đầu tư phòng ng a tai nạn lao động dự án d a theo ngân sách đề xuất II MƠ HÌNH COST OF...
... highest among the experimental cases in Table The validation ofthe RSM model indicates adequate and reasonable operating inthe polymer flood process CONCLUSIONS The combination of mathematical statistical ... decreasing on the NPV Analyzing the graph of Figure 1a andthe values of Table 3b it can be inferred that the interaction factors ofthe water injection rate and polymer concentration were the ... Response surface optimization is more advantageous than the traditional single parameter optimization in that it saves time, space, and injection raw material There are a total of14 scenarios for...
... inference of Matlab software following the formula (5) and (6) The maximum value of FRTS has the highest ranking andthe minimum value of FRTS has lowest ranking as also shown in Table The maximum average ... wear and 59 .4% the width of crater wear when using nanolubricant with 0.5% Al2O3-20 nm and decreasing 32.1% the flank wear and 46 ,4% the width of crater wear when using nanolubricant 0.3% Al2O3-20 ... 0 .43 5 REFERENCES [1] Anuj Kumar sharma, Rabesh Kumar Singh, Amit Rai Dixit, Arun Kumar Tiwari, Characterization and experimental investigation of Al2O3 nanoparticle based cutting fluid in turning...