j kang hw cohen de 2009 thioesterase superfamily member 2 them2 acyl coa thioesterase 13 acot13 a homotetrameric hotdog fold thioesterase with selectivity for long chain fatty acyl coas biochem j
Expression dynamics of the hepatic mitochondrial proteome of the sod2+ mouse in response to troglitazone administration
... Pace et al (20 03); Velsor et al (20 04) Haasio et al (20 0 2a, b,c) Bedoucha et al (20 01); Haskins et al (20 01); Tirmenstein et al (20 02) ; Narayanan et al (20 03); Shishido et al (20 03); Bova et al ... chromatography 3-nitrotyrosine 3-methylglutaconic aciduria 8-hydroxydeoxyguanosine 8-oxo-hydrodeoxyguanosine Alanine aminotransferase Asparate aminotransferase Area under curve Carbonate radical anion ... Tuschl (20 03); Chowdhury et al (20 06) Note et al (20 03); Desai et al (20 08) Spodnik et al (20 02) McDougall et al (1983); Masubuchi et al (20 00) Mingatto et al (20 00); Caparroz-Assef et al (20 01);...
- 226
- 1,830
- 0
Tài liệu Báo cáo khoa học: Altered inactivation pathway of factor Va by activated protein C in the presence of heparin doc
... cleavage at R506 but not at R306 in factor Va J Biol Chem 27 6, 23 105 23 108 16 Gale, A .J. , Tsavaler, A & Griffin, J. H (20 02) Molecular characterization of an extended binding site for coagulation ... the heparin binding site in antithrombotic protein C J Biol Chem 27 6, 24 122 24 128 22 Petaja, J. , Fernandez, J. A. , Gruber, A & Griffin, J. H (1997) ¨ Anticoagulant synergism of heparin and activated ... Va À Factor Vaint À Factor Vai ! ! 2 In wild-type FVa, in which cleavage at Arg506 is % 20 -fold faster than cleavage at Arg306, the major part (% 95%) of Ó FEBS 20 04 27 26 G A F Nicolaes et al...
- 13
- 654
- 0
Báo cáo khoa học: The effect of replacing the axial methionine ligand with a lysine residue in cytochrome c-550 from Paracoccus versutus assessed by X-ray crystallography and unfolding ppt
... K99 3 .2 2.8 2. 7 3 .2 3.7 2. 9 3.4 2. 7 2. 7 2. 9 2. 7 2. 7 2. 8 2. 9 2. 7 2. 6 2. 9 3 .2 2.9 3.0 2. 8 2. 7 2. 9 3.0 w2 w5 w3 w2 w5 w3 w6 7-O 1A 7-O 2A 6-O1D 6-O2D w4 OH Tyr55 NH2 Arg45 w4 Ne1 Trp71 N Ala48 N Gly56 ... is able to catalyse H2O2 reduction with concomitant oxidation of a reducing substrate albeit with an extremely low rate [18] Unfolding by addition of chemical denaturants [ 12, 13] Table Main -chain ... X-ray diffraction data collected in oscillation mode Methods Enzymol 27 6, 307– 326 FEBS Journal 27 2 (20 05) 24 41 24 55 ª 20 05 FEBS J A R Worrall et al 56 Vagin A & Teplyakov A (1997) MOLREP: an automated...
- 15
- 509
- 0
Báo cáo Y học: Cloning and expression of sterol D14-reductase from bovine liver potx
... gradient centrifugation [29 ] RNA was denatured in formamide, separated in denaturing agarose gel (1% agarose /2. 2 M formaldehyde), and blotted onto a nitrocellulose ®lter The RNAs (20 lg) extracted ... Materials and methods Enzymatic activity was evaluated on the basis of peak area ratios between m/z 426 and m/z 3 72 ions (C27D8,14/ 5a- cholestane) or m/z 428 and m/z 3 72 ions (C27D8/5acholestane) at ... BLAST and PSIBLAST: a new generation of protein database search programs Nucleic Acids Res 25 , 3389±34 02 28 Harlow, E & Lane, D (1988) Antibodies: A Laboratory Manual Cold Spring Harbor Laboratory...
- 8
- 493
- 0
Báo cáo khoa học: Selective detection of superoxide anion radicals generated from macrophages by using a novel fluorescent probe pdf
... 12 myristate 13 acetate (2 ngÆmL)1) at 37 °C for 12 h (C) Bright-field image of probe-stained RAW264.7 macrophages stimulated with 4b-phorbol 12 myristate 13 acetate (2 ngÆmL)1) at 37 °C for 12 ... Ben GY (20 00) Seasonal variation in antioxidants of Polygonum viviparum and its relation to solar radiation in alpine meadow Acta Bot Boreal Occident Sin 20 , 20 1 20 5 Chaudhury S & Sarkar PK (1983) ... ª 20 07 The Authors Journal compilation ª 20 07 FEBS J J Gao et al Selective detection of superoxide anion radicals Scheme A mechanism for the reaction of DBZTC with O2–Æ of reaction of O2–Æ with...
- 9
- 401
- 0
Báo cáo khoa học: Identification of a copper-repressible C-type heme protein of Methylococcus capsulatus (Bath) A member of a novel group of the bacterial di-heme cytochrome c peroxidase family of proteins docx
... 25 90 R mopB–F 3103 F mopB–R 3103 R GGCAACGAGCAAGGTCCGAAG AAGTCGTTGCAATCGGCGTCG GGCAACGAGCAAGGTCCGAAG GACGTCGTGAGTGCCTCCGTG CGACGTGCAGTATTACTTTTCTAGGG AGTATCAAACCGTGCTGGTCTCC Bioinformatic analyses ... capsulatus (Bath) Plos Biol 2, E303 FEBS Journal 27 2 (20 05) 6 324 –6335 ª 20 05 The Authors Journal compilation ª 20 05 FEBS O A Karlsen et al 12 Gattiker A, Gasteiger E & Bairoch A (20 02) ScanProsite: a reference ... characteristics of mau mutants J Bacteriol 176, 40 52 4065 24 van der Palen CJ, Slotboom DJ, Jongejan L, Reijnders WN, Harms N, Duine JA & van Spanning RJ (1995) Mutational analysis of mau genes involved...
- 12
- 392
- 0
Báo cáo khoa học: "PCR-based detection of genes encoding virulence determinants in Staphylococcus aureus from bovine subclinical mastitis cases" doc
... ATCGGTATTTAACTAGCCCTGAAA :drawrof CGAAATCAAGCAGTTCCGAACGCA :esrever TTGGCATAGTGGTAGTTAGC :drawrof TACAGCAATTTGGACCAC :esrever AAGGAGAAAACCACGAAC :drawrof CTCCTTCTGTTGTTGTTCGG :esrever GCGTCGTAAACGTCGTCCAC ... GCGTCGTAAACGTCGTCCAC :drawrof CGTAGCTTGTTAGCCTTCG :esrever GGACATGGTCGTAGAGATA :drawrof CGAAT ATAACTGGGACTTTT :esrever GGATGTTCGTGACTTCGG :drawrof )'3-'5( ecneuqeS aps aps A tne cun )noiger-X( aps )gnidnib-GgI( ... :2 ;ces 06-Co27,ces 06-Co75 ,ces 06-Co49 selcyc 53 :1* *margorp RCP )pb( stcudorp deifilpma fo eziS 24 01 019,017, 726 079,018,095 513, 3 52, 022 9 72 6 12 AGATGTCTTGGAAGCCAATTAATG :esrever ATCGGTATTTAACTAGCCCTGAAA...
- 4
- 138
- 0
Tài liệu Int’l High Performance Network Infrastructure of Korea doc
... Dec 20 02 Dec 20 02 Dec 20 02 Jan 20 03 Jan 20 03 Jan 20 03 Jan 20 03 Feb 20 03 Feb 20 03 Feb 20 03 Feb 20 03 Int’l ICT, IR, 10 APII Testbed: Research Collaborations ASIA World heritage Time/Space Sharing ... NEA & SEA GEANT UK Sweden Germany France Spain Lithuania Poland NEA Austria Romania Italy TEIN 10Mbps KOREA CHINA JAPAN 45Mbps 16-45Mbps 12Mbps MALAYSIA SEA Singapore Int’l ICT, IR, USA 1Gbps 26 ... (1999 -20 01) Korea & Japan, Korea & Singapore (1999) Korea & US (20 01) Joined TEIN (20 01) Expanded via AI3 for TEIN (20 01) Served as Asian partner for GEANT (20 01) Int’l ICT, IR, APII Testbed: Cable...
- 30
- 362
- 0
Báo cáo khoa học: Injection of poly(b-L-malate) into the plasmodium of Physarum polycephalum shortens the cell cycle and increases the growth rate pot
... metaphase To follow the growth of a plasmodium in a noninvasive manner, its surface area was measured at successive times [19] The plasmodia did not contact the walls of the agar plates at any ... independent measurements) Table PMLA contents and numbers of nuclei in various strains of P polycephalum All results are given in means and standard deviations of at least three independent measurements ... depended on the degree of phosphorylation, and no attempts were made to standardize the ELISA readings on an H1 mass basis Series of measurements were compared after standardization with a reference...
- 7
- 325
- 0
Child Health And The Quality Of Medical Care by Sarah L. Barber University of California, Berkeley ppt
... 321 enumeration areas chosen from a nationally representative sample used in the 1993 SUSENAS National North Sumatra, West Sumatra, South Sumatra, Lampung, DKI Jakarta, West Java, Central Java, ... Java, Yogyakarta, East Java, Bali, West Nusa Tenggara, South Kalimantan and South Sulawesi 12 Socio-Demographic Survey.6 Over-sampling in urban and small province EAs allows for comparisons between ... maternal and infant risk factors, namely, maternal age and parity at the time of birth, maternal and paternal height, sex of infant, and gestational age For parity, women with no prior pregnancies...
- 53
- 369
- 0
Báo cáo khoa học: Novel L-amino acid oxidase with antibacterial activity against methicillin-resistant Staphylococcus aureus isolated from epidermal mucus of the flounder Platichthys stellatus pptx
... Tokyo, Japan) Antiserum preparation and IgG purification An antiserum against the antibacterial protein was obtained by injecting a Japanese white rabbit (Kitayama Labes Co Ltd., Nagano, Japan) with ... broadly antimicrobial FAD-containing L-amino acid oxidase from ink of the sea hare Aplysia californica J Exp Biol 20 8, 3609– 3 622 33 Ehara T, Kitajima S, Kanzawa N, Tamiya T & Tsuchiya T (20 02) Antimicrobial ... spp with hydrogen FEBS Journal 27 7 (20 10) 453–465 ª 20 09 The Authors Journal compilation ª 20 09 FEBS K Kasai et al 22 23 24 25 26 27 28 29 30 peroxide generated by its L-amino acid oxidase Biochem...
- 13
- 423
- 0
The Project Gutenberg EBook of Creating Capital, by Frederick L. Lipman pot
... commodities—and then cast our thought backward to a time not very many years ago when all this country was a natural wilderness, we may begin to realize the magnitude of the wealth, the capital, that has ... situation to advantage by increasing that output as largely as lay in his power? If, for instance, I can manufacture shoes to sell for $4.00 a pair and a change in market conditions is such that ... file was produced from images generously made available by The Internet Archive/Canadian Libraries) Barbara Weinstock Lectures on The Morals of Trade HIGHER EDUCATION AND BUSINESS STANDARDS By...
- 109
- 350
- 0
The Project Gutenberg E Book of Domestic Animals, by Richard L. Allen ppt
... feeding and food Ducks—feeding—varieties breeding and rearing Sheep, the uses of—importance of 21 6 21 8 22 0, 22 1 22 2 22 3 22 3 22 4 22 5 22 5 22 6 22 7 84 85 varieties of wild— domesticated native Merino, ... &c 22 24 Geese—see Poultry Guinea-hen—see ditto Hens—see Poultry Hinny—see Ass Horse—the Arabian and Barb the English American Arabians in America Ranger, the Barb— Bussorah—Narraganset 138 139 ... oxen fattening and stall-feeding Diseases hoven 26 26 27 29 30 35 38 39 41 42 42 45 41, 50 50 choking inflammation of stomach mange or scab horn-ail—jaundice mad-itch—bloody murrain hoof-ail loss...
- 794
- 2,692
- 0
Báo cáo lâm nghiệp: "Soil environment and nutrient status of Norway spruce (Picea abies [L.] Karst.) underplantings in conditions of the 8th FAZ in the Hrubý Jeseník Mts" potx
... correlation was calculated between the foliar N and P content and the degree of damage to evaluated underplantings caused by nutrient de ciency (Tables and 6) Damage to un240 70 22 0 50 20 0 damage ... the stand concerned was also evaluated A scale of underplanting damage was developed according to the chosen method (I 1990) in order to compare damage in the particular localities and for ... samples for laboratory analyses were taken from humification (H), organomineral (Ae, Ep) and spodic horizons (Bs, Bv) For a more detailed and objective evaluation of the Norway spruce (Picea abies...
- 12
- 529
- 0
Báo cáo lâm nghiệp: "Influence of exogenous L-proline on embryogenic cultures of larch (Larix leptoeuropaea Dengler), sitka spruce (Picea sitchensis (Bong.) Carr.) and oak (Quercus robur L.) subjected to cold and salt stress" pdf
... Pereiara A. A.M., Silva J. D., Pilegga S .A. V., Verma D.P.S., An improved method for transformation of lettuce by Agrobacterium tumefaciens with a gene that confers freezing resistance, Brazilian Archives ... Commercial delivery of genetic improvement to conifer plantations using somatic embryogenesis, Ann For Sci 59 (20 02) 657–661 [22 ] Van Swaaij C., Jacobsen E., Feensta W .J. , Effect of cold hardening, ... Plant 52 (19 62) 375–379 [14] Palta J. P., Levitt J. , Stadelmann E .J. , Freezing injury in onion bulb cells I Evaluation of the conductivity method and analysis of ion and sugar efflux from injured...
- 4
- 338
- 0
Báo cáo lâm nghiệp: " Influence of repeated defoliations by insects on wood increment in common oak (Quercus robur L)" pps
... viridana L), gypsy moth (Lymantria dispar L) and winter moth (Operophtera brumata L) were the most common defoliators A defoliation index was recorded as the relative leaf area loss estimated ... The search for potential correlations between annual increment and degree of defoliation was restricted to years with defoliation rates above 35% and devoid of additional stresses such as late ... i) an upland stand, site index I-II, aged between 55 and 85 years, dominated by late oaks, and prone to water deficits; ii) a floodplain stand, site index II, aged 90 years, with only early oaks;...
- 6
- 263
- 0
Báo cáo khoa học: "A comparison of photosynthetic responses to water stress in seedlings from 3 oak species: Quercus petraea (Matt) Liebl, Q rubra L and Q cerris L" doc
... Both A and g were comw puted according to von Caemmerer and Farquhar (1981) and expressed on a projected leafarea basis (ΔT area meter, ΔT Devices, UK) Measurements were made 3—4 ... net CO assimilation rate (A) were recorded us2 ing a portable gas-exchange measurement system (LiCor 620 0, Lincoln, NE, USA) Average (± standard deviation) leaf temperature (t leaf), a to-air difference ... transport pathways in the trees probably play a major role and differ significantly among species (Abrams, 1990; Cochard et al, 19 92; Bréda et al, 1993) In addition, the ability to maintain significant...
- 13
- 402
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25