CloningandexpressionofsterolD14-reductasefrombovine liver
Rita Roberti
1
, Anna Maria Bennati
1
, Giovanni Galli
2
, Donatella Caruso
2
, Bruno Maras
3
, Cristina Aisa
4
,
Tommaso Beccari
4
, Maria Agnese Della Fazia
4
and Giuseppe Servillo
4
1
Department of Internal Medicine, University of Perugia, Italy;
2
Department of Pharmacological Sciences, University of Milan,
Italy;
3
Department of Biochemical Sciences ÔA. Rossi FanelliÕ, Universita
Á
ÔLa SapienzaÕ Roma, Italy;
4
Department of Biochemical Sciences and Molecular Biotechnology, University of Perugia, Italy
Biosynthesis of cholesterol represents one of the funda-
mental cellular metabolic processes. Sterol D14-reductase
(D14-SR) is a microsomal enzyme involved in the con-
version of lanosterol t o c holesterol i n mammals. A mino-
acid sequence analysis o f a 38-kDa protein puri®ed from
bovine live r in our laboratory r evealed > 90% similarity
with a human sterol reductase, SR-1, encoded by the
TM7SF2 gene, and with the C-terminal domain of human
lamin B receptor. A cDNA encoding the 38-kDa protein,
similar to human TM7SF2, was identi®ed by analysis
of a bovine expressed sequence tag (EST)
1
database.
The cDNA was synthesized by RT-PCR, cloned, and
sequenced. The cDNA encodes a 418 amino-acid poly-
peptide with nine predicted transmembrane domains. The
deduced amino-acid se quence exhibits h igh similarity with
D14-SR from yeasts, fungi, and plants (55±59%), sug-
gesting that the bovine cDNA encodes D14-SR. Northern
blot analysis ofbovine tissues showed high expression of
mRNA in liverand brain. The polypeptide encoded by
theclonedcDNAwasexpressedinCOS-7cells.Immu-
no¯uorescence analysis o f t ransfected cells revealed a
distribution of the protein throughout the ER. COS-7
cells expressing the protein exhibited D14-SR activity
about sevenfold higher than control cells. These results
demonstrate that t he cloned b ovine c DNA encod es D14-
SR and provide evidence t hat the human TM7SF2 gene
encodes D14-SR.
Keywords: sterol biosynthesis; sterol reductase; cloning;
endoplasmic r eticulum.
Sterol D14-reductase (D14-SR), an essential enzyme for
sterol biosynthesis in eukaryotic cells, is an i ntegral protein
of the ER that acts on D
14(15)
-unsaturated sterols in different
organisms. In mammalian cells the elimination of a
14a-methyl group from the C30 sterols, lanosterol and
24,25-dihydrolanosterol, during conversion to cholesterol
(C27D
5
) generates the intermediates 4,4-dimethyl-5a-cho-
lesta-8,14,24-trien-3b-ol (C29D
8,14,24
) and 4,4-dimethyl-5a-
cholesta-8,14-dien-3b-ol [1] that are transformed into
4,4-dimethyl-5a-cholesta- 8,24-dien-3 b-ol (C29D
8,24
)and
4,4-dimethyl-5a-cholesta-8-en-3b-ol, respectively, by the
action of D14-SR [2]. The saturation of the C14C15
double b ond may occur at different stages of the pathway
leading from C30 to C27 sterols [3,4].
Biochemical c haracterization, solubilization, and puri®-
cation of D14-SR from rat liver have been reported [5,6].
The liver enzyme is responsive to cholesterol lowering
agents, as well as to changes in diet and circadian rhythm
[6]. D14-SR h as been cloned fromy east [7±9] and fungi
[10]. Gene c loning of D14-SR from Ara bidopsis thaliana
and analysis o f m utants has h ighlighted the role of the
protein in cell growth and embryonic development of the
plant [11,12].
Inherited human disorders caused by defects in choles-
terol biosynthesis have been identi®ed, suggesting a major
role for cholesterol a nd/or intermediates of biosynthesis in
embryogenesis and morphogenesis [13]. Among these, the
Greenberg skeletal dysplasia has been hypothesized to
originate from D14-SR de®ciency [14]. In addition, interest
in the C29D
8,14,24
and C29D
8,24
sterols has been consid-
erably stimulated by the ®nding that they play a crucial
role during meiosis in mammals [15]. The C29D
8,14,24
sterol is a positive regulator of the nuclear receptor L XRa
[16]. These data indicate that D14-SR is one of the
regulatory enzymes in the complex pathway of cholesterol
biosynthesis.
Recently t he human lamin B receptor (LBR), an integral
protein of the inner nuclear membrane, has been shown t o
exhibit D14-SR activity [17]. Two protein p aralogues of
human LBR, sharing high similarity with plant and yeast
sterol reductases, have been identi®ed. These proteins, sterol
reductase 1 and 2 (SR-1 and SR-2), are encoded by
TM7SF2 and DHCR7 genes, respectively [18±20]. SR-2 is
sterol D7-reductase, a Smith±Lemli±Opitz syndrome-related
Correspondence to R. Roberti, Department of Internal Medicine,
Laboratory of Biochemistry, University of Perugia, Via del Giochetto,
06122 Perugia, Italy. Fax: + 39 0755857428, Tel.: + 39 0755857426,
E-mail: robe rti@unipg.it
Abbreviations: D14-SR, sterol D14-reductase; SR-1, sterol reductase 1;
LBR, lamin B receptor; C29D
8,14,24
, 4 ,4-d imethyl-5 a-cholesta-8,14,24-
trien-3b-ol; C29D
8,24
, 4,4-dimethyl-5a-cholesta-8,24-dien-3b-ol;
C27D
8,14
,5a-cholesta-8,14-dien-3b-ol; C27D
8
,5a-cholesta-8-en-3b-ol;
C27D
5
,cholesterol;E-64,N-[N-(
L
-3-trans-carboxyrane-2-carbonyl)-
L
-
leucyl]-agmantine; EST, expressed sequence tag; DMEM, Dulbecco's
modi®ed Eagle's medium; PVDF, poly(vinyiledene di¯uoride);
FITC-conjugated, ¯uorescein isothiocyanate-conjugated; EPT,
ethanolaminephosphotransferase.
Note: the nucleotide sequence reported in this pap er has been
submittedtoGenBankandisavailableunderaccessionnumber
AY039681.
(Received 2 August 2001, revised 26 October 2001, accepted 31
October 2001)
Eur. J. Biochem. 269, 283±290 (2002) Ó FEBS 2002
protein [19±22], whereas no functional characterization of
the TM7SF2 gene product has been reported. It has been
hypothesized that human TM7SF2 encodes D14-SR [13,23],
but upon expression in yeast, no sterol D14-, D7-, or D24-
reductase activities were detected [13].
We isolated a 38-kDa protein frombovineliver ER with a
high degree of identity with bo th human SR-1 and human
LBR. A cDNA encoding this protein was identi®ed b y
bovine expressed sequence tag (EST) analysis, cloned, and
expressed as a functional D14-SR.
MATERIALS AND METHODS
Chemicals
M-MLV reverse transcriptase, lipofectamine reagent, Dul-
becco's modi®ed E agle's medium ( DMEM), and foetal
bovine serum were purchas ed from Gibco-BRL (Milan,
Italy). TOPO-cloning kit was from Invitrogen (Leek, the
Netherlands). RNAse inhibitor was from Ambion (Austin,
TX, USA). The Expand Long Template PCR System,
Staphylococcus aureus V8 protease, N-[N-(
L
-3-trans-carb-
oxyrane-2-carbonyl)-
L
-leucyl]-agmantine (E-64), leupeptine,
phenylmethylsulfonyl ¯uoride (PMSF), and thesit were all
purchased from Roche Molecular Biochemicals (Milan,
Italy). Q-Sepharose fast ¯ow, 5a-cholestane, glucose oxi-
dase, reduced glutathione, NADPH, commercial antibod-
ies, protein A-Sepharose CL 4B, SDS/PAGE reagents, and
enhanced chemiluminescence reagents were from Sigma
(Milan, Italy). Biogel HTP was from Bio-Rad (Milan,
Italy). Poly(vinylidene di¯uoride) (PVDF) membranes
(Immobilon P
SQ
) w ere purchased from Millipore (Bedford,
MA, USA). 5 a-cholesta-8,14-dien-3b-ol (C27D
8,14
)was
synthesized according to F ieser & Ourisson [24]. D iacyl-
glycerol was prepared from egg yolk as described previously
[25]. Other reagents were from Gibco-BRL and Sigma.
Isolation ofsterol D14-reductase
Bovine D14-SR was co-puri®ed fromliver ER together with
the previously reported ethanolaminephosphotransferase
(EPT) [25]. Brie¯y, microsomes (3 mg proteinámL
)1
)were
solubilized with 1.5% thesit in the presence of 1 m
M
NaCl
and diacylglycerol (0.3 mgámL
)1
). The puri®cation proce-
dure i ncluded chromatography o n Biogel HTP and t wo
chromatographic steps on Q-Sepharose, performed at
pH 7.0 and pH 8.5, as described previously [25]. The
protein preparation was concentrated and f reed of lipids
as follows. The sample was dialysed extensively against
distilled water and freeze-dried. The residue was suspended
in a 10-mL mixture of chloroform/methanol (1 : 9, v/v) for
10 min at 37 °C. The insoluble protein pellet was recovered
by centrifugation and the extraction was repeated twice. The
protein pellet was vacuum dried, resuspended in 5 % SDS
and adjusted to 100 m
M
Tris/HCl (pH 6.8), 1% SDS (w/v),
10% glycerol (v/v), and 100 m
M
dithiothreitol
2
(SDS/PAGE
sample buf fer).
Sequence analysis ofsterol D14-reductase
A 20-lg aliquot of lipid-free protein was subjected to SDS/
PAGE, electroblotted on a PVDF membrane, and stained
with Co omassie blue. The N-terminal amino-acid sequence
was determined by automated Edman degradation using a
PerkinElmer model AB 476A sequencer. For internal
sequence determination th e protein (30 lg) was subjected
to SDS/PAGE. After staining the gel with Coomassie blue,
the 38-kDa band was cut and equilibrated for 10 min with
100 m
M
Tris/HCl (pH 6.8) c ontaining 12% (v/v) glycerol,
50 m
M
2-mercaptoethanol, and 2% (w/v) SDS (buffer A ).
The slice was then inserted into a gel well and covered w ith
buffer A containing 20% g lycerol (v/v). Staphylococcus
aureus V8 protease solution (2 lgin10lL of buffer A)
was layered onto the top [26]. The separating gel contained
15% (w/v) polyacrylamide (acrylamide/bisacrylamide
30 : 0.8, w/w). After the sample had been stacked with a
4-mA constant current, the power was turned off for 2 h
at room temperature to a chieve proteolysis. Fragments
were separated by applying a 30-mA constant current and
electroblotted o n P VDF membrane. Bands w ere excised
and amino-acid sequence analysis was performed as
described above.
The amino-acid sequences were analysed using t he
BLAST
search program (National Center f or Biotechnology Infor-
mation; http://www.ncbi.nlm.nhi.gov) [27].
Antibody production
Polyclonal antibodies against D14-SR were raised in rabbits
by multiple subcutaneous injections of a solution containing
50 lg of lipid-free protein preparation in 0.9% NaCl
mixed with an equal v olume of Freund's complete adjuvant.
Boost injections of 50-lg protein were performed 21 and
42 d ays after the initial administration. The IgG fraction
was puri®ed on a protein A±Sepharose CL 4B column
equilibrated w ith 0.1
M
Tris/HCl (pH 8.0) and eluted with
0.1
M
glycine buffer (pH 3.0) [28].
RT-PCR cloningof the bovine cDNA encoding sterol
D14-reductase
BLASTN
search of the bovine EST database was performed
to identify bo vine cDNA clones homologous to human
SR-1 cDNA [27]. The putative bovine cDNA was used to
design PCR primers for ampli®cation of the ORF.
Total RNA (5 lg), puri®ed fromliver as described below,
was used to synthesize ®rst-strand cDNA using a reaction
mixture containing 50 m
M
Tris/HCl (pH 8.3), 40 m
M
KCl,
6m
M
MgCl
2
,1m
M
dithiothreitol, 40 UámL
)1
of RNase
inhibitor, 2.5 m
M
dNTP, 0.2 m
M
oligo-dT 15±18mer, and
200 U of M-MLV reverse transcriptase. First-strand syn-
thesis was performed at 42 °C for 45 min a nd then the
enzyme was inactivated at 90 °C for 5 min. Following ®rst-
strand synthesis, PCR of D14-SR cDNA was carried out
using appropriate primers and the Expand Long Template
PCR System. The two primers used were the sense primer
(5¢-AT
TCTAGAAGCGGAGACCATGGCCCCTCCTC
AG-3¢) and the antisense primer (5¢-AT
TCTAGATAG
GGTACAGGCCCTTGTGTCCCG-3¢), both bearing the
XbaI restriction site (underlined). PCR conditions were as
follows: 4 min at 94 °C (1 cycle); 1 min at 94 °C, 1 min at
65 °C, 1 m in at 68 °C (30 cycles); 5 min at 68 °C(1cycle).
The RT-PCR product was cloned into the pCR2.1 vector
by TOPO-cloning kit and bidirectionally sequenced at
MWG Biotech (Mu
È
nchen, Germany). The PCR product
(1370 b p) was used as a probe for Northern blot analysis.
284 R. Roberti et al. (Eur. J. Biochem. 269) Ó FEBS 2002
RNA isolation and Northern blot analysis
Total RNA was isolated from different bovine tissues (liver,
brain, lung, skeletal muscle, heart, adrenal, and testis) by
homogenizing the samples in guanidium isothiocyanate
solution (100 mg tissueámL
)1
) followed by CsCl step
gradient centrifugation [29]. RNA was denatured in
formamide, separated in denaturing agarose gel (1%
agarose/2.2
M
formaldehyde), and blotted onto a nitrocel-
lulose ®lter. The R NAs ( 20 lg) ext racted f rom d ifferent
tissues were hybridized with random priming
32
P cDNA
speci®c for bovine D14-SR [30].
Expression ofsterolD14-reductase in COS-7 cells
Bovine D14-SR cDNA was subcloned in the XbaIsiteofthe
eukaryotic expression vectors pCS2-myc-tag, containing the
CMV promoter [31], and modi®ed pMT2, containing the
SV40 promoter [32], kindly provided b y N. S. Foulkes
(IGBMC of Strasbourg, France) and F. Grignani (Univer-
sity of Perugia, Italy), respectively. The cDNA was subcl-
onedinpCS2-myc-tag 3¢ to a sequence encoding six copies
of a 13-residue c-myc epitope. COS-7 cells were grown in a
5% CO
2
incubator a t 37 °C i n DMEM supplemented with
10% foetal bovine serum and 2 m
M
glutamine. Cells were
cultured in 10-cm Petri dishes until 50±80% con¯uence and
transfected for 5 h with the two plasmids (4 lg) separately,
using lipo fectamine in serum-free DMEM. Con trol cells
were transfected with empty p MT2 or pCS2-myc-tag
vectors. After transfection, the medium was replaced with
complete DMEM and cells were incubated for 35 h at
37 °C. Transfected cells were recovered with 0.9% NaCl
containing 1 m
M
EDTA, 1 l
M
leupeptine, 0.1 m
M
PMSF,
0.3 l
M
E-64 and then sonicated three times for 10 s. The
microsomal fraction was prepared by centrifugation of the
500 g supernatant at 100 000 g for 1 h at 4 °C. The pellet
was resuspended in 10 m
M
K-phosphate/0.05 m
M
EDTA
(pH 7.4). Protein concentration was determined by the
method of Bradford [33], using BSA as a standard.
Microsomal proteins separated by SDS/PAGE were
blotted o n P VDF m embranes and incubated w ith poly-
clonal rabbit anti-(D14-SR) Ig or monoclonal mouse anti-
(c-myc-tag) Ig, as indicated. Peroxidase-conjugated goat
anti-(rabbit IgG) Ig or anti-(mouse IgG) Ig were used as
secondary antibodies. The protein was detected by the
enhanced chemiluminescence assay.
Indirect immuno¯uorescence
Transfected COS-7 cells, grown on coverslips, were washed
with NaCl/P
i
and ® xed in ice-cold methanol for 10 min at
)20 °C. Cells were subsequently permeabilized by treatment
with 0.1 % Triton X-100 i n NaCl/P
i
for 5 min at room
temperature, washed with NaCl/P
i
, blocked w ith 3% BSA
in NaCl/P
i
, and incubated for 60 min a t r oom temperature
with rabbit anti-(D14 -SR) IgG. After washing with NaCl/P
i
containing 0.1% Tween-20, cells were incubated for 60 min
at room temperature with Cy3-conjugated sheep anti-
(rabbit IgG) Ig. Cells transfected with the pCS2-myc-ta g
vector were subsequently treated with monoclonal mouse
anti-(c-myc-tag) Ig and ¯uorescein isothiocyanate-conjugat-
ed (FITC-conjugated) goat anti-(mouse IgG) Ig. The cells
were examined by ¯uorescence microscopy and the images
were acquired by using a Spot-2 cooled camera (Diagnostic
Instruments).
Sterol D14-reductase assay
D14-SR activity was assayed in microsomes prepared from
D14-SR cDNA-transfected COS-7 cells andfrom bovine
liver, using 5a-cholesta-8,14-dien-3b-ol (C27D
8,14
)asa
substrate [5]. The sterol was added as a 0.3-m
M
suspension
in 0.8% Tween-80, at 60 l
M
®nal concentration (13.5 lg) to
0.5 mL of a mixture containing 0.1
M
K-phosphate buffer
(pH 7.4), 0.5 m
M
EDTA, 1 m
M
reduced glutathione, 2 m
M
NADPH, 0.14
M
glucose, and 10 U of glucose oxidase, that
had been preincubated for 4 min at 37 °C under N
2
atmosphere. Incubation was carried out under N
2
for
30 min at 37 °C with 0.24 mg of microsomal proteins and
terminated by the addition of 1 mL of 20% KOH in 50%
methanol, followed by additional 30 min incubation at
37 °C. After the addition of 5a-cholestane (5 lg) as an
internal standard, sterols were extracted three times with
3 mL of petroleum ether and the o rganic phases were
evaporated to dryness under nitrogen stream.
The sterol extracts were acetylated with acetic anhydride-
pyridine, 2 : 1 (v/v) for 1 h at 60 °C. The samples were taken
to dryness and th e residues were dissolved in ethyl acetate.
Aliquots of the samples were analysed by GC-MS in
multiple ion detection m ode
3
using a Varian Saturn 2100T
apparatus with a Varian CP-Sil8 CB low bleed/MS column.
Temperature was programmed from 150 to 300 °Cat
12 °Cámin
)1
. Sterol retention times were: 14.5 min, 5a-
cholestane (M
+
372); 18.2 min, cholesterol (M
+
368);
18.3 min, C27D
8,14
(M
+
426); 18.5 min, 5a-cholesta-
8(9)-en-3b-ol ( C27D
8
,M
+
428).
D14-SR activity was evaluated on the basis of peak area
ratios between m/z 426 and m/z 372 ions (C27D
8,14
/5a-
cholestane) or m/z 428 and m/z 372 ions (C27D
8
/5a-
cholestane) at the expected retention time.
RESULTS AND DISCUSSION
Isolation ofsterol D14-reductase
During the preparation and delipidation of a bovine liver
38-kDa protein exhibiting EPT activity [25], a protein co-
migrating in SDS/PAGE was revealed by amino-acid
sequence a nalysis. The determined N-terminal s equence of
the protein, APPQGSRAPLEFGGPLGAAALML, was
87% identical to residues 2±24 of human SR-1 (GenBank
accession no. AF096304) [18]. The digestion of the 38-kDa
band with S. aureus V8 protease produced three major
fragments with molecular masses of 27, 19.5, and
9.5 kDa. The 27- a nd 9.5-kDa fragments con®rmed the
N-terminal sequence, whereas the sequence of the 19.5-kDa
fragment was AVLTTMDIIHDGFGFMLAF, 95% iden-
tical to residues 243±261 of human SR-1 and 440±458 of
human LBR (GenBank accession no. L25931). Human
SR-1 has been reported to be a sterol reductase, based on
similarities with sterol reductases fromy east, f ungi, and
plants, although its catalytic activity has not been identi®ed
[18]. Moreover, human SR-1 exhibits 58% identity with the
C-terminal domain (residues 197±615) of human LBR [18],
which possesses D14-SR activity [17]. For this reason we
hypothesized that the puri®ed 38-kDa bovine protein is a
Ó FEBS 2002 BovinesterolD14-reductasecloning (Eur. J. Biochem. 269) 285
Fig. 1. Amino-acid sequence alignment ofsterolD14-reductaseand related sterol reductases. Alignment was perfo rmed using the
OMIGA
2.0 p rogram
run with the default parameters. Positions with consensus residues present in all se quence s are boxed. Positions with consensus residues present in at
least three sequences are shaded. Bovine D14-SR (b 14 sr); human SR-1 (h SR-1); residues 197±615 of human lamin B receptor (h lbr197);
A. thaliana D14-SR (at 14 sr) (GenBank accession no. AF256535); S. cerevisiae D14-SR (sc 14 sr) (GenBank accession no. S69420). For bovine
D14-SR, regions of the deduced amino-acid sequence corresponding to the N-terminal and V8 peptide sequences determined in the sequencing
experiments of the protein puri®ed from b ovine liver are underlined.
TMPRED
program (ExPASy Molecular Biology Server, http://www.expasy.ch/)
was used to predict transmembrane domains, indicated by thick lines on top.
286 R. Roberti et al. (Eur. J. Biochem. 269) Ó FEBS 2002
D14-SR. To verify our hypothesis, bovine cDNA encoding
the 38-kDa protein was cloned to iden tify the catalytic
activity of the expressed protein.
Cloning of the cDNA encoding bovine sterol
D14-reductase
Bovine cDNA clones, similar to human SR-1 (TM7SF2),
were retrieved by a
BLASTN
search in the EST database. The
putative cDNA o f the bovine D14-SR was obtained by
aligning four different clones (GenBank accession nos.
BE756766, BE756734, BE754556 and AW427392) [34]. The
bovine cDNA was synthesized by RT-PCR using synthetic
primers based on the EST sequences, cloned into the
pCR2.1 vector, and sequenced on both strands. The cloned
cDNA was 1370 bp long and contained an ORF of
1257 bp, encoding a protein of 418 amino a cids with a
calculated molecular mass of 46 751 Da.
The N-terminal amino-acid sequence of the protein
puri®ed fromliverand the amino-acid sequence of the 19.5-
kDa fragment generated by S. aureus V8 protease digestion
corresponded to residues 2±24 and 243±261, respectively, of
the putative protein (Fig. 1). In the puri® ed protein, the
N-terminal methionine was cleaved out, as previously
described for most eukaryotic proteins [35]. Moreover, the
sequenced 27- and 19.5-kDa fragments appeared to origi-
nate from cleavage of the protein i n two parts ( Fig. 1),
which accounted for the calculated molecular mass of
46.7 kDa. Therefore, the discrepancy between the appar-
ent molecular mass of 38 kDa estimated by SDS/PAGE
and the calculated molecular mass may be due to an
aberrant electrophoretic migration, as reported for other
structurally related proteins [19,36].
The putative protein was rich i n leucine (19.1%) and
highly hydrophobic, with nine predicted membrane-span-
ning domains (Fig. 1). The deduced amino-acid sequence
displayed similarity to putative h uman SR-1 (92%), the
197±615 domain of human LBR (71%), A. thaliana D14-SR
(59%), Saccharomyces c erevisiae D14-SR (55%) (Fig. 1),
and o ther sterol reductases [50% and 49% similarit y to
human and A. thaliana sterol D7-reductases, respectively,
and 44% to S. cerevisiae sterol D24(28)-reductase].
The EFGGx(2)G signature ofsterol D24(28)-reductase
and D14-SR and the LLxSGWWGx(2)RH signature of
sterol reductases family [37] were present at positions 12±18
and 337±348 of the deduced amino-acid sequence, respec-
tively. Ergosterol b iosynthesis ERG4/ERG24 f amily signa-
tures, Gx(2)[LIVM][YH]Dx[FYV]xGx(2)LNPR and
[LIVM](2)HRx(2)R
D
x(3)Cx(2)KYG [38] were found at
positions 167±182 and 383±399 of the deduced amino-acid
sequence, respectively. A leucine-zipper region was present
at position 139±160.
The presence of signature patterns conserved from yeast
D14-SR (ERG24 gene) andsterol D24(28)-reductase (ERG4
gene), as well as the degree of similarity with human LBR
and D14-SR from plants and yeast, strongly suggest that the
cloned cDNA corresponds to D14-SR.
Sterol D14-reductase mRNA expression in bovine tissues
Northern blot analysis ofbovine tissues was performed with
D14-SR cDNA. A single transcript of 1.8 kb was detected
in different tissues. H igh levels of mRNA expression were
found in liverand brain (Fig. 2). No transcript was detected
in the heart, contrary to TM7SF2, highly expressed in t he
human tissue [18].
Expression ofsterolD14-reductase cDNA
in transfected COS-7 cells
Western blot analysis. Immunoblot analysis of the ex-
pressed D14-SR cDNA was performed using a polyclonal
antibody raised against the bovineliver D14-SR. The
antibody recognized a single band of 38 kDa both in
D14-SR transfected cells and i n bovineliver microsomes
(Fig. 3 ). No protein was detected in cells transfected with
control vector. The expressed myc-tag-D14-SR was detected
by both anti-(D14-S R) Ig and anti-(c-myc)Igasaproteinof
56 kDa, consistent with the fusion of six myc epitopes
( 9.3 kDa) at the N-terminus of the protein (Fig. 3).
Cellular localization. The c ellular localization of myc-tag-
D14-SR was examined in transiently t ransfected COS-7
cells. Double immuno¯uorescence analysis of cells showed a
similar l abelling pattern with anti-(myc-tag)Igandanti-
(D14-SR) Ig (Fig. 4). The images showed that the newly
formed protein was distributed throughout the ER in the
proximity of the nucleus. The same localization was
observed i n t ransfected cells over-expressing D14-SR; no
label was observed in control cells. These results are
consistent with the known subcellular localization of the
enzymes involved in cholesterol biosynthesis and with the
puri®cation of the bovine protein from the ER.
Determination of D14-SR activity. To demonstrate that
the cloned bovineliver cDNA encodes a protein with D14-
SR activity, cDNA was c loned i n t he expression vector
pMT2 and transfected into COS-7 cells. Microsomes
prepared from transfected ce lls were assayed f or D14-SR
Fig. 2. Northern blot analysis ofbovine tissues. Th e RNAs ( 20 lg)
extracted from dierent tissues were b lotted onto a nitrocellulose ®lter
and hybridized by
32
P-labelled cDNA speci®c for bovine D14-SR. (A)
Hybridized D14-SR transcript (arrow). (B) Nitrocellulose ®lter show-
ing total RNA (28S and 18S rRNAs are indicated).
Ó FEBS 2002 BovinesterolD14-reductasecloning (Eur. J. Biochem. 269) 287
activity by incubation with C27D
8,14
sterol. C27D
8
sterol was
undetectable at the beginning of incubation both in COS-7
cells andbovineliver microsomes. Endogenous D14-SR
activity of microsomes obtained from control COS-7 cells,
measured on the basis of C27D
8
formation and C27D
8,14
disappearance, was much lower than that observed in
bovine liver microsomes (Fig. 5). COS-7 c ells expressing
D14-SR cDNA exhibited D14-SR microsomal activity
sixfold to sevenfold higher than that of control cells and
comparable to that ofbovineliver microsomes (Fig. 5).
These results indicate that the cloned bovine cDNA encodes
a functional D14-SR.
The present study describes t he cloningand functional
characterization ofbovine D14-SR, thus providing evi-
dence that the previously cloned human TM7SF2 corre-
sponds to D14-SR. Identi®cation of TM7SF2 as the
human gene encoding D14-SR paves the way for studies
on molecular regulatory mechanisms of the D14-SR gene
expression and its possible role in the metabolism of
meiosis activating sterols. Mutation analysis of TM7SF2
will clarify whether a defect in this gene underlies the
Greenberg skeletal dysplasia.
Fig. 5. SterolD14-reductase activity of transfected COS-7 cells.
Microsomes (0.24 mg protein), prepared from cells transfected with
the empty pMT2 vector (control) or with D14-SR cDNA (D14-SR) and
bovine liver microsomes (0.24 mg protein), were assayed for sterol
D14-reductase activity by incubation for 30 min with C27D
8,14
in the
conditions described i n Materials and methods. Enzymatic activity was
evaluated on the basis of peak area ratios between m/z 426 and m/z 372
ions (C2 7D
8,14
/5a-cholestane) or m/z 428 and m/z 372 ions (C27D
8
/5a-
cholestane) a t th e exp ected retention time. At z ero in cubation time the
C27D
8,14
/5a-cholestane peak area ratio determined for control cells,
transfected cells, andliver microsomes was 4.23 0.56. Data shown
are mean SD (n 3).
Fig. 3. Immunoblot analysis ofbovinesterolD14-reductase expressed in
COS-7 cells. Micro somal proteins were sep arated on a 12% (w/v) SDS
gel and transferred to PVDF membranes. Lane A, bovineliver (40 lg
protein); lanes B and D, COS-7 cel ls tran sfec ted with myc-tag-D14-SR
cDNA (5 lg protein); lane C, COS-7 cells transfected with D14-SR
cDNA (5 lg protein). Blots were probed with speci®c antibodies: anti-
(bovine liver D14-SR) Ig (lanes A±C) and anti-(myc-tag)Ig(laneD).
Detection was performed by the enhanced chemiluminescence proce-
dure. Molecular size markers are shown on the right.
Fig. 4. Cellular localization ofsterol D14-reductase. (A) and (B) I mmuno¯u orescence photomicrographs of transfected COS-7 cells expressing
myc-tag-D14-SR. Cells were labelled with rabbit anti-(D14-SR) Ig and secondary Cy3-conjugated sheep anti-(rabbit IgG) Ig (A) and then
with mono clonal mouse anti-(myc-tag) Ig and secondary FITC-conjugated goat anti-(mouse IgG) Ig (B). (C) Immuno¯urescence photomicro-
graphs of transfected COS-7 cells expressing D14-SR. Cells were labelled with rabbit a nti-(D14-SR) Ig and secondary Cy3-conjugated sheep
anti-(rabbit IgG) Ig.
288 R. Roberti et al. (Eur. J. Biochem. 269) Ó FEBS 2002
ACKNOWLEDGEMENTS
We are grateful to Prof. D. Barra and Prof. L. Binaglia for critical
reading of the manuscript and helpful suggestions. Th anks are extended
to D. Piobbico and A. Toia for excellent technical assistance. This stud y
was supported by grants from the University of Perugia, Italy.
REFERENCES
1. Canonica, L., Fiecchi, A., Galli Kienle, M., Scala, A., Galli, G.,
Grossi Paoletti, E. & Paoletti, R. (1968) The fate of the 15b
hydrogen of lanosterol in cholesterol biosynthesis. J. Am. Chem.
Soc. 90, 3597±3598.
2. Fiecchi, A., Canonica, L., Scala, A., Cattabeni, F., Grossi Paoletti,
E. & Paoletti, R. (1969) 4,4-Dimethyl-5a-chole sta- 8,14-dien -3b-ol
a new precursor of cholesterol in mammalian tissues. Life Sci. 8,
629±634.
3. Canonica, L., Fiecchi, A., Galli Kienle, M., Scala, A., Galli, G.,
Grossi Paoletti, E. & Paoletti, R. (1968) Evidence for the biological
conversion of D
8,14
sterol dien es into cholesterol. J. Am. Che m.
Soc. 90, 6532±6534.
4. L utsky, B.N. & Schroepfer, G.J. (1970) Studies on the enzymatic
conversion of 5a-cholesta-8,14-dien-3b-ol to cholesterol. J. Biol.
Chem. 245, 6449±6455.
5. Paik, Y K., Trzaskos, J.M., Sha®ee, A. & Gaylor, J.L. (1984)
Microsomal enzymes o f cholesterol biosynthesis from lanosterol.
Characterization, solubilization, and partial puri®cation of
NADPH-dependent D
8,14
-steroid 14-reductase. J. Biol. Chem. 259,
13413±13423.
6.Kim,C K.,Jeon,K I.,Lim,D M.,Johng,T N.,Trzaskos,
J.M., G aylor, J.L. & Paik, Y K. (1995) Cholesterol biosynthesis
from lanosterol: regulation an d puri®cation of rat he patic sterol
14-reductase. Biochim. Biophys. Acta 1259, 39±48.
7. Lorenz, R.T. & Parks, L.W. (1992) Cloning, sequencing, and
disruption of the gene encoding sterol C-14 reductase in Sac-
charomyces cerevisiae. DNA Cell Biol. 11 , 685±692.
8. Marcireau, C., Guyonnet, D. & K arst, F. (1992) Construction and
growth pro perties of a yeast strain defec tive in sterol 14-red uctase.
Curr. Genet. 22, 267±272.
9. Smith, S. (1995) Cloningand sequence analysis of an
ERG24 homolog from Schizosaccharomyces pombe. Gene 155,
139±140.
10. P apavinasasundaram, K.G. & Kasbekar, D.P. (1994) The Neu-
rospora crassa e rg3 gene encodes a protein with sequence homol-
ogy to both y east sterol C-14 reductase and chicken lamin B
receptor. J. Genet. 73, 33±41.
11. S chrick, K., Mayer, U., Horrichs, A., Kuhnt, C., Bellini, C.,
Dangl,J.,Schmidt,J.&Ju
È
rgens, G. (2000) FACKEL is a sterol C-
14 reductase required for organized cell division and expansion in
Arabidopsis embryogenesis. Genes Dev. 14, 1471±1484.
12. Jang, J.C., Fujioka, S., Tasaka, M., Seto, H., Takatsuto, S., Ishii,
A., Aid a, M., Yoshida, S. & S heen, J. (2000) A critic al role of
sterols in embryonic p atterning and meristem programming
revealed by the fackel mutants of Arabidopsis thaliana. Genes Dev.
14, 1485±1497.
13. Waterham, H.R. & W anders, R.J.A. (2000) Bioc hemical and
genetic aspects o f 7- dehydrocholesterol reductase and Smith±
Lemli±Opitz syndrome. Biochim. Biophys. Acta 1529, 340±356.
14. Opitz, J.M. (1999) RSH (so-called Smith±Lemli±Opitz) syndrome.
Curr. Opin. Pediatr. 11, 353±362.
15. B yskov, A.G., Andersen, C.Y., Nordholm, L., Thùgersen, H .,
Guoliang, X., Wassmann, O., Andersen, J.V., Guddal, E . &
Roed, T. (1995) Chemical structure of sterols that activate oocyte
meiosis. Nature 374, 559±562.
16. J anowski, B.A., Willy, P.J., Rama Devi, T., Falck, J.R. & Man-
gelsdorf, D.J. (1996) An oxysterol signalling pathw ay mediated by
the nuclear receptor LXRa. Nature 383, 728±731.
17. Silve,S.,Dupuy,P H.,Ferrara,P.&Loison,G.(1998)Human
lamin B receptor exhibits sterol C14-reductase activity in
Saccharomyces cerevisiae. Biochim. Biophys. Acta 1392, 233±244.
18. Holmer, L., Pezhman, A. & Worman, H.J. (1998) The human
lamin B receptor/sterol reductase multigene family. Genomics 54,
469±476.
19. Moebius, F.F., Fitzky, B.U., Lee, J.N., Paik, Y K. & Glossmann,
H. (1998) Molecular cloningandexpressionof the human delta7-
sterol reductase. Proc.NatlAcad.Sci.USA95, 1899±1902.
20. F itzky, B.U., Witsch-Baumgartner, M., Erdel, M., Lee, J.N., Paik,
Y K., Glossmann, H., Utermann, G. & Moebius, F.F. (1998)
Mutations in the D7-sterol reductase gene in patients with the
Smith±Lemli±Opitz syndrome. Proc. Natl Acad. Sci. USA 95,
8181±8186.
21. W assif, C.A., Maslen, C., Kachilele-Linjevile, S., Lin, D., Linck,
L.M.,Connor,W.E.,Steiner,R.D.&Porter,F.D.(1998)Muta-
tions in the human sterol D
7
-reductase gene at 11q12-13 cause
Smith±Lemli±Opitz syndrome. Am.J.Hum.Genet.63, 55±62.
22. W aterham, H.R., Wijburg, F.A., Hennekam, R.C.M., Vreken, P.,
Poll-The
Á
, B.T., Dorland, L., Duran, M., Jira, P.E.,
Smeitink, J.A.M., Wevers, R.A. & Wanders, R.J.A. (1998)
Smith±Lemli±Opitz syndrome is caused by mutations in the
7-dehydrocholesterol reductase gene. Am.J.Hum.Genet.63,
329±338.
23. Prakash, A., Sengupta, S., Aparna, K. & Kasbekar, D.P. (1999)
The erg -3 (sterol D
14,15
-reductase) gene o f Neuros pora crassa :
generation of null mutants by repeat-induced point mutation and
complementat ion by proteins chimeric for human lamin B recep-
tor sequences. Microbiology 145, 1443±1451.
24. F ieser, L.F. & Ourisson, G. (1953) Cholesterol and compan ion.
IV. Oxidation of D7 sterol with selenium dioxide. J. Am. Chem.
Soc. 75, 4404±4414.
25. M ancini, A., Del Rosso, F., Roberti, R., Orvietani, P., Coletti, L.
& Binaglia, L. (1999) Puri®cation of ethanolaminephosphotrans-
ferase frombovineliver microsomes. Biochim. Biophys. Acta 1437,
80±92.
26. C leveland, D.W., Fischer, S.G., Kirschner, M.W. & Laemmli,
U.K. (1977) Peptide mapping by limited proteolysis in sodium
dodecylsulfate and a nalysis by gel electrop horesis. J. Biol. Chem.
252, 1102±1106.
27. A ltschul, S. F., Madden, T.L., Scha
È
er, A.A., Zhang, J., Zhang,
Z., Miller, W. & Lipman, D.J. (1997) Gapped BLAST and PSI-
BLAST: a new generation of protein database search programs.
Nucleic Acids Res. 25, 3389±3402.
28. Harlow, E. & Lane, D. (1988) Antibodies: A Laboratory Manual.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor NY,
USA.
29. Chirgwin, J.M., Przybyla, A.E., MacDonald, R.J. & Rutter, W.J.
(1979) Isolation of biologically active ribonucleic acid from
sources enriched in ribonuclease. Biochemistry 18, 5294±5299.
30. D ella Fazia, M.A., Servillo, G. & Viola Magni, M . (1992) Dif-
ferent expressionof tyrosine aminotransferase an d serine d ehy-
dratase in rat livers after partial hepatectomy. Biochem. Biophys.
Res. Commun. 182, 753±759.
31. Rupp, R.A., Snider, L. & Weintraub, H. (1994) Xenopus embryos
regulate the nuclear localization of XMyoD. Genes Dev. 8, 1311±
1323.
32. S ambrook, J., Fritsch, E.F. & Maniatis, T. ( 1989) Molecular
Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, N Y, USA.
33. Bradford, M.M. (1976) A rapid and sensitive method for
the quantitation o f m icrogram quantities of protein utilizing
the principle of protein-dye binding. Anal. Biochem. 72, 248±
254.
34. S mith, T.P., Grosse, W.M., Freking, B.A., Roberts, A.J., Stone,
R.T., Casas, E., Wray, J.E., White, J., Cho, J. & Fahrenkrug, S.C.,
et al. (2001) Sequence evaluation of four pooled-tissue normalized
Ó FEBS 2002 BovinesterolD14-reductasecloning (Eur. J. Biochem. 269) 289
bovine c DNA libraries and construction o f a gene index for cattle.
Genome Res. 11, 626±630.
35. Polevoda, B. & Sherman, F. (2000) N
a
-terminal acetylation of
eukaryotic proteins. J. Biol. Chem. 275, 36479±36482.
36. Worman, H.J., Evans, C.D. & Blobel, G. (1990) The lamin B
receptor of t he nuclear envelope inner membrane: a polytopic
protein with eight potential t ransmembrane domains. J. Cell. Biol.
111, 1535±1542.
37. Lecain, E., Chenivesse, X., Spagnoli, R. & Pompon, D. (1996)
Cloning by metabolic interference in yeast and enzymatic c har-
acterization of Arabidopsis thaliana sterol D7-re ductas e. J. Biol.
Chem. 271, 10866±10873.
38. Lai, M.H., Bard, M., Pierson, C.A., Alexander, J.F., Goebl, M.,
Carter, G.T. & Kirsch, D.R. (1994) The identi®cation of a gene
family in th e Saccharomyces cerevisiae ergosterol biosynthesis
pathway. Gene 140, 41±49.
290 R. Roberti et al. (Eur. J. Biochem. 269) Ó FEBS 2002
. Biotechnology, University of Perugia, Italy
Biosynthesis of cholesterol represents one of the funda-
mental cellular metabolic processes. Sterol D14-reductase
(D14-SR). the bovine cDNA encodes D14-SR. Northern
blot analysis of bovine tissues showed high expression of
mRNA in liver and brain. The polypeptide encoded by
theclonedcDNAwasexpressedinCOS-7cells.Immu-
no¯uorescence