Báo cáo khoa học: Cloning and expression of the first nonmammalian interleukin-11 gene in rainbow trout Oncorhynchus mykiss pdf

Cloning and expression of the first nonmammalian interleukin-11 gene in rainbow trout Oncorhynchus mykiss Tiehui Wang,1 Jason W Holland,1 Niels Bols2 and Christopher J Secombes1 Scottish Fish Immunology Research Centre, University of Aberdeen, UK Department of Biology, University of Waterloo, Ontario, Canada Keywords Aeromonas salmonicida; cloning; expression; interleukin-11; rainbow trout Correspondence C J Secombes, Scottish Fish Immunology Research Centre, School of Biological Sciences, University of Aberdeen, Aberdeen AB24 2TZ, UK Fax: +44 1224 272396 Tel: +44 1224 272872 E-mail: c.secombes@abdn.ac.uk Database The nucleotide sequences of rainbow trout interleukin-11 will appear in the EMBL ⁄ DDBJ ⁄ GenBank nucleotide sequence database under the accession numbers AJ535687 (cDNA) and AJ867256 (genomic DNA) (Received September 2004, revised December 2004, accepted 24 December 2004) doi:10.1111/j.1742-4658.2005.04544.x Interleukin (IL)-11 is a multifunctional cytokine that stimulates hematopoietic progenitor cells and exerts a series of important immunomodulatory effects It was believed to be restricted to mammals, but here we report the first nonmammalian IL-11 gene, in rainbow trout (Oncorhynchus mykiss) A trout IL-11 cDNA clone was isolated that contains a 5¢-untranslated region (UTR) of 400 bp, an open reading frame of 612 bp and a large 3¢UTR of 1924 bp Analysis of a genomic DNA clone from a trout lambda library revealed that the trout IL-11 gene has the same five exon ⁄ four intron gene organization, as well as the same intron phase, as mammalian IL-11 genes The 204 amino acid trout IL-11 translation has a predicted signal peptide of 26 amino acids and mature peptide of 178 amino acids, with a calculated molecular mass of 20.5 kDa and a theoretical pI of 9.83 The mature peptide contains a cysteine residue and a potential N-linked glycosylation site that are not present in mammals Phylogenetic analysis clearly grouped trout IL-11 with IL-11 molecules from other species and separated from other members of the IL-6 family The IL-11 gene is highly expressed in intestine and gills in healthy fish and its expression can also be detected in spleen, head kidney, brain, skin and muscle Bacterial infection of rainbow trout markedly up-regulates IL-11 expression in liver, head kidney and spleen IL-11 expression is also up-regulated in RTS-11 cells (a trout macrophage cell line), which constitutively expressed the lowest level of IL-11 of the four trout cell lines examined, after stimulation with bacteria, lipopolysaccharide, poly(I:C) and recombinant trout IL-1b Only a single transcript of 3.2 kb could be detected in lipopolysaccharide or recombinant IL-1b-stimulated RNA samples by northern blotting The expression results, showing that IL-11 is widely distributed and modulated by infection and other cytokines, suggest that fish IL-11 is an active player in the cytokine network and the host immune response to infection Interleukin (IL)-11 is a 19 kDa, highly conserved, nonglycosylated protein that was originally identified and cloned from a primate bone marrow-derived stromal cell line (PU-34) as a lymphopoietic and hemotopoietic cytokine [1] It is synthesized as a 199 amino acid precursor and secreted as a 178 amino acid mature peptide after cleavage of the 21 amino acid signal peptide [2] It is unusually basic for a cytokine, and has a high content of proline, leucine and positively charged amino acids IL-11 is thought to exist as a thermally stable, four-helix bundle structure, although it contains no cysteine residues [3] It is a member of the gp130 family of cytokines that includes IL-6, leukaemia inhibitory factor, oncostatin M, cardiotropin 1, ciliary Abbreviations IL, interleukin; LPS, lipopolysaccharide; MOI, multiplicity of infection; ORF, open reading frame; pI, isoelectric point; TGF, transforming growth factor; TNF, tumour necrosis factor; UTR, untranslated region 1136 FEBS Journal 272 (2005) 1136–1147 ª 2005 FEBS T Wang et al neurotrophic growth factor and a viral homologue of IL-6 encoded by the Kaposi’s sarcoma-associated herpesvirus All of these cytokines elicit either hetero- or homodimerization of gp130, which activates intracellular signal transduction pathways [4] IL-11 has three receptor-binding sites, with a signal being initiated by binding to the specific IL-11R via site I and gp130 via sites II and III, through the formation of a hexameric receptor complex consisting of two molecules each of IL-11, IL-11R, and gp130 [5] IL-11 is produced by many cell types throughout the body Basal and inducible IL-11 mRNA expression can be detected in fibroblasts, epithelial cells, chondrocytes, synoviocytes, keratinocytes, endothelial cells, osteoblasts and certain tumour cells and cell lines [3] Viral [6] and bacterial [7] infection, and cytokine [IL-1, tumour necrosis factor (TNF)a, and transforming growth factor (TGF)-b1] [8] stimulation all induce IL-11 expression By alternative use of two polyadenylation sites, the human IL-11 gene produces two transcripts of 1.5 and 2.5 kb, respectively that encode the same IL-11 protein [1,9] Once produced, IL-11 acts on multiple cell types, including hemotopoietic cells, hepatocytes, adipocytes, intestinal epithelial cells, tumour cells, macrophages, and both osteoblasts and osteoclasts In the hematopoietic compartment IL-11 supports multilineage and committed progenitors contributing to myeloid, erythroid, megakaryocyte and lymphoid lineages [10] As human IL-11 stimulates megakaryocytopoiesis, resulting in increased production of platelets, it is used in the prevention of severe thrombocytopenia occurring after cancer chemotherapy and may be a useful future therapy to ameliorate neonatal thrombocytopenia [11] IL-11 is also an anti-inflammatory cytokine that inhibits the production of proinflammatory cytokines from lipopolysaccharde (LPS)-stimulated macrophages [12] In combination with its trophic effects on the gastrointestinal epithelium, IL-11 has a profound activity in the protection and restoration of the gastrointestinal mucosa [13,14] Interestingly IL-11 stimulates osteoclast formation and bone resorption in vitro [15] Indeed, transgenic overexpression of IL-11 stimulates osteoblastogenesis and bone formation [16] Thus, IL-11, together with other members of the gp130 family, are essential for bone metabolism [17] Lastly, IL-11 signalling is an absolute requirement for normal development of placentation and survival to birth [18] Although IL-11R– ⁄ – mice display normal hematopoiesis [19], female IL-11R– ⁄ – mice are infertile because of defective decidualization [20] and mutant mice with low IL-11R activity have low fertility [21] FEBS Journal 272 (2005) 1136–1147 ª 2005 FEBS Rainbow trout interleukin-11 Owing to its key activities on thrombocytopoiesis and the development of placentation, IL-11 is currently believed to be restricted to mammals and to date no nonmammalian IL-11 molecules have been described In an effort to identify immune genes involved in host defence against bacterial infection in rainbow trout (Oncorhynchus mykiss), the gene-expression profile of bacterial-challenged rainbow trout was surveyed by means of suppression subtraction hybridization and sequence analysis [22] This resulted in identification of a number of immune genes, including a SSH clone with homology to mammalian IL-11 As the expression of this clone was highly induced in tissues of bacterial infected fish, a full-length cDNA clone as well as a genomic DNA clone were isolated and sequenced, and the expression and modulation of this molecule was studied Results Cloning and characterization of rainbow trout IL-11 A cDNA clone containing a 2936 bp insert has been isolated from a liver SMART cDNA library and fully sequenced from both directions It contained a 5¢-untranslated region (UTR) of 400 bp, an open reading frame (ORF) of 612 bp and a large 3¢-UTR of 1922 bp (accession number AJ535687, Fig 1) Several mRNA instability motifs (ATTTA) were present in the 3¢-UTR as well as in the 5¢-UTR, and four potential poly(A) signals were found in the 3¢-UTR (Fig 1), two of them just 14 or 23 bp upstream of the poly(A) tail The remaining two poly(A) signals were upstream of the region that contained the ATTTA motifs, such that if either was used as a poly(A) signal, a transcript encoding the same protein but without any ATTTA motifs in the 3¢-UTR would be produced The precursor trout IL-11 translation had 204 amino acids, a calculated molecular mass of 23.3 kDa and a theoretical isoelectric point (pI) of 9.77 A signal peptide of 26 amino acids was predicted [32] Thus the mature trout IL-11 generated following cleavage of the signal peptide is 178 amino acids with a calculated molecular mass of 20.5 kDa and a theoretical pI of 9.83 A potential N-linked glycosylation site was also identified (Fig 1) To define the gene organization of trout IL-11, a lambda clone was isolated and a fragment (9894 bp, accession number AJ867256) containing the IL-11 gene and its 5¢- and 3¢-flanking region was sequenced The trout IL-11 gene has a five exon ⁄ four intron organization and all introns are phase except intron I, which 1137 Rainbow trout interleukin-11 1138 T Wang et al FEBS Journal 272 (2005) 1136–1147 ª 2005 FEBS T Wang et al Rainbow trout interleukin-11 Fig Nucleotide and deduced amino acid sequences of the trout IL-11 gene The genomic DNA (upper line, accession number 867256), cDNA (middle line, accession number AJ535687) and amino acid (lower line) sequence are numbered on the left according to the submitted sequences The 5¢- and 3¢-flanking and intron sequences are in lowercase Identical nucleotides in the cDNA to genomic DNA sequence is relaced by ‘|’ and insertions indicated by ‘-’ The two insertions in the 5¢- and 3¢-UTR are underlined and the 13 repeats with a consensus of CCAATGATGATCCAAGAAATCCACACTACAG (31 bp) in the 3¢-UTR are numbered and distinguished from each other by alternate highlighting in bold and italics The ATTTA motifs in the 5¢- and 3¢-UTRs, the start and stop codons, the signal peptide predicted by SIGNALP 3.0 [23] and the potential N-glycosylation site (NQT) are in bold and underlined The four potential poly(A) signals (AATAAA) in the 3¢-UTR and the TATA box in the 5¢-flanking region are boxed is phase (Fig 1) This exon ⁄ intron organization resembles that of mammalian IL-11 The sequences between the trout cDNA and genomic DNA in the coding region are identical, although there were differences in both the 5¢- and 3¢-UTR The major differences were a 26 bp insertion in the 5¢-UTR of the cDNA and an insertion of 12 repeats with a consensus of CCAATGATGATCCAAGAAATCCACACTACAG (31 bp) in the 3¢-UTR of the cDNA sequence (Fig 1) A TATA box was identified 28 bp upstream from the cDNA sequence The trout IL-11 translation showed only 32 ⁄ 40% sequence identity ⁄ similarity to primate counterparts, and even lower homology (29 ⁄ 39% identity ⁄ similarity) to rodent IL-11, whereas mammalian IL-11 molecules share high sequence identities, with 94.5% identity between primates, 97% identity between rodents, and 84% identity between primates and rodents (Table 1) When preparing this article, an IL-11 homologue in the fugu (Tetraodon nigroviridis) database was discovered The trout translation showed similar homology to the fugu IL-11 molecule as to mammalian molecules However, the trout molecule shares a higher nucleotide identity of 46.7% in the coding region with fugu IL-11, compared with 42.5, 43.2, 41.4 and 42.8% with IL-11s from human, monkey, mouse and rat, respectively Fugu IL-11 translation also showed low homology (28% identity) with mammalian IL-11s (Table 1) Trout IL-11 has a mature peptide of the same length (178 amino acids) as in mammals, although it encodes a longer precursor of 204 amino acids (compared with 199 amino acids in mammals, Table 2) Both fish IL-11s have a longer signal peptide of 26 amino acids, compared Table Amino acid homology of trout IL-11 with known IL-11 molecules Puffer fish Human Monkey Mouse Rat Identity(%) Trout Puffer fish Human Monkey Mouse Similarity(%) Identity Similarity Identity Similarity Identity Similarity Identity Similarity 30.3 – – – – 37.9 – – – – 32.3 28.1 – – – 40.3 32.4 – – – 31.7 28.6 94.5 – – 39.8 33.0 95.0 – – 29.4 28.3 87.9 83.9 – 38.5 32.6 90.0 86.4 – 29.0 27.8 87.9 84.4 97.5 38.5 32.1 90.0 86.9 98.0 Table Comparison of biochemical parameters of the predicted trout IL-11 translation with other known IL-11 molecules Puffer fish Precursor (amino acids) Signal peptite (amino acids) Mature peptide (amino acids) Mature peptide Mol mass (kDa) Cysteine (amino acids) Potential N-Gly Prolinea (%) Leucinea (%) Positive chargeda (%) Isoelectric point a Trout Human Monkey Mouse Rat 208 26 182 204 26 178 199 21 178 199 21 178 199 21 178 199 21 178 20.4 4.9 (9) 15.4 (28) 9.9 (18) 7.91 20.5 1 9.0 (16) 13.5 (24) 12.4 (22) 9.83 19.1 0 12.4 (22) 23.0 (41) 11.8 (21) 11.16 19.4 0 11.2 (20) 23.6 (42) 11.8 (21) 10.71 19.2 0 9.0 (16) 21.9 (39) 11.8 (21) 11.16 19.2 0 9.0 (16) 21.3 (38) 11.8 (21) 11.16 Percentage of amino acid in the mature peptide Number in brackets is actual number of residues present FEBS Journal 272 (2005) 1136–1147 ª 2005 FEBS 1139 Rainbow trout interleukin-11 with 21 amino acids in mammals There are cysteine residues (one in trout and four in fugu) and potential N-glycosylation sites (one in trout and two in fugu) present in mature peptides of the fish IL-11s that are not present in mammals (Table 2) The two fish IL-11s have a lower leucine content; 15.4% in fugu and 13.5% in trout, compared with 21.3–23.6% in mammals Trout and mammalian IL-11s have a high proline content, positively charged amino acid content and high isoelectric points, in contrast to fugu IL-11 (Table 2) A multiple alignment was constructed from the fish (trout and fugu) and mammalian IL-11 molecules (Fig 2) The single cysteine residue present in the trout sequence aligned well with one of the four cysteine residues in the fugu mature peptide Critical residues L67 and R169 (numbered according to human IL-11) in the receptor-binding site I, which bind to mammalian IL-11R and are essential for its activity [2, 24] were well conserved However, three residues, K42, M59 and K99, which are conserved in all mammalian sequences and also critical for receptor binding [5], are absent in the relevant positions in both fish sequences (Fig 2) To define the relationship of trout IL-11 to other IL-6 family members, a phylogenetic tree was constructed using the neighbor-joining method and bootstrapped 1000 times This tree (Fig 3) clearly grouped the trout IL-11 with IL-11 molecules from T Wang et al other species and separate from other members of the IL-6 family In vivo expression of IL-11 RT–PCR was used to examine the expression of trout IL-11 in tissues prepared from three healthy fish Comparable products for b-actin were amplified from the different samples using a low cycle number (21 cycles) Trout IL-11 was highly expressed in intestine and gills, and was also detectable in other tissues including spleen, liver, head kidney, brain, skin and muscle using a high cycle number of 32 (Fig 3) IL-11 expression was highly up-regulated in vivo by bacterial infection, as shown in Fig in liver, head kidney and spleen tissues No IL-11 expression was detectable using 28 cycles in samples prepared from control fish or phosphate-buffered saline (PBS)-injected fish, however, a PCR product was just detectable in samples from fish injected with bacteria h after infection, and a strong product was present in samples prepared at 24 and 48 h after infection (Fig 4) Expression and modulation of trout IL-11 in cell lines The constitutive expression of IL-11 was examined in four trout cell lines from samples prepared from Fig Multiple alignment of the predicted rainbow trout IL-11 translation with known IL-11 molecules Identical (*) and similar residues (: or.) identified using CLUSTAL W are indicated The signal peptides are in bold The potential N-glycosylation sites and cysteine residues present in the two fish molecules, and the three conserved residues (K42, M59 and K99) in the mammalian mature IL-11 protein, are in bold and underlined The conserved residues L67 and R169, critical to binding IL-11R, are boxed A, B, C and D indicate the four alpha helices [5] Accession numbers are: human, P20809; monkey, P20808; mouse, P47873; rat, Q99MF5; puffer fish, Q6UAM0 and trout, AJ535687 1140 FEBS Journal 272 (2005) 1136–1147 ª 2005 FEBS T Wang et al Rainbow trout interleukin-11 OSM, Mouse, P53347 OSM, Cow, P53346 OSM, Human, P13725 IL-6, Squirrel Monkey, Q8MKH0 IL-6, Night monkey, Q9TTH3 IL-6, Human P05231 973 IL-6, Sooty mangabey, P46650 980 IL-6, Rhesus macaque, P51494 966 IL-6, Cynomolgus monkey, P79341 IL-6, Sheep, P29455 984 IL-6, Goat, Q28319 984 IL-6, Cow, P26892 983 IL-6, Buffalo, Q6V919 I L- , K ille r w l e, Q 28 474 824 IL-6, Beluga whale, Q9XT80 IL-6, Pig, P26893 952 984 550 984 262 339 450 520 IL-6, Camel, Q865W7 IL-6, Lama glama, Q865X6 IL-6, Cat, P41683 860 IL-6, Dog , P41323 650 IL-6, Seal, Q28819 928 IL-6, Sea Otter, Q28403 IL-6, Woodchuck, 557 IL-6, Rat, P20607 984 IL-6, Mouse, P08505 IL-6, Rabbit, Q9MZR1 499 IL-6, Chicken, Q90YI0 M16, Carp, AY102632 319 IL-6, fugu, Q6L6X6 361 984 971 487 347 353 IL-11, Rat, Q99MF5 IL-11, Mouse, P47873 IL-11, Human, P20809 583 IL-11, Cynomolgus monkey,P20808 984 984 492 IL-11, Trout, AJ535687 412 IL-11, Fugu, Q6UAM0 809 IL-11, Halibut, AU090873 (est) 702 IL-11, Cat fish, CB939978 (est) LIF, Possum, Q9GLC2 LI F , P ig , Q G K Z 341 LIF, Mouse, P09056 984 LIF, Rat, P17777 LIF, Human, P15018 466 LI F , S h e e p , Q M3 259 LIF, Mink, O62728 175 LIF, Cow, Q27956 CT-1, Human, Q16619 984 CT-1, Rat ,Q63086 984 CT-1, Mouse, Q60753 403 984 984 984 636 984 984 840 726 805 CNTF, Chicken, Q02011 CNTF, Pig, O02732 CNTF, Rat, P20294 CNTF, Mouse, P51642 CNTF, Human, P26441 CNTF, Rabbit, P1 4188 Fig A phylogenetic tree of trout IL-11 and other members of the IL-6 family cytokines including IL-6, IL-11, LIF (leukaemia inhibitory factor), OSM (Oncostatin M), CT-1 (cardiotrophin-1) and CNTF (ciliary neurotrophic factor) A carp molecule (M16) that shares sequence similarity with the IL-6 family is also included The tree was constructed using the neighbor-joining method Numbers indicate bootstrap values from 1000 replications The molecular type, species and accession number for each molecule analysed are on the right cultures one day after passaging Expression of IL-11 was highly detectable in CL-6 and RTG cell lines, and to a lesser extent in RTL cells However, only a very weak PCR product was detectable in the monocyte ⁄ macrophage cell line RTS-11, under 32 cycles of amplification (Fig 5) As a potentially important molecule in monocyte ⁄ macrophage host defence, the modulation of IL-11 was studied in RTS-11 cells One day after passaging, RTS-11 cells were stimulated with LPS (25 lgỈmL)1), Aeromonas salmonicida MT423 [multiplicity of infection (MOI) ¼ 50] or poly(I:C) (25 lgỈmL)1) for 3, and 24 h IL-11 expression in FEBS Journal 272 (2005) 1136–1147 ª 2005 FEBS RTS-11 cells was highly up-regulated by bacterial infection, as well as by LPS, poly(I:C) (Fig 6A) and recombinant trout IL-1b stimulation (Fig 6B) Northern blot analysis To study the transcript size and to confirm the RT– PCR analysis, RNA samples from LPS (25 lgỈmL)1, h) and trout recombinant IL-1b (25 ngỈmL)1, h) stimulated RTS-11 cells were analysed by northern blotting A single transcript of  3.2 kb was detectable that was highly expressed in LPS- and recombinant 1141 3 1 3 3 pM ar k lee n Sp er id ne y Li ve r le M us c in Sk He ad k e tin In tes 0b Gi lls T Wang et al 10 10 0b Ne p M ga ar tiv ke ec r o Br ain ntro l Rainbow trout interleukin-11 β IL-11 PBS Bacterial Liver D NA m ar h ke r 24 h 48 h h 24 h 48 h C on N trol eg D NA tr m ol ar ke r Fig Expression of trout IL-11 in tissues A range of cDNAs was prepared from tissue samples from three healthy rainbow trout and used for amplification of IL-11 (Primer EF and ER, expected size: 271 bp) and b-actin (expected size: 276 bp) The cycle numbers were 21 and 32 for b-actin and IL-11, respectively β-Actin Spleen Head kidney IL-11 β-Actin IL-11 β-Actin IL-11 IL-1b-treated samples but undetectable in the control cells Comparable signals for the 1.8-kb b-actin transcript were detected in all samples (Fig 7A,B) Discussion This is the first report to describe an IL-11 gene in fish The trout IL-11 gene was initially identified from 1142 Fig Expression of trout IL-11 in vivo in bacterially challenged rainbow trout Trout were injected with PBS or bacteria (Aeromonas salmonicida, MT423) and three fish were sampled at 6, 24 and 48 h postinjection, as described in the Experimental procedures Three healthy fish were killed for the control samples Total RNA from three fish at each time point was pooled and used for RT-PCR analysis The cycle numbers were 21 and 28 for b-actin and IL-11, respectively a liver SSH library prepared from bacterial-challenged fish and a full-length cDNA clone was then obtained from a SMART cDNA library The trout sequence has a long ORF encoding a basic protein with a predicted signal peptide of 26 amino acids and a mature peptide of 178 amino acids The trout IL-11 translation, as well as one from another bony fish (fugu, Tetraodon nigroviridis) share low amino acid identity FEBS Journal 272 (2005) 1136–1147 ª 2005 FEBS 24 h 7h Poly I:C 3h 24 h 7h 3h MT423 24 h 7h LPS 3h Control Marker A Marker Rainbow trout interleukin-11 Neg Control T Wang et al β-actin LP S C on tr ol A β-actin C on β rI L -1 β -1 L tr ol 1.8 kb rI Marker 8h 6h 4h 2h IL-11 IL-11 3.2 kb IL-11 1.8 kb β-actin Fig Northern blot analysis of trout IL-11 expression in RTS-11 cells stimulated for h with LPS (25 lgỈmL)1) (A) and recombinant trout IL-1b (25 ngỈmL)1) (B) Twenty micrograms of RNA was separated, transferred to a Hybond nylon membrane, and hybridized with 32P-labelled trout b-actin and IL-11 probes Two independent experiments are shown for the LPS or rIL-1b stimulated cells (28–32%) to mammalian IL-11, despite the fact that mammalian IL-11s are highly conserved and share 94% amino acid identity between primate sequences, 97% identity between mouse and rat sequences, and 88% identity between human and mouse sequences FEBS Journal 272 (2005) 1136–1147 ª 2005 FEBS 1h β-actin 3.2 kb B 0.5 h 0h Marker B LP S Fig Modulation of IL-11 expression by LPS, bacterial infection and Poly I:C (A) or trout rIL-1b (B) One day after passaging, RTS-11 cells were treated with LPS (25 lgặmL)1), Aeromonas salmonicida MT423 (MOI ẳ 50), or poly(I:C) (50 lgỈmL)1) for 3, and 24 h or IL-1b (25 ngỈmL)1) for 0.5–8 h, and total RNA prepared for RT–PCR analysis The cycle numbers for PCR were 21 and 30 for b-actin and IL-11, respectively Neg Control IL- 11 The trout molecule has a similar exon ⁄ intron organization to mammalian IL-11 The phylogenetic tree grouped the trout molecule with IL-11 molecules from other species and separate from other IL-6 family members Such evidence strongly suggests that the trout molecule is the fish homologue to mammalian IL-11 The low homology between fish and mammalian sequences is not unusual For example, trout IL-1b shares 28% identity with human IL-1b [25], trout TNFa shares 32% identity with human TNFa [26], and a recently identified trout IL-15 shares only 26% identity with human IL-15 [27] The divergence between fish and mammalian IL-11 and the conservation between mammalian IL-11 molecules may be relevant to their functional role For example, the requirement for IL-11 in normal development of placentation in mammals is a biological activity that is apparently not needed in fish However, other functions, such as anti-inflammatory effects and other hematopoietic effects, might be conserved and await functional studies with the recombinant protein IL-11 expression is regulated mainly at the post-transcription level, by stabilizing the transcribed mRNA that possesses multiple copies of a destabilizing signal (ATTTA) in the 3¢-UTR [28] Multiple ATTTA motifs are also present in the 3¢-UTR of trout and pufferfish IL-11 sequences, as well in the 5¢-UTR of the trout transcript Human and monkey IL-11 is produced as two mRNA transcripts of 1.5 and 2.5 kb which differ at their 3¢-polyadenylation sites yet encode the same 1143 Rainbow trout interleukin-11 protein [1], and respond similarly to IL-1a ⁄ b and TGFb stimulation [8,28] In mouse and rat only a single IL11 transcript, of kb, is produced [29] The trout IL-11 gene gives rise to a single transcript of 3.2 kb in RTS cells, as seen in the northern blot (Fig 7), and is the largest of the known IL-11 molecules Interestingly, the trout IL-11 transcript has four potential poly(A) signals (AATAAA), two of them present just 14 and 23 bp, respectively, upstream of the poly(A) tail in the cDNA sequence, which should be the poly(A) signal giving rise to the 3.2 kb transcript The other two are present before the region that contains the ATTTA motifs and if either is used as a poly(A) signal, a transcript encoding the same protein but without instability motifs in the 3¢-UTR would be produced, as a shorter but potentially more stable mRNA IL-11 expression was detectable by RT–PCR in all the tissues examined, with apparent high levels of expression in intestine and gills Intestine and gills are two primary sites where fish encounter foreign insults including infection by bacteria, viruses and parasites, and environmental stresses Constitutive expression of IL-11 was also detectable in lung, stomach and intestine in mice [30], and suggests a conserved role for IL-11 in gills ⁄ lung and intestine, where it functions as an anti-inflammatory cytokine Although in healthy fish IL-11 is expressed at very low levels in liver, head kidney and spleen, as evidenced from the high cycle number of 32 needed for its detection by RT–PCR, its expression is highly induced in these tissues after bacterial infection This induction of expression has also been seen after infection in mammals where, for example, human cord blood-derived macrophages and dendritic cells express a higher level of IL-11 upon virus infection [6] IL-11 mRNA up-regulation has also been seen in mice after infection with Pseudomonas aeruginosa [7] As IL-11 is known to be immunosuppressive rather than proinflammatory in mammals, its role in the immune response to A salmonicida and the pathology of furunculosis will be interesting to elucidate Of the four cell lines examined, the monocyte ⁄ macrophage-like RTS-11 cell line expressed the lowest level of IL-11 mRNA However, expression of IL-11 was highly modulated by stimulation with LPS, bacteria, poly(I:C), as well as trout recombinant IL-1b in this cell line Expression of mammalian IL-11 is modulated in vitro by cytokines and other stimulants in different biological settings IL-1a induces IL-11 expression in rheumatoid synovial fibroblasts, lung epithelial cell lines and endometrial epithelial and stromal cells TGF-b has been shown to stimulate IL-11 production in a number of cell types, including lung epithelial cells, fibroblasts, osteoblasts, chondrocytes, breast cancer 1144 T Wang et al cells, and again endometrial epithelial and stromal cells [31] Lastly, with intestinal myofibroblasts, IL-b and TGF-b are potent inducers of IL-11 expression at both the mRNA and protein levels [8] Trout RTS-11 cells show constitutive expression of TGF-b mRNA, and IL-1b but not TGF-b mRNA is up-regulated by LPS and IL-1b itself [32] IL-1b mRNA is also up-regulated in RTS-11 cells by infection with A salmonicida and by poly(I:C) stimulation (unpublished results) Thus, the up-regulation of IL-11 expression by such stimuli may be an indirect effect through the induction of IL-1b In conclusion, it is clear that IL-11 evolved early and is present in bony fish Expression of IL-11 in trout was shown to be widely distributed, being present in all the tissues and cell lines examined Its expression was modulated by bacterial infection, and stimulation in vitro with LPS, poly(I:C) (a viral mimic) and IL-1b Such data suggest that IL-11 is an active player in the cytokine network and the host immune response to infection in fish Experimental procedures Cell lines and cell culture Four rainbow trout cell lines were used in these studies; the mononuclear cell line RTS-11 [33], the gonad cell line RTG [34], the liver cell line RTL [35] and CL-6 (a generous gift from Dr Benmansour, INRA, France) All trout cells were grown in L-15 medium supplemented with 100 unitsỈmL)1 penicillin and 100 lgỈmL)1 streptomycin, and 30% fetal calf serum for RTS-11, and 10% fetal bovine serum for all the other cell lines Bacterial challenge, SSH library construction and analysis A virulent strain of A salmonicida ssp salmonicida, MT 423 [36,37] was used to challenge rainbow trout ( 300 g, females) – procedures were in accordance with a Home Office (UK) animal licence The preparation of bacteria, challenge procedure, tissue sampling and construction of liver SSH libraries were described previously [22] Fish were anaesthetized in benzocaine solution (40 mgỈL)1) and killed by severing the spinal cord Sequence analysis The nucleotide sequences generated were assembled and analysed using the alignir program (LI-COR, Inc., Lincoln, NE, USA) A sequence similarity search was performed using fasta [38] and blast [39,40] Direct comparison between two sequences was performed using FEBS Journal 272 (2005) 1136–1147 ª 2005 FEBS T Wang et al the gap program [41] A signal peptide was predicted using signalp 3.0 [23] Multiple sequence alignments of IL-11 molecules from were generated using clustal w, version 1.7 [42] The IL-11 sequences analysed were from human [43], monkey (Macaca fascicularis) [1], mouse [44], rat [29] and fugu (Tetraodon nigroviridis) [45] Phylogenetic trees of the IL-6 family members were created from multiple alignments by the neighbor-joining method and were bootstrapped 1000 times Trout IL-11 cDNA cloning To clone full-length trout IL-11 cDNA, a SMART cDNA library was constructed from bacterial-challenged liver tissues, as high expression of IL-11 was seen after bacterial infection in initial RT–PCRs Briefly, SMART cDNA was synthesized using total RNA prepared from liver tissue 24 and 48 h postchallenge with A salmonicida MT423, using a SMART cDNA synthesis kit (Clontech, Hampshire, UK) The SMART cDNA was amplified over five cycles using the Advantage-2 PCR enzyme system (Clontech) and a modified primer (TGAAAGCGGCCGCAGTGGTATCAACGCAG AGT) with a NotI restriction enzyme site at the 5¢-end The resulting amplified cDNA was digested with NotI (Promega, Southampton, UK), purified using a Qiagen PCR purification kit (Qiagen, West Sussex, UK) and ligated to NotI digested, dephosphorylated pGEM 5Zf(+) (Promega) Competent cells UltraMaxTM DN5a-FTTM (Invitrogen, Paisley, UK) were transformed with the ligated cDNA, diluted in 200 mL Luria–Bertani medium, containing 100 lgỈmL)1 ampicillin, after h recovery incubation at 37 °C and dispersed into two 96-deep-well (2.2 mL) plates and incubated at 37 °C overnight The bacteria from each well were PCR screened with IL-11 specific primers (Forward primer, 5¢TCAACTCCCTTGAGATGAGACC-3¢; Reverse primers, 5¢-TCCTGGGAAGACTGTAACACATC-3¢, expected product size of 271 bp) One well was identified containing IL-11 cDNA, with an insert of kb, as estimated by PCR using gene-specific and vector primers Bacteria from the IL-11positive well were diluted in Luria–Bertani medium, incubated at 37 °C overnight, and re-screened Finally, the bacteria were plated, and an isolated clone containing IL-11 was identified Plasmid DNA containing the kb IL-11 cDNA was prepared and fully sequenced from two directions using a GeneJumper kit (Invitrogen) Isolation and sequencing of a genomic clone of IL-11 A rainbow trout genomic library constructed with Lambda GEM-11 was PCR screened with IL-11-specific primer as described previously [46] A positive lambda clone was plaque purified and its DNA was prepared using a Wizard Lambda Preps DNA purification system (Promega) After an initial restriction enzyme analysis with BamHI, EcoRI, FEBS Journal 272 (2005) 1136–1147 ª 2005 FEBS Rainbow trout interleukin-11 SacI, XbaI and XhoI, the SacI digestion was subcloned in pGEM 7zf(+) and sequenced The cDNA sequence was aligned to the genomic sequence and the intron ⁄ exon boundary was identified using the sim4 program (http:// www.hgmp.mrc.ac.uk/Registered/Webapp/sim4/) In vivo expression of IL-11 A range of tissues (head kidney, gills, liver, spleen, muscle, skin, intestine and brain) were collected from three healthy fish for analysis of constitutive expression of IL-11 Liver, head kidney and spleen tissues were sampled 6, 24 and 48 h after A salmonicida MT423 injection as described previously [22] Total RNA was prepared using Trizol (Invitrogen) and converted to cDNA using PowerScript reverse transcriptase (Clontech) PCR was performed with IL-11 gene-specific primers as described above for cloning of the IL-11 cDNA A parallel PCR using primers for b-actin (forward primer, 5¢-CGACCTCACAGACTACCTGAT-3¢; reverse primers, 5¢-TGGATACCGCAAGACTCCATAC-3¢, expected product size of 276 bp) was used as a positive control for RT-PCR The PCR conditions were as described previously [46] Modulation of IL-11 expression in cell lines One day after passaging, cells were used for preparation of total RNA to examine constitutive expression of IL-11 To study the modulation of IL-11 expression in RTS-11 cells, one day after passaging cells were treated with 25 lgỈmL)1 LPS (Sigma), live A salmonicida MT423 (MOI ẳ 50) or 50 lgặmL)1 Poly(I:C) (Sigma, Dorset, UK) for 3, and 24 h, and recombinant trout IL-1b [47] (25 ngỈmL)1) for 0.5–8 h Total RNA was prepared from the treated and untreated control cells and analysed by RT–PCR as described above Total RNA was also prepared from RTS-11 cells treated with LPS (25 lgỈmL)1) and recombinant trout IL-1b (25 ngỈmL)1) for h for northern blot analysis Northern blot Northern blot analysis was performed as described previously [48] Briefly, 20 lg of total RNA per lane was transferred from a 1.1% formaldehyde–Mops agarose gel to nylon membranes by capillary action and hybridized overnight at 65 °C with a 32P-labelled 271 bp cDNA probe purified from a trout IL-11 PCR fragment amplified from the IL-11 cDNA clone A 32P-labelled b-actin cDNA probe was used as a control to ensure that any changes in mRNA levels were not a result of a general change in the amount of mRNA loaded Following stringent washing, membranes were put into an X-ray cassette with intensifying screens and film (Kodak, Rochester, NY, USA) and exposed for between h and days 1145 Rainbow trout interleukin-11 Acknowledgements This work was supported by a grant from the EC (Q5RS-2001–002211) Many thanks to Dr Jun Zou (University of Aberdeen) for supplying the recombinant trout IL-1b References Paul SR, Bennett F, Calvetti JA et al (1990) Molecular cloning of a cDNA encoding interleukin 11, a stromal cell-derived lymphopoietic and hematopoietic cytokine Proc Natl Acad Sci USA 87, 7512–7516 Keith JC Jr (2003) Interleukin-11 In The Cytokine Handbook, 4th edn (Thomsom AW & Lotze M T, eds), pp 363–381 Elsevier Science, London Czupryn MJ, McCoy JM & Scoble HA (1995) Structure–function relationships in human interleukin-11 Identification of regions involved in activity by chemical modification and site-directed mutagenesis J Biol Chem 270, 978–985 Barton VA, Hudson KR & Heath JK (1999) Identification of three distinct receptor binding sites of murine interleukin-11 J Biol Chem 274, 5755–5761 Barton VA, Hall MA, Hudson KR & Heath JK (2000) Interleukin-11 signals through the formation of a hexameric receptor complex J Biol Chem 275, 36197–36203 Bartz H, Buning-Pfaue F, Turkel O & Schauer U (2002) Respiratory syncytial virus induces prostaglandin E2, IL-10 and IL-11 generation in antigen presenting cells Clin Exp Immunol 129, 438–445 Kernacki KA, Goebel DJ, Poosch MS & Hazlett LD (1998) Early cytokine and chemokine gene expression during Pseudomonas aeruginosa corneal infection in mice Infect Immun 66, 376–379 Bamba S, Andoh A, Yasui H, Makino J, Kim S & Fujiyama Y (2003) Regulation of IL-11 expression in intestinal myofibroblasts: role of c-Jun AP-1- and MAPK-dependent pathways Am J Physiol Gastrointest Liver Physiol 285, G529–G538 McKinley D, Wu Q, Yang-Feng T & Yang YC (1992) Genomic sequence and chromosomal location of human interleukin-11 gene (IL11) Genomics 13, 814–819 10 Nandurkar HH, Robb L & Begley CG (1998) The role of IL-11 in hematopoiesis as revealed by a targeted mutation of its receptor Stem Cells 16 (Suppl 2), 53–65 11 Murray NA (2002) Evaluation and treatment of thrombocytopenia in the neonatal intensive care unit Acta Paediatr Suppl 91, 74–81 12 Trepicchio WL, Bozza M, Pedneault G & Dorner AJ (1996) Recombinant human IL-11 attenuates the inflammatory response through down-regulation of proinflammatory cytokine release and nitric oxide production J Immunol 157, 3627–3634 1146 T Wang et al 13 Orazi AX, Yang Z, Kashai M & Williams DA (1996) Interleukin-11 prevents apoptosis and accelerates recovery of small intestinal mucosa in mice treated with combined chemotherapy and radiation Lab Invest 75, 33–42 14 Liu QXX, Schindel DT, Yang ZX, Rescorla FJ, Williams DA & Grosfeld JL (1996) Trophic effects of interleukin-11 in rats with experimental short bowel syndrome J Pediatr Surg 31, 1047–1050 15 Girasole G, Passeri G, Jilka RL & Manolagas SC (1994) Interleukin-11: a new cytokine critical for osteoclast development J Clin Invest 93, 1516–1524 16 Takeuchi Y, Watanabe S, Ishii G et al (2002) Interleukin-11 as a stimulatory factor for bone formation prevents bone loss with advancing age in mice J Biol Chem 277, 49011–49018 17 Sims NA, Jenkins BJ, Quinn JM, Nakamura A, Glatt M, Gillespie MT, Ernst M & Martin TJ (2004) Glycoprotein 130 regulates bone turnover and bone size by distinct downstream signaling pathways J Clin Invest 113, 379–389 18 Robb L, Dimitriadis E, Li R & Salamonsen LA (2002) Leukemia inhibitory factor and interleukin-11: cytokines with key roles in implantation J Reprod Immunol 57, 129–141 19 Nandurkar HH, Robb L, Tarlinton D, Barnett L, Kontgen F & Begley CG (1997) Adult mice with targeted mutation of the interleukin-11 receptor (IL11Ra) display normal hematopoiesis Blood 90, 2148–2159 20 Robb L, Li R, Hartley L, Nandurkar HH, Koentgen F & Begley CG (1998) Infertility in female mice lacking the receptor for interleukin 11 is due to a defective uterine response to implantation Nat Med 4, 303–308 21 Bilinski P, Roopenian D & Gossler A (1998) Maternal IL-11Ralpha function is required for normal decidua and fetoplacental development in mice Genes Dev 12, 2234–2243 22 Wang T & Secombes CJ (2003) Complete sequencing and expression of three complement components, C1r, C4 and C1 inhibitor, of the classical activation pathway of the complement system in rainbow trout Oncorhynchus mykiss Immunogenetics 55, 615–628 23 Bendtsen JD, Nielsen H, von Heijne G & Brunak S (2004) Improved prediction of signal peptides signalp 3.0 J Mol Biol 340, 783–795 24 Tacken I, Dahmen H, Boisteau O et al (1999) Definition of receptor binding sites on human interleukin-11 by molecular modeling-guided mutagenesis Eur J Biochem 265, 645–655 25 Bird S, Zou J, Wang T, Munday B, Cunningham C & Secombes CJ (2002) Evolution of interleukin-1beta Cytokine Growth Factor Rev 13, 483–502 26 Laing KJ, Wang T, Zou J, Holland J, Hong S, Bols N, Hirono I, Aoki T & Secombes CJ (2001) Cloning and expression analysis of rainbow trout Oncorhynchus FEBS Journal 272 (2005) 1136–1147 ª 2005 FEBS T Wang et al 27 28 29 30 31 32 33 34 35 36 37 mykiss tumour necrosis factor-alpha Eur J Biochem 268, 1315–1322 Wang T & Secombes CJ (2003) Sequence analysis of rainbow trout genes modulated by bacterial infection EMBL accession no AJ555868 Yang L & Yang YC (1994) Regulation of interleukin (IL)-11 gene expression in IL-1 induced primate bone marrow stromal cells J Biol Chem 269, 32732– 32739 Li R, Hartley L & Robb L (2001) Cloning of rat interleukin 11 and interleukin 11 receptor alpha chain and analysis of their expression in rat uterus in the periimplantation period Reproduction 122, 593–600 Davidson AJ, Freeman SA, Crosier KE, Wood CR & Crosier PS (1997) Expression of murine interleukin 11 and its receptor alpha-chain in adult and embryonic tissues Stem Cells 15, 119–124 Cork BA, Li TC, Warren MA & Laird SM (2001) Interleukin-11 (IL-11) in human endometrium: expression throughout the menstrual cycle and the effects of cytokines on endometrial IL-11 production in vitro J Reprod Immunol 50, 3–17 Brubacher JL, Secombes CJ, Zou J & Bols NC (2000) Constitutive and LPS-induced gene expression in a macrophage-like cell line from the rainbow trout (Oncorhynchus mykiss) Dev Comp Immunol 24, 565– 574 Ganassin RC & Bols NC (1998) Development of a monocyte ⁄ macrophage-like cell line, RTS11, from rainbow trout spleen Fish Shellfish Immunol 8, 457–476 Wolf K & Quimby MC (1962) Established eurythermic lines of fish cells in vitro Science 135, 1065–1066 Lee LE, Clemons JH, Bechtel DG, Caldwell SJ, Han KB, Pasitschniak-Arts M, Mosser DD & Bols NC (1993) Development and characterization of a rainbow trout liver cell line expressing cytochrome P450-dependent monooxygenase activity Cell Biol Toxicol 9, 279– 294 Barnes AC, Horne MT & Ellis AE (1996) Effect of iron on expression of superoxide dismutase by Aeromonas salmonicida and associated resistance to superoxide anion FEMS Microbiol Lett 142, 19–26 Barnes AC, Bowden TJ, Horne MT & Ellis AE (1999) Peroxide-inducible catalase in Aeromonas salmonicida subsp salmonicida protects against exogenous hydrogen peroxide and killing by activated rainbow trout, FEBS Journal 272 (2005) 1136–1147 ª 2005 FEBS Rainbow trout interleukin-11 38 39 40 41 42 43 44 45 46 47 48 Oncorhynchus mykiss L macrophages Microb Pathog 26, 149–158 Pearson WR & Lipman DI (1988) Improved tools for biological sequence comparison Proc Natl Acad Sci USA 85, 2444–2448 Altschul SF, Gish W, Miller W, Myers EW & Lipman DJ (1990) Basic local alignment search tool J Mol Biol 215, 403–410 Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W & Lipman DJ (1997) Gapped blast and psi-blast: a new generation of protein database search programs Nucleic Acids Res 25, 3389–3402 Needleman SB & Wunsch CD (1970) A general method applicable to the search for similarities in the amino acid sequence of two proteins J Mol Biol 48, 443–453 Thompson JD, Higgins DG & Gibson TJ (1994) clustal w: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice Nucleic Acids Res 22, 4673–4680 Kawashima I, Ohsumi J, Mita-Honjo K, ShimodaTakano K, Ishikawa H, Sakakibara S, Miyadai K & Takiguchi Y (1991) Molecular cloning of cDNA encoding adipogenesis inhibitory factor and identity with interleukin-11 FEBS Lett 283, 199–202 Morris JC, Neben S, Bennett F et al (1996) Molecular cloning and characterization of murine interleukin-11 Exp Hematol 24, 1369–1376 Lutfalla G (2003) Tetraodon nigroviridis class I helical cytokines and their receptors EMBL accession no AY374508 Wang T, Ward M, Grabowski P & Secombes CJ (2001) Molecular cloning, gene organization and expression of rainbow trout (Oncorhynchus mykiss) inducible nitric oxide synthase (iNOS) gene Biochem J 358, 747–755 Hong S, Zou J, Crampe M, Peddie S, Scapigliati G, Bols N, Cunningham C & Secombes CJ (2001) The production and bioactivity of rainbow trout (Oncorhynchus mykiss) recombinant IL-1 beta Vet Immunol Immunopathol 81, 1–14 Zou J, Holland J, Pleguezuelos O, Cunningham C & Secombes CJ (2000) Factors influencing the expression of interleukin-1 beta in cultured rainbow trout (Oncorhynchus mykiss) leucocytes Dev Comp Immunol 24, 575–582 1147 ... genes involved in host defence against bacterial infection in rainbow trout (Oncorhynchus mykiss) , the gene -expression profile of bacterial-challenged rainbow trout was surveyed by means of suppression... player in the cytokine network and the host immune response to infection in fish Experimental procedures Cell lines and cell culture Four rainbow trout cell lines were used in these studies; the. .. 32739 Li R, Hartley L & Robb L (2001) Cloning of rat interleukin 11 and interleukin 11 receptor alpha chain and analysis of their expression in rat uterus in the periimplantation period Reproduction