in vitro and in vivo analyses of regulatory t cell suppression of cd8 t cells
In vitro and ex vivo effect of hyaluronic acid on erythrocyte flow properties pps
... aggregation of the in vitro experiments GP: acquisition, analysis and interpretation of data of erythrocyte deformability of the in vitro experiments RV and SP: protocol design and obtention of the ... revealed that HA produces alterations in the spectrin structure of the membrane cytoskeleton increasing the amount of strongly immobilized sites This result suggests that the increase in erythrocyte ... rigidity is related to a stiffening of the cytoskeleton However, as HA only interacts with the outer erythrocyte surface, we postulate that HA interaction results in a protein organizational perturbation...
- 7
- 221
- 0
Báo cáo khoa học: Insertion of the plant photosystem I subunit G into the thylakoid membrane In vitro and in vivo studies of wild-type and tagged versions of the protein doc
... C-terminus of PSI-G (Fig 1) These cassettes were both cloned into binary vectors under the control of the 35S promoter and terminator, and into vectors for in vitro transcription and translation ... 5¢-GCGGAGCTCAT GGCCACAAGCGCATCAGC-3¢ and 5¢-GCGGCATGCT CATTTTTCGAACTGCGGGTGGCTCCATCCAAAGAA GCTTGGGTCGTAT-3¢ (region encoding the Strep-tag, WSHPQFEK [19], underlined) Constructs containing a His- or Strep-tag ... with other proteins such as the PSI core Incorporation of tagged PSI-G into PSI Whilst it is evident that both C-terminally and looptagged PSI-G can insert into the thylakoid in vivo (Figs and...
- 9
- 422
- 0
báo cáo hóa học:" In vitro generation of cytotoxic and regulatory T cells by fusions of human dendritic cells and hepatocellular carcinoma cells" docx
... which Treg arise in vivo and exert their immunoregulatory effects remain to be defined and are the subject of intensive investigation In the present study, we first show that coculture of T cells ... naive T cells to differentiate into CTL with lytic activity against the HCC cells (Figure 3A and 3B) After hr coculture of the HCC cells with healthy donor's T cells stimulated by unirradiated ... supernatants in the generation of Treg in vitro is demonstrated in the present study, little is known about the impact of fusion cell vaccination on generating Treg The negative impact of fusion cell...
- 19
- 459
- 0
báo cáo hóa học:" Generation in vivo of peptide-specific cytotoxic T cells and presence of regulatory T cells during vaccination with hTERT (class I and II) peptide-pulsed DCs" pot
... present TAAgs, potency in stimulating T cell responses, stability of the phenotype following in vivo administration, the ability to migrate to sites of T cell activation and generation of CTLs Activated ... production of T cells that not recognize tumour cells in vivo based on this epitope [67-69] In contrast to these studies, the ability of our vaccination strategy to generate tetramer+ CD8 +T cells ... cycles of vaccination (the time point associated with the maximal tetramer + CD8+ response, in patients undergoing vaccination with class I peptides only),, in vitro cytotoxicity against both peptides...
- 23
- 439
- 0
Báo cáo y học: "Discrepancy between the in vitro and in vivo effects of murine mesenchymal stem cells on T-cell proliferation and collagen-induced arthritis" doc
... evaluation and to analysis of T- cell proliferation PM contributed to the design of the study and to manuscript preparation All authors contributed to interpretation of the data All authors read and ... potently inhibit in vitro T- cell proliferation in an IFN-g-dependent mechanism that involves NO and PGE2 These in vitro data, however, could not be extrapolated to an in vivo situation Neither ... summarized in Table Thus, overall, the results obtained with MSC treatment for CIA are inconclusive This is in contrast to transfer of Treg cells for the treatment of CIA When mice are injected with...
- 11
- 464
- 0
Báo cáo khoa học: "Comparative study on the in vitro and in vivo properties of two bovine herpesvirus-5 reference strains" pptx
... aim of the present study is to compare the in vitro and in vivo properties of these two BoHV-5 reference strains belonging to different subtypes Materials and methods Viruses and cell culture The ... immunological status of cattle In addition, in agreement with results presented elsewhere [36], latency was detected in all the animals infected with A663 strain and two out of four animals infected with ... CCA TCC ACA GTC TTC TG) Results In vitro characterization With the aim of performing an in vitro comparison between N569 and A663 BoHV-5 strains, their growth properties, lysis and infection...
- 8
- 366
- 0
Báo cáo y học: "In vitro and in vivo evaluation of a new active heat moisture exchange" potx
... difference in temperature between the dry and wet probe is related to the dryness of the gas [19] At the start of the measurements, we inserted the two probes in a solution of water plus ice to test the ... the study in a test lung with different ventilatory settings and temperatures, and in a group of patients with acute lung injury Methods Materials In addition to the Performer, The HMEs evaluated ... measures the actual gas temperature The wet probe is coated with cotton that is wet with sterile water The evaporation of the sterile water is proportional to the dryness of the gas, and so the difference...
- 8
- 360
- 0
In vitro and in vivo study of ABT 869 in treatment acute myeloid leukemia (AML) alone or in combination with chemotherapy or HDAC inhibitors insight into molecular mechanism and biologic characterization
... associated with poor outcome, but the prognosis of FLT3 activating point mutation remains inconclusive.5-7 FLT3-ITD mutations trigger strong autophosphorylation of the FLT3 kinase domain, and constitutively ... synergistic effects on inhibition of proliferation and induction of apoptosis To further validate findings in cell lines, patient samples with either FLT3-ITD (Pt#1, 2, 3), FLT3-D835Y point mutation ... cyclin E in MV4-11 cells at 4h, in MOLM-14 cells at 1h and cyclin D in MOLM-14 cells at 8h after drug exposure could be due to the fact that cells intended to progress to S phase at the early time...
- 121
- 368
- 0
In vitro and in vivo assessments of PCL TCP composites for bone tissue engineering
... minerals with the rest in the form of proteins Within the proteins in bone, the ratio of collagenous to noncollagenous stands at 9:1 This is in stark contrast with other tissues consisting of only ... discovery, more efforts were targeted at understanding the structure of heparin The first commercialisation of bovine lung and porcine intestinal heparin was carried out in Toronto and Stockholm Figure ... anticoagulant in the treatment of stroke and coronary artery disease 20 There are heparin binding sites in some growth factors which played an important role in their modulation of cell activities...
- 94
- 546
- 0
In vitro and in vivo characterisation of recombinant lactobacilli expressing house dust mite allergen
... saline TCR T cell receptor TGF Tumor Growth Factor Th T helper TNF Tumor Necrosis Factor Tr1 T regulatory cell Treg T regulatory TTFC tetanus toxin fragment C wt wildtype xix Chapter Introduction ... reactivity to other components in the extracts Besides, the long duration of treatment and the route of administration limit the patients’ compliance The standardisation of allergen extracts due to the ... with either recombinant Lactobacillus strain were protected against Blo t sensitisation by intraperitoneal injection with Blo t in alum as shown by the attenuation of Blo t 5-specific IgE, the...
- 193
- 613
- 0
In vitro and in vivo evaluation of customized polycaprolactone tricalcium phosphate scaffolds for bone tissue engineering
... structural integrity until the ingrowth of new tissue could adapt to the environment and excrete sufficient amount of extracellular matrix During this time, it 14 is expected of the scaffold to ... CHAPTER 4: OPTIMIZATION OF NATIVE AND CUSTOMIZED SCAFFOLDS IN VITRO AND THEIR EFFECTS IN INITIAL BONE HEALING 4.1 INTRODUCTION 44 4.1.1 In vitro degradation study 44 4.1.2 In vivo degradation study ... adhesion, the sealing zone This attachment involves the specific interaction between the cell membrane and some bone matrix proteins via integrins (transmembrane adhesion proteins mediating cellsubstratum...
- 143
- 472
- 0
In vitro and in vivo evaluation of transferrin conjugated lipid shell and polymer core nanoparticles for targeted delivery of docetaxel
... nonantibody ligands binding to specific receptors The active targeting strategy can be categorized into two groups: (i) the targeting of cancer cell (Figure 7B.1) and (ii) the targeting of tumoral ... are the challenging factors of targeting Tumor targeting can be classified into ―passive targeting‖ and ―active targeting‖ Active targeting cannot be separated from the passive because it occurs ... used in the first and secondline treatments of metastatic diseases The major mechanism contributing to their cytotoxicity against tumors remains unclear However, it is widely acknowledged that these...
- 129
- 286
- 0
In vitro and in vivo investigation of nanoparticles of a novel copolymer for substained and controlled delivery of docetaxel
... molecular structure The cytotoxic effect of cisplatin is mainly contributed from the platinum complexes which can bind and interact with the basic sites of DNA, resulting in DNA crosslinking (Lippert, ... system is the high probability of binding to endogenous proteins in the circulatory system The high-binding affinity of most commercial formulations to plasma proteins reduces the amount of free ... (GI) tract or RES After undergoing the metabolic process in vivo, the breakdown of the molecule into the corresponding constituents then restores the original bioactive form of the drug In other...
- 163
- 932
- 0
In vitro and in vivo study of vitamin e TPGs coated immunoliposomes for sustained and targeted delivery of docetaxel
... greater affinity for the β-tubulin binding site and greater uptake with slower efflux from the tumor cells, resulting in longer intracellular retention time and higher intracellular concentrations ... control over the cell cycle, adhesion with other tissues and interaction with the immune cells The two wide factors that cause the cancerous cells are the external factors and the internal factors ... to the β- subunit of tubulin in the microtubules rather than to tubulin dimers The binding site to tubulin differs from the one of vinca-alkaloids and podophyllotoxins While vincas inhibit polymerization...
- 121
- 326
- 0
Stability and in vivo evaluation of pullulan acetate as a drug nanocarrier
... the stability and toxicity of PANs, and further investigated the sustained release behavior in vivo of drug loading in PANs PA was firstly synthesized and characterized by FT-IR and 1H NMR, and ... Bioavailability (BA) is a measurement of the rate and extent of a therapeutically active drug that reaches the systemic circulation and is available at the site of action When a medication is administered ... preparation and a necessary step in the development process, it will indicate the potentiality of industry production The possibilities of modulating the loaded drug’s pharmacokinetic parameters...
- 7
- 391
- 0
Tài liệu Báo cáo Y học: Identification and characterization of the Escherichia coli stress protein UP12, a putative in vivo substrate of GroEL pptx
... acrylamide in the separating and stacking gels, respectively In order to estimate the ratio between the amounts of UP12 and the total amount of protein in the extracts, a series of samples containing ... dissociation of the complex strongly support the suggestion that the two stress proteins GroEL and UP12 interact with each other in vivo, and that this interaction might be physiologically relevant ... of the chaperonin GroEL In addition to its in vivo interaction with GroEL [27], it was shown that GatY aggregates at 42 °C in mutant cells containing a deletion for DnaK [35] Taken together, these...
- 9
- 548
- 0
Báo cáo khoa học: A steady-state modeling approach to validate an in vivo mechanism of the GAL regulatory network in Saccharomyces cerevisiae ppt
... quantifying strength of interactions; and (d) spatial localization of protein in a compartment or shuttling of proteins between compartments It is evident that a large number of parameters play ... enumerated various interactions resulting in a complex regulatory network Most of such studies demonstrate the in vitro interaction between the various components However, these in vitro experiments ... [11,23] The above two studies indicate the existence of following two contrasting in vivo mechanisms for GAL protein expression: (a) regulatory protein Gal3p translocates into the nucleus to bind to...
- 11
- 490
- 0
Báo cáo khoa học: In vivo studies of altered expression patterns of p53 and proliferative control genes in chronic vitamin A deficiency and hypervitaminosis pot
... and 5¢-TCTGAGTCCTTATCCAGC CTG-3¢ (reverse) corresponding to a region of the c-Jun promoter that expands between the start transcription site and the )504 position Statistics In the experiment shown ... single band of about 53 kDa was detected in liver and lung indicating that the amount of p53 protein was significantly increased in the liver and lung from vitamin A-deficient rats that in controls ... its downstream target, the cyclin-dependent kinase inhibitor p21WAF1/CIF1, suggesting that one particular function of c-Jun is the negative regulation of p53 transcription The fact that the binding...
- 9
- 508
- 0
Báo cáo khoa học: A study of microRNAs in silico and in vivo: bioimaging of microRNA biogenesis and regulation doc
... imaging systems that are used to create a better understanding of the production and function of miRNA in vivo as well as for monitoring the therapeutic potential of miRNAs in cancer Bioimaging of ... associated with the translational inhibition of target mRNAs by binding miRNA to the seed region of the target mRNA with noncomplementarity between the miRNA and its target Therefore, the 3¢-UTR-based ... down-regulated by specific miRNAs These targets were determined in vitro using a reporter gene system containing the 3¢-UTR of the targets located immediately after the stop codon of the luciferase...
- 10
- 463
- 0
Báo cáo khoa học: In vivo degradation of nitric oxide synthase (NOS) and heat shock protein 90 (HSP90) by calpain is modulated by the formation of a NOS–HSP90 heterocomplex pot
... inactivated As both the inactivation and fragmentation of calpastatin are known to be produced by active calpain [32], these observations further indicate that calpain is activated in both tissues, ... Fig In vivo digestion of NOS and HSP90 in NMS rats during HSD treatment Aliquots (20 lg protein) of rat brain soluble material (A) and aliquots (50 lg protein) of rat aorta total lysate (B), obtained ... pattern of calpastatin digestion, resulting in an imbalance within the proteolytic system [32]; and (c) the degradation of calpain target proteins [26,30] As shown in Fig 2A, following HSD treatment,...
- 11
- 344
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008