... 5¢-d(TCAGAAATTAAAGCGG ATGCATTATTTGCATG)-3¢ The upstream primer containing the NdeI restriction site (underlined) was: 5¢-d(GCTAGCATATGAAGCTTAAA AAAATTG)-3¢ and the downstream primer containing the ... primer 5¢-d(TATTTGCATGGCC AGCCCAATCTATTTGAG)-3¢; Gly262 to Ala, upper primer 5¢-d(ATAGATTGGGGTGCCCATGCAAATAA TGCA)-3¢, lower primer 5¢-d(ATTATTTGCATGGGCA CCCCAATCTATTTG)-3¢; Tyr269 to Ala, upper ... value almost 2.5-fold higher than the native cold adapted enzyme (Table 1) The mutant G26 1A/ Y26 9A exhibits an Ea almost the same as inthe case ofthe native enzyme (Table 1) Thermal inactivation...
... transmission ofa recombinant virus, ina hypothetical in vivo situation, from one rodent to another If transmission is performed ina samplinglike fashion – and this seems to be the case for hantaviruses ... recombination awaits further investigation Conclusion The data presented in this paper show that the recTULV presents no real match to the original cell adapted variant and that the lower fitness ofthe ... monitor thepresenceof TULV S RNA on passages, RT-PCR was performed with primers VF738 (5'GCCTGAAAAGATTGAGGAGTTCC3'; nt 738–760) and VR855 (5'TTCACGTCCTAAAAGGTAAGCATCA3'; nt 831–855) To monitor the...
... transmission ofa recombinant virus, ina hypothetical in vivo situation, from one rodent to another If transmission is performed ina samplinglike fashion – and this seems to be the case for hantaviruses ... recombination awaits further investigation Conclusion The data presented in this paper show that the recTULV presents no real match to the original cell adapted variant and that the lower fitness ofthe ... monitor thepresenceof TULV S RNA on passages, RT-PCR was performed with primers VF738 (5'GCCTGAAAAGATTGAGGAGTTCC3'; nt 738–760) and VR855 (5'TTCACGTCCTAAAAGGTAAGCATCA3'; nt 831–855) To monitor the...
... history of an esophagus carcinoma, a basal cell carcinoma, and a melanoma; another one suffered from a prostate and a bladder carcinoma, and one patient experienced a colon carcinoma and a basal cell ... oropharyngeal carcinoma, 12 showed hypopharyngeal carcinoma, and 22 had laryngeal carcinoma (Table 1) In 49 patients, cervical lymph node metastases were found while 42 patients showed no metastases ... future investigations Abbreviations ATM: ataxia telangiectasia-mutated protein kinase; ATR: ataxia telangiectasia and Rad3 related; BRCA1: breast cancer 1; CDC2 5A: cell division cycle 25 homolog A; ...
... Structural insights into the mechanochemical nature of a- CT catalysis A more detailed analysis ofthe inuence of chemical glycosylation on the dynamics of a- CT from the theoretical simulations was additionally ... on the kinetics of enzymatic catalysis from both an experimental and theoretical perspective Changes inthe kinetics of a- CT catalysis upon chemical glycosylation The catalytic behavior of a- CT ... these parameters Analysis ofthe changes in internal hydrogen bond composition for the protein-glycan conjugates indicates that for all ofthe conjugates there was also an increase in these internal...
... [13] Quantification ofthe data indicated that the cross-linking efficiency ofthe mutant nascent chains was somewhat reduced (Fig 3B) In conclusion, our results show an increased affinity ofthe G-10C ... using the PhoE forward primer (5¢-GCCGGAATTCTAATATGAAAAAGAGCACTCT GGC-3¢) and the 94PhoE reverse primer (5¢-CGCGGA TCCTTTTTGCTGTCAGTATCAC-3¢), pNN7 and pNN8 as the templates, respectively, and ... obtained by P1 transduction using strain CE1224 as the recipient and strains IQ85 and strain MM152, respectively, as donor strains To obtain strain CE1513, strain MM88 was used as Table Bacterial...
... presenceof 10 mM Ca2 + [23,35], indicating that the dominant effect ofthe Ca2 + concentration appears Fig Autocatalytic activation of trypsinogen by trypsin inthe absence or presenceof p-amindinobenzamidine ... which isa particular case ofthe activation of zymogens As the autocatalytic activation of zymogens plays a key role inthe regulation of many integrated metabolic systems in living organisms, a ... Gabeloteau showed that inthepresenceof calcium ions the autocatalytic activation of trypsinogen is quantitative and therefore calcium ions almost totally suppress hydrolysis of certain other...
... immediately created a false scenario of events in his head: his father’s car and wallet were stolen by a crazed carjacker who then crashed his father’s car Dad isn’t really dead; he’s probably wandering ... there is often a detached sensation, as if we are merely observing some strange drama from a distance After all, this can’t really be happening; this can’t be real But it is real Although the analogy ... after my fiancé, David, died,” says Katherine, “I began having dreams about him.” Katherine recalls one particular dream a visitation dream—that brought her a great deal of comfort Inthe dream,...
... perpendicular external magnetic field, both for the case ofa single potential kink, as well as for a kink-antikink pair One advantage of such a setup isthe fact that in an experimental realization of ... the sequence alignment and drafted the manuscript GAF contributed in analysis ofthe numerical results All authors read and approved the final manuscript Competing interests The authors declare ... either presenceof magnetic field (blue solid curves in panels (a, b)) The inset of panel (a) indicates that the wavespinors satisfy the a1 = ϕb3 and ϕb1 = − a3 relations at ky = and B0 = which leads...
... a soft consistency and had the gross appearance of adipose tissue Histological examination confirmed the diagnosis of fibrolipoma (Figure 3) Our patient was discharged the day after surgery and ... tube: a case report Journal of Medical Case Reports 2011 5:436 Conclusion To the best of our knowledge, this isthe first report ofa lipoma originating from the cartilaginous portion ofthe Eustachian ... surgical approach involving the Eustachian tube isa difficult procedure due to the regional anatomy Zollner [11] suggested a good approach to the tube via an open mastoid cavity, or at least the...
... his stomach His abdominal cavity was lavaged with copious warm saline, a drain placed adjacent to the gastrojejunostomy and a drain by the duodenal repair and his abdomen closed The drains were ... fistulas and intraabdominal abscesses were the main causes of morbidity [3] Most duodenal injuries can be managed by surgical repair [3] Non-operative management of duodenal perforations with intravenous ... abdominal trauma inthepresenceofa large pancreatic pseudocyst Minor blunt abdominal trauma ina normal healthy adult would not be expected to result in any significant duodenal injury We acknowledge...
... electrons inthe single (constant) scattering time approximation Then utilizing the similar way as in Ref [14] and performing the analytical calculation for the total current density we have the expression ... optical phonon interaction has been taken into account and the influence ofa strong EMW has been considered in details To make a comparison ofthe effect of different scattering mechanisms, in ... those in Fig In Fig we can see that the dependence ofthe HC on the amplitude E0 is nonlinear The HC parabolically increases with increasing amplitude E0 , also this dependence is stronger at small...
... in deviance or comparison of AIC values) were retained inthe analysis regardless of significance of individual variables within the domain This approach was taken as variables composing the different ... multilevel modeling, interpretation of data, and created the first draft ofthe manuscript EN was involved with the management of data, participated inthe analysis and interpretation of data, and provided ... to tailoring and packaging ofthe intervention materials ina user-friendly way, enhancing organizational capacity, establishing systems and rewards for implementation, providing training and...
... found inthe changes inthe British language teaching tradition Communicative Language Teaching (CLT) marks the beginning ofa major innovation within language teaching for its widely accepted principles ... to carry out a conversation inthe target language Additionally, inthe speaking class, if the right activities are taught inthe right way, speaking can be a lot of fun, raising general learner ... which lays great emphasis on four skills including listening, speaking, reading and writing and other subjects related to English theoretical linguistics The total time allocation and the training...
... Equally, internal patents can be licensed to other firms as a source of revenue (rather than, as is often the case, using it as a defence mechanism against another firm developing the same IP) Above ... total vertical integration: those who built the track also ran the trains But maintaining the infrastructure and looking after the passengers came eventually to be recognised as different businesses ... agree that the way they innovate today is significantly different from how they approached innovation a decade ago ● Open Innovation involves closer links with a growing number of external partners...