Báo cáo khoa học: Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding site on the catalytic domain doc

Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding site on the catalytic domain ˇ ˇ´ ´ ´ ˇ ´ Jozef Sevcık1, Eva Hostinova1, Adriana Solovicova1, Juraj Gasperık1, Zbigniew Dauter2 and Keith S Wilson3 Institute of Molecular Biology, Slovak Academy of Sciences, Bratislava, Slovakia Synchrotron Radiation Research Section, Macromolecular Crystallography Laboratory, NCI, Argonne, IL, USA York Structural Biology Laboratory, University of York, UK Keywords acarbose; glucoamylase; starch binding site; sugar tongs; X-ray structure Correspondence ˇ ˇı J Sevc´k, Institute of Molecular Biology, ´ ´ Slovak Academy of Sciences, Dubravska cesta 21, 84551 Bratislava, Slovakia Fax: +421 259307416 Tel: +421 259307435 E-mail: jozef.sevcik@savba.sk (Received 16 January 2006, revised 10 March 2006, accepted 15 March 2006) doi:10.1111/j.1742-4658.2006.05230.x Most glucoamylases (a-1,4-d-glucan glucohydrolase, EC 3.2.1.3) have structures consisting of both a catalytic and a starch binding domain The structure of a glucoamylase from Saccharomycopsis fibuligera HUT 7212 (Glu), determined a few years ago, consists of a single catalytic domain ˚ The structure of this enzyme with the resolution extended to 1.1 A and that ˚ of the enzyme–acarbose complex at 1.6 A resolution are presented here The structure at atomic resolution, besides its high accuracy, shows clearly the influence of cryo-cooling, which is manifested in shrinkage of the molecule and lowering the volume of the unit cell In the structure of the complex, two acarbose molecules are bound, one at the active site and the second at a site remote from the active site, curved around Tyr464 which resembles the inhibitor molecule in the ‘sugar tongs’ surface binding site in the structure of barley a-amylase isozyme complexed with a thiomaltooligosaccharide Based on the close similarity in sequence of glucoamylase Glu, which does not degrade raw starch, to that of glucoamylase (Glm) from S fibuligera IFO 0111, a raw starch-degrading enzyme, it is reasonable to expect the presence of the remote starch binding site at structurally equivalent positions in both enzymes We propose the role of this site is to fix the enzyme onto the surface of a starch granule while the active site degrades the polysaccharide This hypothesis is verified here by the preparation of mutants of glucoamylases Glu and Glm In addition to catalyzing the removal of b-d-glucose from the nonreducing ends of starch and other related poly and oligosaccharides, glucoamylase is able to degrade a-1,6-glucosidic linkages, although much less effectively The enzyme is produced by many moulds and yeasts The primary industrial use of glucoamylase is in the production of glucose and fructose syrups, which in turn serve as a feedstock for biological fermentations in the production of ethanol or in the production of high fructose sweeteners [1] Using the classification of glycoside hydrolases into nearly 100 families on the basis of sequence similarity, glucoamylase belongs to family 15 [2] (http://afmb.cnrs-mrs.fr/ CAZY/) The most thoroughly studied glucoamylase is that from Aspergillus awamori variety X100 The threedimensional structure of its catalytic domain has been described in detail at a range of pH [3,4] Subsequently, its interactions with different carbohydrate inhibitors were defined by the determination of Abbreviations ˚ ˚ ˚ Glu, glucoamylase structure at 1.7 A (1AYX); Glu-A, glucoamylase–acarbose complex at 1.6 A resolution; Glu1.1, glucoamylase at 1.1 A resolution FEBS Journal 273 (2006) 2161–2171 ª 2006 The Authors Journal compilation ª 2006 FEBS 2161 ˇ ˇı J Sevc´k et al Glucoamylase raw starch binding site Fig Sequences of glucoamylases Glu (upper line) and Glm (lower line) Identical residues are underlined Catalytic residues (Glu210, Glu456) are marked with an arrow Residues which represent the raw starch binding site (Arg15, His447, Asp450, Thr462, Tyr464) are in bold structures in complex with 1-deoxinojirimycin [5], acarbose [6] and d-gluco-dihydroacarbose [7,8] These structures define the positions of malto-oligosaccharide residues in at least the )1 and +1 subsites labeled according to the nomenclature proposed by [9] and identify interactions between substrates and active site amino acid side-chains The structure of the starch binding domain of A niger glucoamylase was solved by NMR in its native state [10] and in a complex with b-cyclodextrin [11] Crystal structures of an intact twodomain prokaryotic glucoamylase were determined from the clostridial species Thermoanaerobacterium thermosaccharolyticum with and without acarbose [12] In all of these enzymes the N-terminal starch binding domain has 18 antiparallel strands arranged in b-sheets of a super-b-sandwich, while the C-terminal catalytic domain is an (a ⁄ a)6 barrel Different strains of the dimorphous yeast Saccharomycopsis fibuligera produce a set of closely related glucoamylases Two of them, (Glu; strain HUT7212) and Glm (strain IFO 0111) from the GLU [13] and GLM [14] genes, consist of 492 and 489 amino acid residues, respectively, with a sequence identity of 60% and a similarity of 77%, Fig The two enzymes 2162 differ in biochemical properties, in particular in the ability to digest raw starch While Glu adsorbs to, but does not digest raw starch, Glm adsorbs well to starch granules and is capable of raw starch digestion The glucoamylases from Aspergillus niger and A awamori prefer longer malt-oligosaccharides as substrates, which is also the case for S fibuligera glucoamylases [15] The determination of the crystal structure of recom˚ binant glucoamylase Glu at 1.7 A resolution was reported earlier [16] The core of the enzyme is an (a ⁄ a)6 barrel known in SCOP nomenclature [17] as a six-helical hairpin toroid, and is closely similar to that of the catalytic domain of A awamori and T thermosaccharolyticum glucoamylases, with the active site at the narrower end of barrel There is no terminal starch-binding domain, and this is clearly also true for the closely related Glm, for which a homology model was proposed [14] Thus the S fibuligera glucoamylases Glu and Glm differ from the other characterized glucoamylases in that the raw-starch affinity site is an integral part of the single catalytic domain In this paper, two structures are described: that of the glucoamylase Glu with the resolution extended to FEBS Journal 273 (2006) 2161–2171 ª 2006 The Authors Journal compilation ª 2006 FEBS ˇ ˇı J Sevc´k et al ˚ 1.1 A (Glu1.1) and that of its complex with acarbose ˚ at 1.6 A resolution (Glu-A) One acarbose binds at the expected catalytic site, and we propose that the second site corresponds to the remote starch binding site Five residues (Arg15, His447, Asp450, Thr462 and Tyr464) which are important in the remote starch binding site in Glu are conserved in Glm (Arg15, His444, Asp447, Thr459 and Phe461) However, a key residue which is central for the remote acarbose binding is different in the two enzymes: Tyr464 in Glu versus Phe461 in Glm (Fig 1) To confirm that the remote binding site is essential for raw starch binding, the above amino acids were mutated and the mutants tested for their ability to adsorb to and digest raw starch Results and discussion Description of the structures There is one molecule in the asymmetric unit of both structures composed of a single domain consisting of 14 helices, 12 of them forming an (a ⁄ a6) barrel as expected from our previous native structure [16] The active site is at the narrower end of the barrel as mapped by the presence of ligands (Tris in Glu1.1 or acarbose in the Glu-A structure) Glucoamylase raw starch binding site Table Refinement statistics ESU, estimated standard uncertainty Glu-A Molecules in asymmetric unit R (%) Rfree (%) Model – atom sites Solvent molecules Glu1.1 12.0 16.0 3946 810 14.6 16.1 3853 949 13.7 13.4 17.8 ˚ Average B-values (A2) Protein atoms Tris Acarbose Phosphate anion Solvent molecules ˚ Wilson plot (A2) Coordinates ESU based ˚ on R ⁄ Rfree (A) ˚ rA error estimate (A) 12.7 ⁄ 33.1 32.0 33.2 15.6 0.117 ⁄ 0.077 0.04 33.5 10.4 0.033 ⁄ 0.031 0.02 Stereochemical restraints r.m.s (r) ˚ Bond distances (A) 0.011 (0.021) Bond angles (°) 1.609 (1.965) ˚ Chiral centers (A3) 0.159 (0.200) ˚ Planar groups (A) 0.015 (0.020) 0.007 1.204 0.079 0.008 (0.021) (1.939) (0.200) (0.020) B-factors restraints ˚ Main-chain bond (A2) ˚ Main-chain angle (A2) ˚ Side-chain bond (A2) ˚ Side-chain angle (A2) 0.838 1.389 1.812 2.684 (1.500) (2.000) (3.000) (4.500) 0.938 1.535 2.237 3.318 (1.500) (2.000) (3.000) (4.500) Accuracy of models As expected, the accuracy of the structure Glu1.1 at atomic resolution is higher than that of Glu-A or Glu The overall coordinate error for Glu1.1 and Glu-A estimated from the rA plot [18], estimated standard uncertainty (ESU) based on R and Rfree factors (the Cruickshank’s dispersion precision indicator DPI [19], and the average temperature factors for protein atoms, water molecules and ligands are given in Table The temperature factors are in good agreement with estimates from the Wilson plot [20] The Ramachandran plot [21] calculated by the program procheck [22] for Glu1.1 and Glu-A shows that in both structures, there are > 92% of residues in the most favored regions, the rest in additionally allowed regions except Ala339 and Ser357 which are in generously allowed regions The electron density for both residues in the two structures is clear and all mainchain atoms are well ordered, which confirms that the deviation of torsion angles from ideal geometry of these two residues is an intrinsic feature of the structure In Glu1.1 there is another residue, Ser305 in the generously allowed region This residue is part of the loop Gly302–Ser306, which is poorly ordered in this structure (see below) In both structures for most of the residues the x angle deviates significantly from planarity This is reflected in the G-factor calculated by procheck (Table 2) in which the x angles score for Glu1.1 and Glu-A has a value of )0.05 and )0.06, respectively, with 489 contributors This confirms that the peptide bond deviates from planarity by up to 20° as observed in a number of atomic resolution structures The average value for x angle in Glu1.1 and Glu-A structures Table G-factors calculated by PROCHECK Glu1.1 Dihedral angles (°) Phi–Psi distribution Chi1–Chi2 distribution Chi1 only Chi3 and Chi4 Omega Average score Main-chain covalent forces ˚ Main-chain bond lengths (A) Main-chain bond angles (°) Average score Overall average FEBS Journal 273 (2006) 2161–2171 ª 2006 The Authors Journal compilation ª 2006 FEBS Glu-A 0.15 0.02 0.13 0.51 )0.46 )0.05 0.15 0.02 0.10 0.32 )0.43 )0.06 0.63 0.44 0.52 0.18 0.56 0.39 0.46 0.15 2163 ˇ ˇı J Sevc´k et al Glucoamylase raw starch binding site is 179.6 and 179.5, respectively, with rmsd of 5.7° in both The Glu-A structure The Glu-A structure was refined to a low R factor (Table 1) and the electron density is clear through the whole structure While the Gly302-Ser306 loop has an ˚ average temperature factor of 26 A2, compared with ˚ an average value for the whole protein of 13.7 A2, the electron density is considerably better in comparison to the Glu1.1 structure This is due to the close proximity of a phosphate anion (sodium phosphate buffer was used in purification) which fills the gap between the loop and the rest of the protein (Fig 2B) forming a number of direct and water-mediated hydrogen bonds One of the phosphate oxygen atoms forms hydrogen bonds with a water molecule which belongs to the cluster of water molecules and the Asp379 carboxyl liganded to a Na+ ion Another Na+ ion, surrounded by five water molecules is bound to Ile177 carbonyl All distances between the Na+ and the sur˚ rounding oxygen ligands are close to 2.42 A, the average distance observed in a set of protein structures [23] Superposition of the Glu-A and Glu1.1 structures gives r.m.s and maximum displacement of 0.47 and ˚ 4.47 A, respectively Glu-A differs from Glu1.1 mainly in the loop Ser9-Asn10-Tyr11-Lys12-Val13-Asp14Arg15-Thr16 where the differences between CA atoms ˚ are up to 4.5 A (at Asn10) This conformational change is caused by Arg15 which moves (CA moves ˚ 1.2 A) in order to interact with the acarbose sugar +1 causing reorientation of the whole loop The Glu1.1 structure The Glu structure (1AYX) was described in detail previously Superposition of the structures Glu1.1 and Glu based on all CA atoms, calculated by the program lsqkab, shows that the two structures are nearly iden˚ tical with rmsd 0.38 A The maximum deviation ˚ ) does not represent any important difference (3.63 A as it relates to the C-terminal residue Omitting 16 atoms from the surface loops for which deviation was ˚ ˚ above A, the rmsd falls to 0.32 A The superposition reveals that the molecule contracts on cryo-cooling with the surface regions being shifted towards the cen˚ tre by 0.3 A, keeping the central part of the molecule intact This is reflected in the unit cell volume which is ˚ ˚ 510 156 A3 at 292 K but falls to 479 022 A3 at 110 K Some of the residues poorly determined in the Glu structure became clearer in the Glu1.1 and all six residues with two conformations in Glu have a single conformation in Glu1.1 Inspection of the Glu1.1 electron density shows that it is very clear in the entire molecule with only a single conformation for each residue suggesting that the molecule has a rigid fold Nevertheless the segment Gly302-Glu303-Ser304-Ser305-Ser306 located at the opposite end of the barrel to the active site has weaker electron density and the temperature factors of the ˚ atoms in this segment are 31 A2, 2.35 times above the average B for the structure The high flexibility of this loop does not appear to be connected with the catalytic function One explanation lies in the fact that the loop protrudes from the surface of the molecule and does not form any additional contacts with the molecule A 2164 Catalytic site The catalytic reaction of glucoamylases proceeds with inversion of configuration at the anomeric carbon which requires a pair of carboxylic acids at the active B Fig Glu with two acarbose molecules and a phosphate anion The anion is hidden below the active site acarbose in (A), but is clearly visible in (B) The two views are related by rotation around y-axis by 90° (drawn using MOLSCRIPT [50]) FEBS Journal 273 (2006) 2161–2171 ª 2006 The Authors Journal compilation ª 2006 FEBS ˇ ˇı J Sevc´k et al site, one acting as general acid and the other as general base [24] The mechanism of hydrolysis consisting of three steps involves proton transfer to the glycosidic oxygen of the scissile bond from a general acid catalyst, formation of oxocarbenium ion and a water-assisted nucleophilic attack by a general base catalyst [24– 27] In the glucoamylase from A awamori and A niger Glu179 was identified as the general acid and Glu400 as the general base [4–6,28,29] Superposition of the A avamori and A niger structures with those of S fibuligera glucoamylase complexes with Tris and acarbose shows that the corresponding residues are Glu210, general acid and Glu456, general base In the Glu-A and Glu1.1 structures the distances between the ˚ CA atoms of these two residues are 14.8 and 14.7 A and the shortest distances between the two carboxyl ˚ groups are 7.3 and 7.6 A, respectively The carboxyl ˚ groups can easily adopt a distance of 9.2 A, typical for inverting glycoside hydrolysis [24,30,31] In the active site of the native Glu1.1 there is a Tris molecule which forms direct hydrogen bonds with Arg69, Asp70 and one bond, mediated by a water molecule, with Glu210 Hydrogen bonds formed between the enzyme and Tris are the same as observed previously [16] In the Glu-A complex there are two acarbose molecules: one in the active site and the other on the sur˚ face of the enzyme about 25 A away, Fig The active site acarbose fits tightly into the pocket (Fig 3) and the electron density for all the acarbose atoms is very clear (Fig 4A) The acarbose has a well-defined conformation that corresponds to that observed in the complex with the fungal glucoamylase from A awamori var X100 at pH [8] The sugars )1 and +1, labeled according to the nomenclature proposed by [9], form several hydrogen bonds with the enzyme and confirm the identity of the active site residues Sugars +2 and +3 not form any hydrogen bonds with the Glucoamylase raw starch binding site Fig Electron density for (A) the active site and (B) the remote surface acarbose (drawn using BOBSCRIPT [51]) enzyme, however, they stack nicely against the aromatic rings of Tyr351 and Trp139, respectively The distances between the sugars and the aromatic rings of ˚ the two residues are 4 A The mode of acarbose binding to the active site readily explains the exoglucanase activity Raw starch binding site The electron density for the surface acarbose (Fig 4B), is not as clear as that for the active site acarbose, suggesting a higher mobility or a reduced occupancy, probably caused by a neighboring molecule at a dis˚ tance of about 3.5 A This is reflected in the average ˚ temperature factors which are 33 A2 for the surface Fig Hydrogen bonds formed by acarbose with the active site residues in stereo The catalytic residues are Glu210 and Glu456 (drawn using MOLSCRIPT) FEBS Journal 273 (2006) 2161–2171 ª 2006 The Authors Journal compilation ª 2006 FEBS 2165 ˇ ˇı J Sevc´k et al Glucoamylase raw starch binding site analogue, methyl 4¢,4¢¢,4¢¢¢-trithiomaltotetraoside [32,33] and a true oligosaccharide substrate [34] A similar situation was seen in the structure of the amylomaltase–acarbose complex [35,36] in which the acarbose molecule winds around Tyr54 However, in those structures the raw starch binding site is not part of the catalytic but is located on a separate domain Mutations at the remote ligand binding site Fig A space filling model showing the complex of glucoamylase with acarbose Both acarbose molecules are in yellow Tyr464 is in green, Asp450 in red and Arg15 in blue The rest of residues interacting with the surface acarbose are hidden below it ˚ acarbose in contrast to the 13 A2 for the active site ligand The surface acarbose in the Glu-A structure, which we propose to correspond to a raw starch binding site, is localized in the crevice formed by Arg15, His447, Asp450, Thr462, Tyr464 and Ser465 There are six H-bonds between this remote acarbose and the enzyme, two direct, His447 ND1 – O3 (+ 2), Thr462 O – O2 (+ 2) and four mediated through one or two water molecules, Asp450 N–W – O3 (+ 1), Asp450 OD1–W – O2 ()1), Asn451 N–W–W-O4 ()1), Ser465 N–W – O3 (+ 1) The second sugar ring of the acarbose stacks against the planar Arg15 guanidino group A space-filling model of glucoamylase with both acarbose molecules is shown in Fig The surface acarbose is curved around Tyr464 in the form of a semicircle (Fig 6) and captures the inhibitor molecule as seen in the ‘sugar tongs’ binding site in barley a-amylase isozyme complexed with the substrate To verify the hypothesis that the site on the Glu surface interacting with acarbose represents the starch binding site, the point mutants R15A, H447A, T462A and a double mutant H447A, D450A were prepared and tested for affinity to starch Two approaches were used: adsorption of enzymes in a test tube assay on a native granular starch and mobility of enzymes in native gels with and without copolymerized boiled granular starch Adsorption of the wild-type Glu, its mutants and Glm in test tube experiments is presented in Fig The results show that affinity of Glu to native raw starch was observed only at a high raw starch–enzyme ratio: at a ratio of 100 mg raw starch)50 lg Glu only 10% of the enzyme was bound Under the same conditions, > 95% of the wild-type Glm was bound The Glu mutants did not bind at all The electrophoretic mobility of Glu and its mutants are presented in Fig In a standard native gel (Fig 8A) the Glu and its mutants move to nearly the same position while in the gel with a copolymerized boiled granular starch (Fig 8B) all Glu mutants move significantly faster indicating that their affinity to the gel matrix is lower As documented in our previous work [37], a similar situation was found with the raw starch degrading Glm The Glm H444A, D447A mutant in the gel containing starch moved faster than wild-type Glm because of its impaired affinity towards the substrate The changes in electrophoretic mobility of native and Fig Stereo picture of the surface acarbose curved around Tyr464 and the interacting partners Arg15, His447, Asp450 and Thr462 drawn using MOLSCRIPT 2166 FEBS Journal 273 (2006) 2161–2171 ª 2006 The Authors Journal compilation ª 2006 FEBS ˇ ˇı J Sevc´k et al Glucoamylase raw starch binding site tion H444A, D447A retained specific activity on soluble starch identical but caused significant reduction of raw starch hydrolysis (to 12%) in comparison with the wild-type enzyme Conclusions Fig Adsorption to raw starch of Glu and R15A, H447A, T462A, H447A + D450A mutants (A) and Glm (B) (n, wild types; d, mutants) Enzyme at a level ranging from 0.01 to 0.5 mg were added to a suspension of 100 mg of raw corn starch in mL of 0.05 M sodium acetate, pH 5.6 (Glu) and pH 4.5 (Glm) The amount of bound protein was calculated from the differences between the initial enzyme activity and the free enzyme activity after binding The structures of the glucoamylases from S fibuligera belong to family 15 of the glycoside hydrolases Most of the currently characterized family members have a two-domain structure, the small domain playing the role of binding the enzyme to starch, allowing the larger catalytic domain to hydrolyze the starch substrate We showed previously that the S fibuligera Glu enzyme lacked the independent starch binding domain while the catalytic domain was very similar to that of other family 15 members The close similarity in sequence of the Glm enzyme indicated that it too lacked the binding domain, and the modeled structure was like that of Glu with a single domain Our present work has improved the resolution of the native Glu structure, but has in addition revealed the presence of a second acarbose (substrate analogue) ˚ binding site on the surface of the enzyme, 25 A remote from the catalytic site The key residues involved in the binding at this remote site have been mutated, and the mutants shown to have greatly reduced starch binding properties These results strongly support the hypothesis that the S fibuligera glucoamylases have evolved a starch binding site on the catalytic domain quite distinct from that seen in other family 15 glycoside hydrolases Experimental procedures In vitro mutagenesis A B Fig Native PAGE without (A) and with boiled granular starch (B) of Glu Lanes 1,6, wt enzyme; lanes 2,7, mutant R15A; lanes 3,8, mutant H447A; lanes 4,9, double mutant H447A, D450A; lanes 5,10 mutant T462A mutant glucoamylases demonstrate that mutations of the amino acids proposed to be involved in binding of the surface acarbose caused reduction of enzyme adsorption on starch, proving that these amino acids are involved in starch binding site in spite differing in a key residue – Tyr464 in Glu versus Phe461 in Glm Biochemical analysis has shown that the double muta- Site-directed mutagenesis was performed by QuickChangeTM site-directed mutagenesis kit (Stratagene, La Jolla, USA) Plasmid pVT100L-Glu [38] was used as a template The following oligonucleotides were used: GLU R15A forward (5¢-ATTCAAACTATAAAGTTGACGCAA CTGACTTGGAAACCTTC-3¢), GLU R15A reverse (5¢GAAGGTTTCCAAGTCAGTTGCGTCAACTTTATAGTT TGAAT-3¢); GLU H447A forward (5¢- GCAAGTCATTT TGGATGCTATTAATGATGATGGCTC-3¢), GLU H447A reverse (5¢- GAGCCATCATCATTAATAGCATCCAAAA TGACTTGC-3¢); GLU T462A forward (5¢- GAACAACTT AACAGATATGCCGGTTATTCCACCGGTGCC-3¢), GLU T462A reverse (5¢- GGCACCGGTGGAATAACCGGCA TATCTGTTAAGTTGTTC-3¢); GLU H447A, D450A forward (5¢-GCAAGTCATTTTGGATGCTATTAATGCTG ATGGCTCCTTGAATGAAC-3¢), GLU H447A, D450A FEBS Journal 273 (2006) 2161–2171 ª 2006 The Authors Journal compilation ª 2006 FEBS 2167 ˇ ˇı J Sevc´k et al Glucoamylase raw starch binding site reverse (5¢-GTTCATTCAAGGAGCCATCAGCATTAAT AGCATCCAAAATGACTTGC-3¢) All mutations were verified by DNA sequencing Glucoamylase Glu Enzyme preparation and purification The recombinant glycosylated glucoamylases were prepared in Saccharomyces cerevisiae AH22 as described previously [14,38] Yeast transformants were grown in medium containing 1% yeast extract, 2% peptone, 2% glucose, for 48 h Proteins which showed electrophoretic homogeneity were obtained from extracellular media after ultrafiltration through Amicon PM-30 membrane, molecular sieving chromatography on Superose 12P and ion exchange chromatography on FQ (both from Amersham Bioscience, Vienna, Austria) Polyacrylamide gel electrophoresis Polyacrylamide gel electrophoresis was performed under native conditions Concentration gel was omitted Two types of gels were used: (1) Standard 10% polyacrylamide gel: 1.25 mL of 1.5 m TrisHCl buffer, pH 8.8, 1.45 mL of water, 2.2 mL of acrylamide solution (30%), 60 lL of 10% ammonium persulfate solution and 2.5 lL N,N,N¢,N¢-tetramethylethylendiamine (TEMED) were mixed together (2) Polyacrylamide gel (7.5%) with copolymerized boiled granular corn starch: a suspension of 37.5 mg of starch in 1.25 mL of 1.5 m TrisHCl buffer, pH 8.8, and mL of water was boiled for and after cooling to room temperature, 1.65 mL of acrylamide solution (30%), 60 lL of 10% ammonium persulfate solution and 2.5 lL TEMED were added The positions of glucoamylases were detected with Coomassie Brilliant Blue R-250 staining (Merck, Darmstadt, Germany) Crystallization, data collection and processing The recombinant nonglycosylated Glu was prepared essentially as reported in [39] The enzyme was crystallized from a protein solution of 10 mgỈmL)1 in 50 mm acetate buffer at pH 5.4 and 15% PEG 8K, as described earlier [40] Protein for preparation of the glucoamylase–acarbose complex was isolated in the same way as before, but Tris was replaced by sodium phosphate buffer to avoid Tris binding at the active site Native crystals of the enzyme were prepared as above and then lL of the mother liquor enriched by acarbose at a concentration of 10 mm was added to drops (5 lL) containing native crystals a few days before data collection X-ray data from native and complex crystals were collec˚ ted at 110 K on EMBL beam lines BW7B to 1.1 A and ˚ resolution, respectively, at the DORIS storage X11–1.6 A ring (DESY, Hamburg, Germany) Each data set was collected from a single crystal with a MAR Research (Hamburg, Germany) imaging plate scanner and processed with denzo and scalepack [41] A summary of data collection and processing is given in Table Structure determination and refinement All subsequent calculations were performed with programs from the CCP4 package [42] unless otherwise indicated As ˚ the unit cell parameters of glucoamylase at 1.1 A resolution (Glu1.1) and the glucoamylase–acarbose complex (Glu-A) Table Data statistics Values in parentheses refer to the highest resolution shell Raw starch binding assay The purified enzymes, in amounts of 0.01–0.5 mg mL)1 protein, were added to a suspension of 100 mg of raw corn starch in mL of 0.05 m sodium acetate at pH 5.6 and 4.5 for Glu and Glm, respectively, which are optimal values for soluble starch hydrolysis The mixture was gently stirred for h at +4 °C After centrifugation at 13 000 g for min, the protein content expressed as enzyme activity of the supernatant was assayed The amount of the bound protein was calculated from the difference between the initial enzyme activity and the free enzyme activity in the supernatant after binding Enzyme activity Glucoamylase activity was determined in the reaction mixture containing 0.9% Leulier soluble starch in 0.05 m 2168 sodium acetate, pH 5.6 and 4.5 for Glu and Glm, respectively, incubated with enzyme at 40 °C for 15 An increment of glucose was measured as described previously [14] Glu-A EMBL-Hamburg X-ray source ˚ Wavelength (A) Temperature (K) ˚ Resolution range (A) Space group Cell parameters ˚ a (A) ˚ b (A) ˚ c (A) Unique reflections Completeness (%) R(I)mergea (%) I ⁄ r(I) a Glu1.1 Beamline X11 Beamline BW7B 0.9096 100 10–1.6 (1.62–1.60) P212121 0.834 100 15–1.1(1.12–1.10) P212121 56.6 85.3 97.5 59266 94.5 (85.8) 4.3 (14.4) 17.5 (4.2) 56.9 85.7 98.2 184868 93.5 (84.8) 5.9 (15.3) 16.9 (2.4) R(I)merge ¼ Sh Si |Ii–| ⁄ Sh SiI FEBS Journal 273 (2006) 2161–2171 ª 2006 The Authors Journal compilation ª 2006 FEBS ˇ ˇı J Sevc´k et al were slightly different from those of Glu (1AYX), molecular replacement molrep [43], was used to position the model in the new cells Both structures were refined with the program refmac [44] against 95% of the data with the remaining 5% randomly excluded for cross-validation using the free R factor (Rfree) [45] All data were included in the final refinement step After each refinement step, ARP [46] was used for modeling and updating the solvent structure The Glu1.1 and Glu-A structures were initially refined with isotropic temperature factors and in the later stages with anisotropic temperature factors including the contributions from the hydrogen atoms Hydrogen atoms were generated according to established geometrical criteria on their parent C, N and O atoms The temperature factors of the hydrogen atoms were set equal to those of their parent atom Isotropic and anisotropic temperature factors, bond lengths, and bond angles were restrained according to the standard criteria employed by refmac Occupancies of water molecules were set to unity and not refined The models were adjusted manually between refinement cycles on the basis of (3Fo-2Fc, ac) and (Fo–Fc, ac) maps using the programs o [47] and xtalview [48] The refinement statistics are given in Table Glucoamylase Glm Modeling of the structure A model of the glucoamylase Glm structure was generated using the modeller w4 package [49] using the known structure of glucoamylase Glu and the sequence similarity between the two enzymes [14] Data Bank accession numbers The atomic coordinates have been deposited in the Protein Data Bank for Glu-A (2F6D) and Glu1.1 (2FBA) GenBank accession no(s) M17355 and AJ311587 belong to GLU and GLM genes, respectively Acknowledgements This work was supported by Howard Hughes Medical Institute grant no 75195–574601 and the grants ⁄ 0101 ⁄ 03 and ⁄ 1010 ⁄ 96 awarded by the Slovak Grant Agency VEGA References Saha BC & Zeikus JG (1989) Microbial glucoamylases: biochemical and biotechnological features Starch 41, 57–64 Henrissat B (1991) A classification of glycosyl hydrolases based on amino acid sequence similarities Biochem J 280, 309–316 Glucoamylase raw starch binding site Aleshin AE, Golubev A, Firsov LM & Honzatko RB (1992) Crystal structure of glucoamylase from Aspergil˚ lus awamori var X100–2.2 A resolution J Biol Chem 267, 19291–19298 Aleshin AE, Hoffman C, Firsov LM & Honzatko RB (1994a) Crystal structure of glucoamylase from Aspergil˚ lus awamori var X100–2.2 A resolution J Mol Biol 238, 575–591 Harris EMS, Aleshin AE, Firsov LM & Honzatko RB (1993) Refined structure for the complex of 1-deoxynojirimycin with glucoamylase from Aspergillus awamori ˚ var X100–2.4 A resolution Biochemistry 32, 1618–1626 Aleshin AE, Firsov LM & Honzatko RB (1994b) Refined structure for the complex of acarbose with glu˚ coamylase from Aspergillus awamori var X100–2.4 A resolution J Biol Chem 269, 15631–15639 Stoffer B, Aleshin AE, Firsov LM, Svensson B & Honzatko RB (1995) Refined structure for the complex of d-gluco-dihydroacarbose with glucoamylase from Asper˚ gillus awamori var X100–2.2 A resolution: dual conformations for extended inhibitors bound to the active site of glucoamylase FEBS Lett 358, 57–61 Aleshin AE, Stoffer B, Firsov LM, Svensson B & Honzatko RB (1996) Crystallographic complexes of glucoamylase with maltooligosaccharide analogs: relationship of stereochemical distortions at the nonreducing end to the catalytic mechanism Biochemistry 35, 8319–8328 Davies GJ, Wilson KS & Henrissat B (1997) Nomenclature for sugar-binding subsites in glycosyl hydrolases Biochem J 321, 557–559 10 Sorimachi K, Jacks AJ, Le Gal-Coeffet MF, Williamson ă G, Archer DB & Williamson MP (1996) Solution structure of the granular starch binding domain of glucoamylase from Aspergillus niger by nuclear magnetic resonance spectroscopy J Mol Biol 259, 970–987 11 Sorimachi K, LeGal-Coeffet MF, Williamson G, Archer ă DB & Williamson MP (1997) Solution structure of the granular starch binding domain of Aspergillus niger glucoamylase bound to beta-cyclodextrin Structure 5, 547–661 12 Aleshin AE, Feng PH, Honzatko RB & Reilly PJ (2003) Crystal structure and evolution of a prokaryotic glucoamylase J Mol Biol 327, 61–73 13 Itoh T, Ohtsuki L, Yamashita I & Fukui S (1987) Nucleotide sequence of the glucoamylase gene GLU1 in the yeast Saccharomycopsis fibuligera J Bacteriol 169, 4171– 4176 ´ ´ 14 Hostinova E, Solovicova A, Dvorsky R & Gasˇ perı´ k J ´ (2003) Molecular cloning and 3D structure prediction of the first raw-starch-degrading glucoamylase without a separate starch-binding domain Arch Biochem Biophys 411, 189–195 ´ ´ 15 Solovicova A, Christensen T, Hostinova E, Gasˇ perı´ k J, ˇ ˇ Sevcı´ k J & Svensson B (1999) Structure–function FEBS Journal 273 (2006) 2161–2171 ª 2006 The Authors Journal compilation ª 2006 FEBS 2169 ˇ ˇı J Sevc´k et al Glucoamylase raw starch binding site 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 relationships in glucoamylases encoded by variant Saccharomycopsis fibuligera genes Eur J Biochem 264, 756– 764 ˇ ˇ ´ ´ Sevcı´ k J, Solovicova A, Hostinova E, Gasˇ perı´ k J, Wilson KS & Dauter Z (1998) Structure of glucoamylase ˚ from Saccharomycopsis fibuligera at 1.7 A resolution Acta Cryst D54, 854–866 Lo Conte L, Ailey B, Hubbard TJ, Brenner SE, Murzin AG & Chothia C (2000) SCOP: a structural classification of proteins database Nucleic Acids Res 28, 257–259 Read RJ (1986) Improved Fourier coefficients for maps using phases from partial structures with errors Acta Cryst A42, 140–149 Cruickshank DWJ (1996) Macromolecular Refinement In Proceedings of the CCP4 Study Weekend (EJ Dodson, M Moore, A Ralph & S Bailey, eds), pp 11–23 SERC Daresbury Laboratory, Warrington, UK Wilson AJC (1942) Determination of absolute from relative X-ray data intensities Nature 150, 151–152 Ramakrishnan C & Ramachandran GN (1965) Stereochemical criteria for polypeptide and protein chain conformations II Allowed conformations for a pair of peptide units Biophys J 5, 909–933 Morris AL, Macarthur MW, Hutchinson EG & Thornton JM (1992) Stereochemical quality of protein structure coordinates Proteins 12, 345–364 Harding MM (2002) Metal-ligand geometry relevant to proteins and in proteins: sodium and potassium Acta Cryst D58, 872–874 McCarter JD & Withers SG (1994) Mechanisms of enzymatic glycoside hydrolysis Curr Opin Struct Biol 4, 885–892 Sinnott ML (1990) Catalytic mechanism of enzymic glycosyl transfer Chem Rev 90, 1171–1202 Konstantinidis A & Sinnot ML (1991) The interaction of 1-fluoro-d-glucopyranosyl fluoride with glucosidases Biochem J 279, 587–593 Tanaka Y, Tao W, Blanchard JS & Hehre EJ (1994) Transition-state structures for the hydrolysis of alpha-dglucopyranosyl fluoride by retaining and inverting reactions of glycosylases J Biol Chem 269, 32306–32312 Sierks MR, Ford C, Reilly PJ & Svensson B (1990) Catalytic mechanism of fungal glucoamylase as defined by mutagenesis of Asp176, Glu179 and Glu180 in the enzyme from Aspergillus awamori Protein Eng 3, 193– 198 Svensson B, Clarke AJ, Svendsen I & Moller H (1990) Identification of carboxylic acid residues in glucoamylase G2 from Aspergillus niger that participate in catalysis and substrate binding Eur J Biochem 188, 29–38 Davies GJ & Henrissat B (1995) Structures and mechanisms of glycosyl hydrolases Structure 3, 853–859 White A & Rose DR (1997) Mechanism of catalysis by retaining beta-glycosyl hydrolases Curr Opin Struct Biol 7, 645–651 2170 32 Robert X, Haser R, Svensson B & Aghajari N (2002) Comparison of crystal structure of barley alphaamylase and 2: implications for isozyme differences in stability and activity Biologia (Bratislava) 57 (Suppl 11), 59–70 33 Robert X, Haser R, Gottshalk TE, Ratajczak F, Driguez H, Svensson B & Aghajari N (2003) The structure of barley alpha-amylase isozyme reveals a novel role of domain C in substrate recognition and binding: a pair of sugar tongs Structure 11, 973–984 34 Robert X, Haser R, Mori H, Svensson B & Aghajari N (2005) Oligosaccharide binding to barley a-amylase J Biol Chem 280, 32968–32978 35 Przylas I, Terada Y, Fujii K, Takaha T, Saenger W & Strater N (2000) X-ray structure of acarbose bound to ă amylomaltase from Thermus aquaticus: implications for the synthesis of large cyclic glucans Eur J Biochem 267, 6903–6913 36 Strater N, Przylas I, Saenger W, Terada Y, Fuji K & ă Takaha T (2002) Structural basis of the synthesis of large cycloamyloses by amylomaltase Biologia (Bratislava) 57 (Suppl 11), 93–99 ˇ ˇ ´ 37 Gasˇ perı´ k J, Hostinova E & Sevcı´ k J (2005) Acarbose binding at the surface of Saccharomycopsis fibuligera glucoamylase suggests the presence of a raw starchbinding site Biologia (Bratislava) 60 (Suppl 16), 177–180 ´ 38 Gasˇ perı´ k J & Hostinova E (1993) Glucoamylases encoded by variant Saccharomycopsis fibuligera genes: structure and properties Curr Microbiol 27, 11–14 ´ ´ 39 Solovicova A, Gasˇ perı´ k J & Hostinova E (1996) Highyield production of Saccharomycopsis fibuligera glucoamylase in Escherichia coli, refolding, and comparison of the nonglycosylated and glycosylated enzyme forms Biochem Biophys Res Com 224, 790–795 ˇ ˇ ´ ´ 40 Solovicova A, Gasˇ perı´ k J, Sevcı´ k J & Hostinova E (1997) Crystallization and preliminary X-ray analysis of the Saccharomycopsis fibuligera glucoamylase expressed from the GLU1 gene in Escherichia coli Acta Cryst D53, 782–783 41 Otwinowski Z & Minor W (1997) Processing of X-ray diffraction data collected in oscillation mode Methods Enzymol 276, 307–326 42 Collaborative Computational Project, Number (1994) The CCP4 Suite: Programs for Protein Crystallography Acta Cryst D50, 760–763 43 Vagin A & Teplyakov A (1997) MOLREP: an automated program for molecular replacement J Appl Cryst 30, 1022–1025 44 Murshudov GN, Vagin A & Dodson EJ (1997) Refinement of macromolecular structures by the maximumlikelihood method Acta Cryst D53, 240–255 45 Brunger AT (1993) Assessment of phase accuracy by ă cross validation: the free R value: methods and applications Acta Cryst D49, 24–36 FEBS Journal 273 (2006) 2161–2171 ª 2006 The Authors Journal compilation ª 2006 FEBS ˇ ˇı J Sevc´k et al 46 Lamzin VS & Wilson KS (1997) Automated refinement for protein crystallography Methods Enzymol 277, 269– 305 47 Jones TA, Zou JY, Cowan SW & Kjeldgaard M (1991) Improved methods for building protein models in electron density maps and the location of errors in these models Acta Cryst A47, 110–119 48 McRee DE (1993) Practical Protein Crystallography Academic Press, Inc., San Diego, New York, Boston, London, Sydney, Tokyo, Toronto Glucoamylase raw starch binding site 49 Sali A, Potterton L, Yuan F, van Vlijmen H & Karplus M (1995) Evaluation of comparative protein modeling by MODELLER Proteins: Struct Funct Genet 23, 318– 326 50 Kraulis PJ (1991) MOLSCRIPT: a program to produce both detailed and schematic plots of protein structures J Appl Cryst 24, 946–950 51 Esnouf RM (1999) Further additions to Molscript, Version 1.4 including reading and contouring of electrondensity maps Acta Cryst D55, 938–940 FEBS Journal 273 (2006) 2161–2171 ª 2006 The Authors Journal compilation ª 2006 FEBS 2171 ... GLU R1 5A forward (5¢-ATTCAAACTATAAAGTTGACGCAA CTGACTTGGAAACCTTC-3¢), GLU R1 5A reverse (5¢GAAGGTTTCCAAGTCAGTTGCGTCAACTTTATAGTT TGAAT-3¢); GLU H44 7A forward (5¢- GCAAGTCATTT TGGATGCTATTAATGATGATGGCTC-3¢),... form any additional contacts with the molecule A 2164 Catalytic site The catalytic reaction of glucoamylases proceeds with inversion of configuration at the anomeric carbon which requires a pair of. .. H44 7A reverse (5¢- GAGCCATCATCATTAATAGCATCCAAAA TGACTTGC-3¢); GLU T46 2A forward (5¢- GAACAACTT AACAGATATGCCGGTTATTCCACCGGTGCC-3¢), GLU T46 2A reverse (5¢- GGCACCGGTGGAATAACCGGCA TATCTGTTAAGTTGTTC-3¢);