gt a5 viral dna crna and vrna exhibit a gradient of hypermutation after replication in cem cells
Báo cáo y học: " Human endogenous retrovirus HERV-K(HML-2) encodes a stable signal peptide with biological properties distinct from Rec" pps
... previously characterized in Rec, a putative arginine-rich nuclear localization signal (NLS; aa 13–20) and a leucinerich nuclear export signal (NES; aa 54–60) are present in HML-2 SP indicated by an 18-19 ... by Western blotting using anti-SP Cellular β-actin was analyzed as a loading control Larger-sized protein bands, including the protein band slightly larger than SP in the left-hand Western blot, ... followed by addition of a digoxigeninlabeled anti-CAT antibody, and by addition of a peroxidase-conjugated anti-digoxigenin antibody After addition of peroxidase substrate, the absorbance of the colored...
- 20
- 250
- 0
Báo cáo khoa hoc:" Comparison of nanoparticle-mediated transfection methods for DNA expression plasmids: efficiency and cytotoxicity" potx
... PCR-amplification: EcoRI-B1-CFA-Fwd (5’-GGAATTCCACCATGGGCAAAGGAGA-3’; forward primer) and NotI-B1-CFARev/-TAA (5’-AAGAATGATGATGATGAAGCGGCC GCGC-3’, reverse primer) The amplified PCR product was separated ... protocols in which plasmid DNA vectors were transfected into a mammalian cell line and the transfection efficiency and cytotoxicity of each protocol was analysed after transfection The addition of AuNPs ... (Figure and 2, Table 1) indicate that AuNPs, in particular the physically made pure colloids, are able to significantly increase transfection efficiency and that a trade-off in cell vitality becomes...
- 11
- 376
- 0
Báo cáo y học: " Proviral integrations and expression of endogenous Avian leucosis virus during long term selection for high and low body weight in two chicken lines" ppt
... TGCTTGTCTCCCCAGGGTAT CCCAAGAAAGATGGCTGGAA GGCAGGTCAGGTCAACAACA CGATGGCGTTTTTGAACAGAG CATCCAAGAAGCTTTCCTCAATCT AGTCAGAAATGCCTGCAAAAAGA TTCCTTGCCATGCGCGATCCC CGGATGTTGTGGAAAAACGA TACGGTGGTGACAGCGGATAGG GGTGACTAAGAAAGATGAGGCGA ... AGGTCATCACCATTGGCAATG GGGAAGCTTACTGGAATGGCT GCTACGGCGGCTTCATGA CGAAATGGAGACGGAACTGAA ACCCGGACATCACCCAAAG ACGGATTTCTGCCTCTCTACACA GAAACTACCTTGTGTGCTGTCG CCCAAAATCTGTAGCCATATGC TGCTTGTCTCCCCAGGGTAT ... originated from a Scandinavian selection and crossbreeding experiment [17] and was maintained at the Swedish University of Agricultural Sciences at a population size of 30 males and 30 females...
- 13
- 284
- 0
Reagents and instrumentation
... increased volume of reagents added Similarly Ruby Taq and Ruby Taq Master mix are available from USB Corp and contain an inert dye GoTaq® DNA Polymerase from Promega is a Taq DNA Polymerase and a ... premixes Increasingly PCR premixes are becoming available These contain buffer, dNTPs and Taq DNA polymerase as a premixed reagent at a concentration that allows addition of template DNA and primers ... bp) RNA isolation and first-strand cDNA preparation There are a number of ways to isolate RNA for reverse transcriptase applications Standard methods include the lysis of cells and tissues, and...
- 42
- 294
- 0
Tài liệu Báo cáo " synthesis, cloning and expression in escherichia coli of a gene coding for Mcoti-ii " ppt
... gagcaataac 320 321 tagcataccc 361 TTTTTGCTGA cttggggcct AAGGAGGAAC ctaaacgggt TATATCCGGA cttgaggggt TATCCCGCAA 360 400 401 GAGCCCGGCA GTACCGGCAT AACCAAGCCT ATGCCTACAG 440 441 CATCCAGGGT TTG GACGGTGCCG ... Gctcgcggat ttatttcgag ttcagacctg ttcagacctg 40 41 ttattatggg tattacttta tctgatgatt ctgaTcatca 80 81 Gtttttgctt ggatcccagg ttgttgtaca gaatgctggt 120 121 catatgagcg gcagcgatgg cggcgtgtgc cgaaaattct ... gaaaaaatgc cgccgcgata gcgattgccc gggcgcgtca 200 201 tttgccgcgg caacggctat tgcggctaac tcgagcccgg 240 241 gtgactgcag gaaggggatc cggctgctaa caaagcccga 280 281 aaggaagctg agttggctgc tgccaccgct gagcaataac...
- 9
- 497
- 0
Tài liệu Báo cáo khoa học: Restricted localization of proline-rich membrane anchor (PRiMA) of globular form acetylcholinesterase at the neuromuscular junctions – contribution and expression from motor neurons doc
... CCTTAGATGTCC-3¢ and 5¢-GATAGTCAAGTTCGAC CGTC-3¢ for rat 18S ribosomal RNA The SYBR green signal was detected by an Mx3000pÔ multiplex quantitative PCR machine (Stratagene, La Jolla, CA, USA) Transcript ... of PRiMA and PRiMA-linked G4 AChE, rat spinal cords were collected at early postnatal and adult stages Qualitative PCR indicated that both PRiMA I and II transcripts were expressed in the spinal ... 5¢-TCACACCACCGCAGCGTT CAC-3¢ for mouse PRiMA I and II (GenBank numbers NM 133364 and NM 178023); 5¢-CTGGGGTGCGGA TCGGTGTACCCC-3¢ and 5¢-TCACAGGTCTGAGCAG CGTTCCTG-3¢ for mouse AChET [30]; 5¢-TGTGATGC...
- 12
- 488
- 0
Tài liệu Báo cáo khoa học: Nuclear receptors in the mosquito Aedes aegypti Annotation, hormonal regulation and expression profiling ppt
... were analyzed using qPCR Transcript abundance values for AaEcRA, AaEcRB, AaUSP -A, AaUSP-B, AaE7 5A (A) , AaHR3, AaHR4, AaE78, AaHR39, AaHR78 (B) and AabFTZ-F 1A, AabFTZ-F1B, AaHNF- 4A, AaHNF-4B, AaHNF-4C ... 140 AaPNR-like 120 100 80 60 a a a a a a a 40 20 a 16 14 12 10 a a a a a a a a AaS7 Relative mRNA (+SEM) Relative mRNA (+SEM) a 140 AaHR38 120 100 a 80 60 a 40 20 a a a 250 a AaActin 200 a 150 a ... Ftz transcription factor AaERR AaHr38 AaFTZ-F1 NR5B1 NR 6A1 Hormone receptor-like in 39 Hormone receptor-like in Isoform AaHr39 AaHr4 AaHr46 AaEcR AaE7 5A AaE75B AaE75C AaEcRA AaEcRB AaHnf4 -A AaHnf4-B...
- 22
- 578
- 0
Tài liệu Báo cáo khoa học: Cloning, characterization and expression analysis of interleukin-10 from the common carp, Cyprinus carpio L. docx
... forward SP6-reverse GACTGTTGCTCATTTGTGGA GAGGCTAGATACTGCTCGATGT TGATGATTTGGAACCATTATTGAA CACCTTTTTCCTTCATCTTTTCAT ACTACCTCATGAAGATCCTG TTGCTGATCCACATCTGCTG TAATACGACTCACTATAGGG ATTTAGGTGACACTATAGAA ... isolated and characterized a carp cDNA sequence that is homologous to the DNA sequence of mammalian IL-10 Carp IL-10 is 1096 bp in length and encodes a 180 amino acid protein similar to that of ... for head kidney and liver Data are presented as PCR products after normalizing against products of b-actin The x-axis indicates the time-periods of LPS incubation and the relative expression of...
- 8
- 584
- 0
Tài liệu Báo cáo Y học: Purification, characterization, cloning, and expression of the chicken liver ecto-ATP-diphosphohydrolase pot
... primer, 5¢-ATGGAGTATAAGGGGAAGGTTGTTGC-3¢, and reverse primer, 5¢-TTGGATTTCCAGAAACACTGGA-3¢ PCR was carried out in a 50-lL reaction mixture containing 0.5 lL (from a total of 10 lL) cDNA template, 0.5 ... canaliculi of liver was first demonstrated by ATPase activity staining in the 1950s [33,34] Interestingly, this activity was both increased in magnitude and altered in cellular location in rat hepatomas ... other hand, the CaADPase activity is 80% of the MgADPase activity at a divalent ion-ADP concentration of mM (data not shown) The ATPase and ADPase activities of the purified chicken liver ecto-ATPDase...
- 10
- 694
- 0
Report of the Special Rapporteur on the promotion and protection of the right to freedom of opinion and expression, Frank La Rue* ppt
... human rights standards, in particular article 19, paragraph 3, of the International Covenant on Civil and Political Rights, remain pertinent in determining the types of restrictions that are in ... to certain content, such as blocking and filtering, to inadequate guarantees of the right to privacy and protection of personal data, which inhibit the dissemination of opinions and information ... which is independent of any political, commercial, or other unwarranted influences in a manner that is neither arbitrary nor discriminatory, and with adequate safeguards against abuse, including the...
- 22
- 400
- 0
The CMU Pose, Illumination, and Expression (PIE) Database potx
... partitions Finally, we include a description of the database meta-data (i.e calibration data, etc.) 3.2 Pose and Illumination Variation Examples of the pose and illumination variation are shown in Figures ... To allow the cameras to be intensity- (gain and bias) and color-calibrated, we captured images of color calibration charts at the start of every session and include them in the database meta-data ... existence of new datasets, that drives research forward (d) Color Calibration Image Obtaining the Database Figure 8: An example of a background image (b) and a demonstration of how background subtraction...
- 6
- 343
- 0
Báo cáo khoa học: Cloning and expression of the first nonmammalian interleukin-11 gene in rainbow trout Oncorhynchus mykiss pdf
... 5¢- and 3¢-UTR The major differences were a 26 bp insertion in the 5¢-UTR of the cDNA and an insertion of 12 repeats with a consensus of CCAATGATGATCCAAGAAATCCACACTACAG (31 bp) in the 3¢-UTR of ... by ‘|’ and insertions indicated by ‘-’ The two insertions in the 5¢- and 3¢-UTR are underlined and the 13 repeats with a consensus of CCAATGATGATCCAAGAAATCCACACTACAG (31 bp) in the 3¢-UTR are numbered ... medium, incubated at 37 °C overnight, and re-screened Finally, the bacteria were plated, and an isolated clone containing IL-11 was identified Plasmid DNA containing the kb IL-11 cDNA was prepared and...
- 12
- 511
- 0
Báo cáo Y học: Cloning and expression of sterol D14-reductase from bovine liver potx
... contained an ORF of 1257 bp, encoding a protein of 418 amino acids with a calculated molecular mass of 46 751 Da The N-terminal amino-acid sequence of the protein puri®ed from liver and the amino-acid ... RESULTS AND DISCUSSION Isolation of sterol D14-reductase During the preparation and delipidation of a bovine liver 38-kDa protein exhibiting EPT activity [25], a protein comigrating in SDS/PAGE was ... cellular localization of myc-tagD14-SR was examined in transiently transfected COS-7 cells Double immuno¯uorescence analysis of cells showed a similar labelling pattern with anti-(myc-tag) Ig and anti(D14-SR)...
- 8
- 493
- 0
Báo cáo khoa học: Identification and expression of the first nonmammalian amyloid-b precursor-like protein APLP2 in the amphibian Xenopus laevis ppt
... spliced in APP) and exon 14 (encoding a 12 amino acid domain involved in the attachment of a chondroitin sulfate glycosaminoglycan side chain) are alternatively spliced [29] While forms of APP mRNA ... GAPDH cDNA was amplified (forward primer 5¢-GCCGTGTATGTGGTGGAATCT-3¢ and reverse primer 5¢-AAGTTGTCGTTGATGACC TTTGC-3¢) Amplification was performed at 94 °C for min, 58 °C for and 72 °C for min, for ... the appearance of the APLP1 and APLP2 gene families The fact that both mammals and Xenopus contain APP and APLP2 proteins suggests that the first gene duplication giving rise to the APP and preAPLP...
- 7
- 405
- 0
Báo cáo khoa học: Identification and expression analysis of an IL-18 homologue and its alternatively spliced form in rainbow trout (Oncorhynchus mykiss) doc
... CGACATTTCCGAGTGACGTTC CCTTCAACACCCTGACTTCAC ATGTCCTCCTTGTCTACTACC AGCAGCTCCGAATGTAAGGTG GCTCCGAATTCGAACATGAC AGGCAAAGGTTGCTCCAGTG ATGGAAGATGAAATCGCC TGCCAGATCTTCTCCATG TGGTACCACTCAACATGTCAGTAAGCG ... protein translation and thus the alternative spliced mRNA remained in- frame and potentially translated into a 182 amino acid protein (IL-18B), 17 amino acids shorter than the above form The 17 amino ... Primer name Sequence (5¢)3¢) Use Adaptor oligo(dT) ADAP Oligo(dG) F1 GGCCACGCGTCGACTAGTAC(dT)17 GGCCACGCGTCGACTAGTAC GGGGGGIGGGIIGGGIIG GCAATGCGACCGAGTGTCGGAG F2 R2 R3 EF1 EF2 ER1 Actin-F Actin-R...
- 11
- 426
- 0
Báo cáo khoa học: Cloning and expression of a tomato cDNA encoding a methyl jasmonate cleaving esterase pdf
... cDNA for expression was cloned by another RT-PCR with primers fullMJEforMQ (GCATGCAGGGTGATAAAAA TCACTTTGTA) and fullMJErev (AAGGATCCATAA TATTTTTGCGAAATC), adding restriction sites for SphI and ... rapid amplification of cDNA ends (RACE) (RACEfor: GTGA CAGCTTTCATGCCTGG; and RACErev: ATCCTGT CCGTTGTTGTAAAC) 5¢- and 3¢-RACE was performed using the SMART II system (BD Bioscience) Full-length ... while 5¢ and 3¢ untranslated regions are in lower case letters The putative amino acid residues of the catalytical triad of a/ b-hydrolase fold proteins are marked with an asterisk degradation of the...
- 8
- 458
- 1
Báo cáo khoa học: "Sentence and Expression Level Annotation of Opinions in User-Generated Discourse" potx
... level annotation scheme with a very average GPA and only 20; I already make above $45,000 a year as a programmer with a large health care company for over a year and have had promotions up in the ... Claire Cardie 2005 Annotating expressions of opinions and emotions in language Language Resources and Evaluation, 39:165–210 Theresa Wilson and Janyce Wiebe 2005 Annotating attributions and private ... be labeled after marking the span For instance, upon marking a text span as a polar target or an opinionexpression, one has to label the polarity and strength We consider the overlapping spans...
- 10
- 432
- 0
Báo cáo khoa học: Isolation, characterization and expression analysis of a hypoxia-responsive glucose transporter gene from the grass carp, Ctenopharyngodon idellus potx
... 5¢-CCTGATCGACGCACGAGT-3¢ and GT1 -R, 5¢-TTTTGCAAGTCATAGTAATCAGTTT-3¢ for GTcDNA1 (2150 bp); and GT2 -F, 5¢-CACCAGCAACTAC CTGATCGA-3¢ and GT2 -R, 5¢-CACAAAATATGCTT CCAAGTGC-3¢ for GT- cDNA2 (3043 bp) RNA isolation and ... analysis showed that both GT- cDNA1 and GT- cDNA2 contain a 5¢-UTR of 203 bp and a coding region of 1599 bp (excluding the stop codon), but the 3¢-UTR of GT- cDNA1 is 345 bp while that of GTcDNA2 ... clones, GT- cDNA1 and GT- cDNA The two putative polyadenylation sites (ATTAAA) are indicated by an upright arrow (›) (B) The exon/intron boundaries of the split codons for arginine (between exon and...
- 8
- 465
- 0
Báo cáo Y học: Cloning and expression of two novel aldo-keto reductases from Digitalis purpurea leaves potx
... database and are available under accession numbers AJ309822 and AJ309823, respectively DpAR1 and DpAR2 contain 948 bp long ORFs encoding 315 amino acids of a calculated molecular mass 34 898 and ... determined whether leaf damage resulted in enhanced expression of DpAR1 and DpAR2 genes Leaves of D purpurea were damaged mechanically and then sampled at various intervals to measure changes in ... and DpAR2, D purpurea (this study); AAC23647, AAD32792, CAB88350 and AAC2346, Arabidopsis thaliana; Medicago, M sativa [16] The amino-acid residues identical to the DpAR1 sequence are indicated...
- 9
- 570
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25