flow pattern and quantitative computation of the filling process of a mold simulation models
Design of Runner System
... that the areas of high orientation are pushed into the gate area to be later removed and therefore not have any effect on the quality of the molded part 5.9 Qualitative (Flow Pattern) and Quantitative ... importance as a means of reducing the material costs incurred The design of the runner systems is basically the same as that of thermoplastic materials 5.8.1 Elastomers These materials are usually ... lines that always occur at the same place, and other obstacles to free flow, cause increased formation of deposits at these places The same phenomenon can be observed at the end of a filling...
- 22
- 368
- 0
Qualitative (Flow Pattern) and QuantitativeComputation of the Filling Process of a Mold(Simulation Models)
... that completely laminar flow is maintained even in the gate This means that, above all, a flow path close to the wall remains there At the point of branching, the core material penetrates against ... lines, air trapping) 5.9.6 Quantitative Analysis of Filling A quantitative analysis is based on the concepts of fluid dynamics (rheology) and thermodynamics It has to solve the fundamental equations ... mathematically Equation (5.10) is called the power law of Ostwald and de Waele, where the exponent m is the flow exponential and O is the fluidity The flow exponent m characterizes the flow capability...
- 40
- 608
- 0
Báo cáo y học: " Chemical fingerprinting and quantitative analysis of a Panax notoginseng preparation using HPLC-UV and HPLC-MS" pdf
... the study HY performed the fingerprint and quantitative analysis and wrote the manuscript PYS and QS assisted HY to identify the characteristic peaks using HPLC-PDA/ESI-MSn All authors read and ... samples Additional file 2: The similarities of chromatograms of 10 samples (n = 3) Additional file 3: PDA Chromatograms standard compounds (A) and a XST injection (C), and total ion current chromatograms ... saponins From literatures (A) [Journal of Pharmaceutical and Biomedical Analysis 41 (2006) 274-279], (B) [Journal of Pharmaceutical and Biomedical Analysis 48 (2008) 1361-1367], (C) [Journal of...
- 8
- 471
- 0
Báo cáo " Pattern and determinant agents of the debris and mud flash flood in Lay Nua Commune area, the Former Muong Lay District, Dien Bien Province " docx
... has indicated the need and sufficient conditions for debris and mud flows to appear as a particular case similar to one of the Bac Ha Tableland SW slopes. The case of Lay Nua ... erosion. On the top of watershed area, there are predominantly hard bedrocks, as limestone of the Ban Pap Formation (D1-2 bp), aphyric basalt, porphyritic basalt, basaltic agglomerate of the ... Formation (D1-2 bp); the foot of this slope and all the west side of the Lay Nua valley are built with very tender black clay shales and silty sandstone of the Lai Chau Formation (T2-3...
- 10
- 306
- 0
báo cáo khoa học: "Profiling and quantitative evaluation of three Nickel-Coated magnetic matrices for purification of recombinant proteins: helpful hints for the optimized nanomagnetisable matrix preparation" pps
... purification of His-tagged proteins and presents a major limitation for broad application of such materials In this regard, optimization and evaluation of commercially available matrices is mandatory, ... concentrations of magnetic matrices, SiMAC-Nickel, SiMAG/N-NTA/Nickel and SiMAG/CS-NTA/Nickel, and flowthrough fraction of each matrix at each concentration was subjected to SDS-PAGE analysis The target ... SiMAG-Carboxyl NTA adsorbents including SiMAG/CS-NTA and SiMAG/NNTA are quadridentate chelate former and form four coordination bands with such metal ions as Nickel Regarding the fact that Ni has...
- 11
- 289
- 0
Báo cáo y học: "Qualitative and quantitative research into the development and feasibility of a video-tailored physical activity intervention" pptx
... Department of Health and Aged Care (DHAC): National Physical Activity Guidelines for Australians Commonwealth Department of Health and Ageing Canberra: Department of Health and Ageing; 1999 Vandelanotte ... Participants Participants were recruited from large databases held by the Population Research Laboratory (PRL) at Central Queensland University in March and April 2010 The databases consist of ... supported by a National Health and Medical Research Council of Australia (#519778) and National Heart Foundation of Australia (#PH 07B 3303) post-doctoral research fellowship Author details Centre...
- 11
- 427
- 0
Tài liệu Báo cáo Y học: Antibacterial and antifungal properties of a-helical, cationic peptides in the venom of scorpions from southern Africa pptx
... more antibacterial than dermaseptin (34 amino acids) [19], peptides consisting of amino acids 7–22 of parabutoporin (an a- helical part having the four amino acids LAKK identical to mastoparan) and ... explain the higher antibacterial activity on Gram-negative bacteria for parabutoporin compared to opistoporin Also with magainin analogs, an increase in antibacterial activity against Gram-negative ... mastoparan gave the same results The role of LPS in the interaction was also demonstrated by the lack of effect of extracellular Mg2+ on the activity of the peptides against Gram-positive bacteria...
- 12
- 598
- 0
NATIONAL REPORT OF MALAYSIA ON THE FORMULATION OF A TRANSBOUNDARY DIAGNOSTIC ANALYSIS AND PRELIMINARY FRAMEWORK OF A STRATEGIC ACTION PROGRAMME FOR THE BAY OF BENGAL potx
... the Straits of Malacca and the adjacent waters of the Andaman Sea and the Indian Ocean In the process, an attempt is made to identify, examine, and rank those threats that have transboundary effects ... Singapore The Straits of Malacca The Straits of Singapore The Straits of Singapore The Straits of Malacca The South China Sea The South China Sea The Straits of Singapore The Straits of Malacca The ... Sarawak in the north of Kalimantan Kuala Lumpur, the national capital, Labuan UNEP/SCS – National Report Malaysia and Putra Jaya form the Federal territories The multiracial population of Malaysia...
- 88
- 581
- 0
Báo cáo khóa học: Biochemical and molecular characterization of a laccase from the edible straw mushroom, Volvariella volvacea docx
... min; then a final extension at 72 °C for 10 The primers for lac1 PLAC1F (5¢-AGCTTT CATTCCCAGTGATTG-3¢) and PLAC1R (5¢-AACGAG CTCAAGTACAAATGACT-3¢) were designed according to our cloned cDNA (GenBank ... developmental cycle: early, middle and late substrate colonization stages (4, and 12 days); pinhead stage (day 14), button stage (day 18), egg stage (day 21), elongation stage (day 22) and mature stage ... primers The putative N-glycosylation site is boxed; *; stop codon The putative polyadenylation signals (TATAAA and CATAAA) are in white on a black background Ó FEBS 2003 Laccase gene from Volvariella...
- 11
- 703
- 0
Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx
... (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 (2005) 4091–4102 ª 2005 FEBS 4099 Molecular characterization ... PP2500 and ANKHD1 variant In this study we focus on the biochemical and functional characterization of the novel VBARP-L and VBARP-S transcripts Bioinformatics analyses show that VBARP-L and VBARP-S ... Molecular characterization of ANKHD1 splice variant studies blast searches of VBARP revealed that this protein has homology to human ankyrin repeat and KH domain containing 1(ANKHD1) variants, and...
- 12
- 561
- 0
Báo cáo khoa học: Structural and biological effects of a b2- or b3-amino acid insertion in a peptide Application to molecular recognition of substance P by the neurokinin-1 receptor ppt
... between [Ala9]SP and [Gly9]SP on the one hand, and [b2-HAla9]SP and [HGly9]SP on the other hand Indeed, the higher pharmacological potency of [b2-HAla9]SP compared to [HGly9]SP suggests that the methyl ... in the sequence of the C-terminal heptapeptide of NKA, another peptide of the tachykinin family that binds the NK-1 and NK-2 receptors [HGly8] NKA(4–10) is as potent as NKA and [Ala8]NKA on rabbit ... similar results All assays were done in parallel experiments with control at t ¼ for each peptide The percentage of degradation was calculated by comparing the area of the peaks of the intact...
- 11
- 860
- 0
Báo cáo khoa học: Functional fine-mapping and molecular modeling of a conserved loop epitope of the measles virus hemagglutinin protein pdf
... induced against the linear isoform of the HNE peptide Although the binding pattern may be somewhat blurred by these antibodies and by the polyclonal nature of the sera, the importance of residues ... bonds stabilizes a conformational epitope of the apical membrane antigen-1 of Plasmodium falciparum [27] Although the sequential epitope of VP1 of foot and mouth disease does not contain intramolecular ... microtiter plates increased at high pH (Fig 3A) Under the basic conditions optimal for coating, the HNE peptide was at least partially oxidized and the signal of the reduced species increased as a result...
- 13
- 492
- 0
Báo cáo khoa học: Isolation, characterization and expression analysis of a hypoxia-responsive glucose transporter gene from the grass carp, Ctenopharyngodon idellus potx
... 5¢-CCTGATCGACGCACGAGT-3¢ and GT1-R, 5¢-TTTTGCAAGTCATAGTAATCAGTTT-3¢ for GTcDNA1 (2150 bp); and GT2-F, 5¢-CACCAGCAACTAC CTGATCGA-3¢ and GT2-R, 5¢-CACAAAATATGCTT CCAAGTGC-3¢ for GT-cDNA2 (3043 bp) RNA isolation and ... 5¢-RACE and the two alternate 3¢-ends of exon 12 were deduced by 3¢-RACE, and are delineated by the full-length cDNA clones, GT-cDNA1 and GT-cDNA The two putative polyadenylation sites (ATTAAA) are ... revealed two putative polyadenylation (ATTAAA) signals: one is located 18 bp upstream from the poly (A) of GT-cDNA1 and another is located 11 bp upstream from the poly (A) of GT-cDNA2 (data not...
- 8
- 465
- 0
Báo cáo khoa học: Purification, characterization, cDNA cloning and nucleotide sequencing of a cellulase from the yellow-spotted longicorn beetle, Psacothea hilaris ppt
... N-Terminal amino-acid sequencing analysis indicated that the mature protein of P hilaris cellulase was a truncated form, which lacked a signal peptide composed of the first 21 amino acids Therefore, the ... enzymes, such as xylanase and mannanase P hilaris cellulase was proposed to belong to GHF and the signature sequence of GHF was found in the aminoacid sequence (Fig 3) GHF is the largest GHF and includes ... Biochim Biophys Acta 1576, 246–254 Da Lage, J.L., Maczkowiak, F & Cariou, M.L (2000) Molecular characterization and evolution of the amylase multigene family of Drosophila ananassae J Mol Evol...
- 6
- 361
- 0
Retrieval of the source location and mechanical descriptors of a hysteretically-damped solid occupying a half space by full wave inversion of the the response signal on its boundary doc
... when the values of all the parameters of the set P are strictly equal to their counterparts in the set p and the values of all the parameters of the set N are strictly equal to their counterparts ... physical/geometrical and numerical parameters to which the model appeals The physical/geometrical parameters of the SM form none other than the set p, whereas the numerical parameters of the SM can ... 1992), has a corollary (Wirgin, 2004): when the values of all the parameters, except PK of the set P are strictly equal to their counterparts in the set p and the values of all the parameters of the...
- 26
- 467
- 0
Báo cáo khoa học: N-Terminal segment of potato virus X coat protein subunits is glycosylated and mediates formation of a bound water shell on the virion surface docx
... at the beginning of the chromatogram (peaks 1*, 2*, 3*, and in Fig 5A) For peaks and 2, molecular masses of 2025 and 2041 Da were obtained as before (Table 1) The molecular mass of peak 3* was ... additional 162 Da) in the material of peak (Fig 3A, B) and both galactose and fucose (the additional 146 Da) residues in peak (the data for the Ru strain are shown in Fig 4) These results correlated closely ... for films of the intact and trypsin-treated Ru PVX and the intact ST mutant preparations To compare the waterabsorbing capacity of the different PVX variants, we measured their FTIR spectra in dry...
- 10
- 398
- 0
Báo cáo Y học: Heterologous expression and folding analysis of a b-tubulin isotype from the Antarctic ciliate Euplotes focardii ppt
... CCT were quantitated by the use of a phosphorimager and expressed as a fraction of the maximum amount of bound labeled tubulin and plotted as a function of the ratio of labeled : unlabeled tubulin ... immediately after dilution or after h of incubation at 30 °C b-T1 behaviour was similar to that of b5 tubulin [33] At early times, the bulk of the radioactivity migrates as a broad band with a slower ... nondenaturing PAGE; the ratios of labeled to unlabeled tubulins are indicated on the top of each lane and the arrow indicates the position of the b-tubulin/CCT complex (B) The amounts of the tubulin...
- 7
- 500
- 0
Báo cáo khoa học: Identification and structural characterization of a sialylated lacto-N-neotetraose structure in the lipopolysaccharide of Haemophilus influenzae pptx
... Sialylated LPS in Haemophilus influenzae (Eur J Biochem 269) 4011 Analytical methods and methylation analysis Sugars were determined as their alditol acetates and partially methylated alditol acetate ... strains that lack a capsular structure, which in itself provides serum resistance Recent data from our laboratory indicate that the ability of acapsular strains of H influenzae to elaborate sialylated ... signals were observed for the axial and equatorial H-3 H-resonances of the sialic acid residue at 1.81 and 2.76 p.p.m., respectively (Fig 4) Integration of the H-3 H-resonances of the sialic acid...
- 11
- 579
- 0
DELIVERING HEALTH EDUCATION VIA THE WEB: DESIGN AND FORMATIVE EVALUATION OF A DISCOURSE-BASED LEARNING ENVIRONMENT pot
... Web learning environment These icons were replicated at the top left corner of the corresponding page and again in a navigational menu bar that appears at the bottom of each page allowing the student ... appropriateness of graphics and icons, clarity and quality of information, suitability of external links, and clarity and perceived motivating and discussion promoting characteristics of the learning ... experienced while navigating through the site A suggested enhancement to the navigational capability of the site was a text-based replication of site navigation bar at the top of each page to make scrolling...
- 12
- 411
- 0
Tìm thêm: xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008