fill in each blank with a suitable word 1 mark for 1 correct answers 15 m
1186 complete with a suitable word
... TO THE CINEMA LAST NIGHT ANDMUST DO IT TODAY HAVE A GOOD TIME!! EDDIE DEAR TEACHER, I M SORRY I CAN’T COME TO CLASS TODAY I HAVE TO STAY AT HOME FOR A WEEK BECAUSE I HAD A SMALL OPERATION I HOPE ... A TROPICAL ISLAND WE NEED TO RELAX AND FORGET ABOUT WORK I AM STARTING MY HOLIDAYS ON JULY 1ST LOVE SUE DEAR MELANIE, I AM WRITING THIS POSTCARD FROM MY HOTEL ROOM IN LONDON I ARRIVED HERE DAYS ... DEAR TEACHER, I SORRY I CAN’T COME CLASS TODAY I TO STAY HOME A WEEK BECAUSE I A SMALL OPERATION I HOPE TO BE BACK AT SCHOOL _MONDAY YOU SEND ME _HOMEWORK, PLEASE? ALAN DEAR ALAN,...
- 6
- 232
- 0
Báo cáo khoa học: Enhancing the protein production levels in Escherichia coli with a strong promoter potx
... using primers TEHA1: ACACAGATCTCTGCAGGGCACCCCAGGCTTTACA and TEHA2: ACACCCATGGAGCTTTCCTGTGTGAAATTGT, lacUV5 was amplified TEHA3: ACACAGATCTCTGCAGTGAAATGAGCTGTTGACAATTA and TEHA4: ACACCCATGGTCTGTTTCCTGTG ... (Merck KGaA, Darmstadt, Germany), 30 gÆL )1, supplemented with gÆL )1 yeast extract (Merck KGaA, Darmstadt, Germany) and 50 lgÆmL )1 kanamycin (Sigma-Aldrich, Munich, Germany) was used to inoculate ... Cambillau C, Campanacci V, Christodoulou E, FEBS Journal 278 (2 011 ) 729–739 ª 2 011 The Authors Journal compilation ª 2 011 FEBS H Tegel et al 12 13 14 15 16 17 18 19 20 21 Eiler S, Fogg MJ et al...
- 11
- 445
- 0
Estimating Inflation Expectations with a Limited Number of Inflation-Indexed Bonds ∗ doc
... 19 92– 19 96– 20 01 2006– 19 95 2000 2005 2 010 Number of Bonds: Nominal 12 19 12 19 8 12 8 14 In ation Indexed 3–5 4–5 3–4 2–4 Maximum Tenor: Nominal 11 13 11 13 11 13 11 14 In ation Indexed 13 – 21 19–24 ... from nominal Australian Commonwealth Government bonds, Australian Commonwealth Government in ation-indexed bond prices, in ation forecasts from Consensus Economics, and historical in ation Nominal ... model parameters, we also incorporate in ation forecasts from Consensus Economics in the estimation In ation forecasts provide shorter-maturity information (for example, forecasts exist for in ation...
- 32
- 347
- 0
Báo cáo khoa học: "A Novel Word Segmentation Approach for Written Languages with Word Boundary Markers" pptx
... data in the same way that we generate development data.4 In the second experiment, we attempt Performance Improvement according to the Word Spacing Error Rate of User Input 3.2 Performance Comparison ... 2007) within the 10 % spacing error range, which human writers seldom exceed It also performs comparably, even if the user input contains more than 10 % spacing errors Table 1: Performance comparison ... Bernard Merialdo 19 94 Tagging English text with a probabilistic model Comput Linguist., 20(2) :15 5– 17 1 Conclusion Tetsuji Nakagawa 2004 Chinese and Japanese word segmentation using word- level and...
- 4
- 268
- 0
RESEARCH DISCUSSION PAPER: Estimating Infl ation Expectations with a Limited Number of Infl ation-indexed Bonds doc
... Price Data Statistic Number of bonds: nominal in ation-indexed Maximum tenor: nominal in ation-indexed Average outstanding: nominal in ation-indexed 19 92 19 95 12 19 3–5 11 13 13 – 21 49.5 2 .1 Time ... Factor Model 2.4 Yields and Forward Rates In ation Forecasts in the Latent Factor Model 7 3 .1 Data 3.2 The Kalman Filter and Maximum Likelihood Estimation 10 3.3 Data and Model Implementation Calculation ... H1(xt ) from Equation (6) Note that the Australian nominal yield curve has a maximum maturity of roughly 12 years We extrapolate nominal yields beyond this by assuming that the nominal and real...
- 39
- 395
- 0
Báo cáo khoa học: "Hedge classification in biomedical texts with a weakly supervised selection of keywords" doc
... present in the automatically generated training data We manually examined all keywords that had a P (spec) > 0.5 given as a standalone instance for our maxent model, and constructed a dictionary ... and Bruce G Buchanan 20 01 A simple algorithm for identifying negated findings and diseases in discharge summaries Journal of Biomedical Informatics, 5:3 01 310 Ken Hyland 19 94 Hedging in academic ... Computational Natural Language Learning Conference, pages 25–32, Edmonton, Canada, May-June Association for Computational Linguistics James G Shanahan, Yan Qu, and Janyce Wiebe 2005 Computing Attitude...
- 9
- 407
- 0
Báo cáo toán học: " Transient noise reduction in speech signal with a modified long-term predictor" ppt
... experiments is 10 1 samples, and the frame size for the LTP, M, is 32 samples The minimum and the maximum bounds of the pitch lag search range, τmin, τmax , is 20 and 14 3 samples for the conventional ... −5000 Male 1. 40 1. 76 1. 78 2.40 2. 41 2.44 Average 1. 60 1. 87 1. 86 2.34 2.36 2.38 (a) x 10 5000 1. 216 1. 218 1. 22 1. 222 1. 224 1. 226 1. 228 1. 23 (b) 1. 232 1. 234 x 10 5000 1. 216 1. 218 1. 22 1. 222 1. 224 1. 226 ... Kang EURASIP Journal on Advances in Signal Processing 2 011 , 2 011 :14 1 http://asp.eurasipjournals.com/content/2 011 /1/ 1 41 estimator and the IMCRA noise estimator are designed to remove only stationary...
- 9
- 464
- 0
Báo cáo hóa học: " Fine Splitting of Electron States in Silicon Nanocrystal with a Hydrogen-like Shallow Donor" ppt
... functions in case of arbitrary donor position inside the quantum dot Note for comparison that more general treatment [10 , 11 ], taking into account dominant role of the central-cell potential, permits ... energy minima in the p-space, a0 = 0.543 nm stands for the lattice constant of silicon The quasimomentum p and the energy E have the origin at the X-point Equation for an undoped nanocrystal has ... 05-02 -16 762, respectively 575 M Fujii, Y Yamaguchi, Y Takase, K Ninomiya, S Hayashi, Appl Phys Lett 85, 11 58 (2004) D.I Tetelbaum, S .A Trushin, V .A Burdov, A. I Golovanov, D.G Revin, D .M Gaponova,...
- 7
- 255
- 0
Báo cáo toán học: " Stress Field in an Elastic Strip in Frictionless Contact with a Rigid Stamp" potx
... Solving functional equations by contractive averaging, U.S Army Math Res ctr T S R 16 0 (19 60) D D Ang, C D Khanh, and M Yamamoto, A Cauchy like problem in plane elasticity: a moment theoretic approach, ... norm in H1 , 6/5 α K 6/5 u is the norm in L6/5 (R) and (15 ) Dang Dinh Ang 472 ⎛ 1/ 6 α = (2π) 1/ 3 ⎝ 3(p−2)/2 r(y) dy ⎠ 1 dσ(x )1/ 2 1 Details are given in [1] Note that for each u in H1 , Au ... Elasticity, Nauka, Moscow, 19 74 (in Russian) Stress Field in an Elastic Strip in Frictionless Contact with a Rigid Stamp 475 D D Ang, Stabilized aproximate solution of certain integral equations...
- 7
- 289
- 0
Báo cáo y học: "Transient early preeclampsia in twin pregnancy with a triploid fetus: a case report" pot
... twin pregnancy with a successful outcome for the healthy co-twin after early transient preeclampsia Case presentation A 33-year-old Caucasian woman, gravida 3, para 1, was admitted to our clinic ... pregnancy An enlarged placenta of 10 cm × 12 cm with some cysts was prominent on the anterior wall Blood flow had ceased in this placenta Urinary protein excretion was 2.5 g/L Maternal serum beta-humanchorionic-gonadotropin ... draft the manuscript and making corrections References 10 11 12 MacFadden E, Kwong LC, Yam IY, Langlois S: Prenatal origin of triploidy in human fetuses: evidence for genomic imprinting Hum Genet...
- 4
- 328
- 0
Báo cáo sinh học: "Reconstructing phylogenies from noisy quartets in polynomial time with a high success probability" docx
... following improvement to algorithm Q-VOTE to look for a good starting phylogeny that contains m taxa for m ≥ Given a taxon set S, each subset of m (m ≥ 4) taxa of S is called an m- subset of S A quartet ... Approximating minimum quartet inconsistency (abstract) Proceedings of the 13 th Annual ACMSIAM Symposium on Discrete Algorithms 2002:894-895 Berry V, Bryant D, Jiang T, Kearney P, Li M, Wareham ... nected components, each with at most n leaves, and such a node can be found in linear time in T such that each of the trees in T - {v} has at most n leaves An internal node v of T having such a property...
- 10
- 291
- 0
Báo cáo y học: "Saline lavage with substitution of bovine surfactant in term neonates with meconium aspiration syndrome (MAS) transferred for extracorporeal membrane oxygenation (ECMO): a pilot study" docx
... meconium aspiration in two cases [20] In animal models of MAS a beneficial effect of surfactant therapy has been demonstrated [11 ,12 ,18 , 21, 22] This was attributed to the anti-inflammatory, alveolar ... neurodevelopmental delay was months at the age of 12 months in one patient, the others had a normal neurodevelopmental examination Research paper Lavage plus surfactant in mecomium aspiration M ller ... Treatment of severe meconium aspiration syndrome with porcine surfactant Eur J Pediatr 19 96, 15 5 :10 47 10 51 17 Lachmann B, Gommers D: Surfactant treatment for neonatal lung disease other than...
- 4
- 243
- 0
Báo cáo y học: "In silico experimentation with a model of hepatic mitochondrial folate metabolism" pps
... dietary input and vitamin status We plan to investigate the dynamic properties and potential interactions among the many methyltransferases that act in parallel using SAM as a substrate Finally, ... References 10 11 12 13 14 15 16 17 18 19 Bailey LB: Folate in Health and Disease New York, NY: Marcel Dekker; 19 95 Choi SW, Mason JB: Folate and carcinogenesis: an integrated scheme J Nutr 2000, 13 0 :12 9 -13 2 ... Metabolism In Homocysteine in Health and Disease Edited by: Carmel R, Jacobsen DW Cambridge: Cambridge Univ Press; 20 01: 113 -13 4 Appling DR: Compartmentation of folate-mediated one-carbon metabolism in...
- 11
- 207
- 0
Reordering in statistical machine translation a function word, syntax based approach
... background that forbids them from accessing information written in foreign languages, communicating with foreigners speaking unfamiliar languages and disseminating their ideas to people from ... 13 7 Chapter 10 Adaptation to Hiero 13 8 10 .1 Several Notes about Adaptation 13 8 10 .1. 1 Adapting Orientation Model 14 0 10 .1. 2 Adapting Pairwise Dominance Model ... leaves the model only with the standard treatment via intersecting the grammar with n-gram language model This is suboptimal because it only looks at the target language side and local information...
- 192
- 238
- 0
PHOTOSTIMULATED QUANTUM EFFECTS IN QUANTUM WELLS WITH a PARABOLIC POTENTIAL
... (10 ), (11 ) give the same results as those obtained in bulk semiconductor [5, 12 ] The analytical results are numerically evaluated and plotted for a specific GaAs/AlGaAs quantum wells The comparison ... PHOTOSTIMULATED QUANTUM EFFECTS IN QUANTUM 16 9 II PHOTOSTIMULATED QUANTUM EFFECTS IN QUANTUM WELLS WITH A PARABOLIC POTENTIAL II .1 Expressions for the photostimulated quantum effects in quantum wells ... E along the coordinate axes for the case of a specific GaAs/GaAsAl quantum wells The parameters used in the calculations are as follows [7, 8]: = 12 ,5; χ∞ = 10 ,48; χ0 = 12 ,90; ωLO = 36,8meV; m...
- 6
- 323
- 0
PET (b1) fill in the blank test 01
... 3 C taught D teaching Shortly after her marriage, Liz and her husband went to Tanzania, (1) _ he had a job as a teacher Liz hoped that she would be able (2) _ after a while However, ... Shortly after her marriage, Liz and her husband went to Tanzania, (1) _ he had a job as a teacher Liz hoped that she would be able (2) _ after a while However, on the first day, she was asked ... Photocopiable C above D before Shortly after her marriage, Liz and her husband went to Tanzania, (1) _ he had a job as a teacher Liz hoped that she would be able (2) _ after a while...
- 3
- 455
- 1
PET (b1) fill in the blank test 02
... development for all of those countries ASEAN was formed as a result of the Bangkok (5) _ of 19 67 and initially had five members: Thailand, Malaysia, Indonesia, the Philippines and Singapore ... for D with What is the Association of Southeast Asian Nations (ASEAN) and what is its purpose? The ASEAN is a multilateral organization which was (1) _ to give Southeast Asian states a forum ... Asian Nations (ASEAN) and what is its purpose? The ASEAN is a multilateral organization which was (1) _ to give Southeast Asian states a forum to communicate (2) _ each other Since the...
- 3
- 285
- 0
PET (b1) fill in the blank test 03
... and developing countries, FAO acts as a neutral forum (2) all nations meet as equals (3) negotiate agreements and debate policy FAO is also a source of knowledge and information We ... nations meet as equals (3) negotiate agreements and debate policy FAO is also a source of knowledge and information We help developing countries and countries in transition modernize and ... Food and Agriculture Organization of the United Nations leads international efforts to defeat (1) , Serving both developed and developing countries, FAO acts as a neutral forum (2) all...
- 3
- 230
- 0
7815 pats wish fill in the blank
... Answer sheet It was a beautiful day Pat got up and went to the kitchen and had breakfast She had a pancake with strawberry jam and drank an orange juice Then she went out and ran around ... for you.” Suddenly, they were under the sea and saw many colorful fish They played ball with an octopus and a dolphin Then they swam with some rays and a friendly shark They got into a cave and ... didn’t say anything Suddenly, a small man jumped in front of Pat He said “You are a very good person You didn’t take the coin You looked for its owner Please, think of a wish and I will make it...
- 2
- 234
- 0
- fill each blank with a suitable word
- read the following passage then fill in each blank with a suitable word from the box 2ps
- read the text carefully and fill in each blank with a suitable word mỗi câu 0 25điểm
- fill each blank with a suitable word 5 marks
- fill in each blank with one suitable word
- fill in each blank with a suitable word 1 mark for 1 correct answers 15 m
- fill in each blank with a suitable word
- fill in each blank with a suitable word in the box
- fill in each blank with a suitable word appearing in the passage
- read the text and fill in each blank with a suitable verb
- fill in each blank with a word above
- the words in the box all appear in the passage fill each blank with a suitable word
- fill in the blank with a suitable word or phrase in the box
- read the text carefully and fill in each blank with a suitable word moói caõu 0 25ủieồm
- fill in each space with a suitable word
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose