fill in each blank with a word above
Báo cáo khoa học: Enhancing the protein production levels in Escherichia coli with a strong promoter potx
Ngày tải lên :
06/03/2014, 01:20
... lacUV5 and trc were amplified by PCR from vectors including the relevant genes By using primers TEHA1: ACACAGATCTCTGCAGGGCACCCCAGGCTTTACA and TEHA2: ACACCCATGGAGCTTTCCTGTGTGAAATTGT, lacUV5 was ... promoter was amplified from the vector pAff8eGFP using TEHA7: ACACCTGCAGCGATCCCGCGAAATTAATAC and TEHA8: ACACCCATGGTATATCTCCTTCT, introducing restriction sites for PstI upstream and NcoI downstream of ... was amplified TEHA3: ACACAGATCTCTGCAGTGAAATGAGCTGTTGACAATTA and TEHA4: ACACCCATGGTCTGTTTCCTGTG were used for trc amplification The exact nucleotide sequence of each promoter region is provided in...
- 11
- 445
- 0
Báo cáo khoa học: "Chinese Segmentation with a Word-Based Perceptron Algorithm" docx
Ngày tải lên :
08/03/2014, 02:21
... to contain character and length information, and contain only character information, to 12 contain word and character information, while 13 and 14 contain 843 Input: raw sentence sent – a list ... word ending with character c and having length l space-separated characters c1 and c2 character bigram c1 c2 in any word the first and last characters c1 and c2 of any word word w immediately before ... supervised learning for CWS is to treat it as a tagging task Tags are assigned to each character in the sentence, indicating whether the character is a singlecharacter word or the start, middle...
- 8
- 380
- 0
Estimating Inflation Expectations with a Limited Number of Inflation-Indexed Bonds ∗ doc
Ngày tải lên :
15/03/2014, 07:20
... References Australian Financial Markets Association 2008 Australian Financial Markets Report Beechey, M 2008 “Lowering the Anchor: How the Bank of England’s In ation-Targeting Policies Have Shaped In ation ... decompose into in ation expectations and in ation risk premia Due to a lack of data, we cannot this, and instead we estimate in ation forward rates as part of our model Vol No Estimating In ation ... value In an in ation-indexed bond, the coupons are indexed to in ation so that the real value of the coupons and principal is preserved In Australia, in ation-indexed bonds are indexed with a lag...
- 32
- 347
- 0
RESEARCH DISCUSSION PAPER: Estimating Infl ation Expectations with a Limited Number of Infl ation-indexed Bonds doc
Ngày tải lên :
22/03/2014, 20:20
... and so has nothing direct to say about current instantaneous in ation.9 In ation swaps are now far more liquid than in ation-indexed bonds and may provide alternative data for use in estimating ... high in ation in Australia Interestingly, there appears to have been a sustained general rise in inflation expectations between 2004 and 2008 at all horizons Again this was a time of rising domestic ... decompose into in ation expectations and in ation risk premia Due to a lack of data we cannot this and instead estimate in ation forward rates as part of our model 18 in ation, a low 2-year break-even...
- 39
- 395
- 0
Báo cáo khoa học: "Hedge classification in biomedical texts with a weakly supervised selection of keywords" doc
Ngày tải lên :
31/03/2014, 00:20
... in the automatically generated training data We manually examined all keywords that had a P (spec) > 0.5 given as a standalone instance for our maxent model, and constructed a dictionary of hedge ... Computational Natural Language Learning Conference, pages 25–32, Edmonton, Canada, May-June Association for Computational Linguistics James G Shanahan, Yan Qu, and Janyce Wiebe 2005 Computing Attitude ... Cohen, and Wlodzislaw Duch 2007 A shared task involving multi-label classification of clinical free text In Biological, translational, and clinical language processing, pages 97–104, Prague, Czech...
- 9
- 407
- 0
Báo cáo toán học: " Transient noise reduction in speech signal with a modified long-term predictor" ppt
Ngày tải lên :
20/06/2014, 21:20
... Residual signal after applying speech modeling filter to noisy speech Time-domain waveforms of (a) : Noise signal, (b): Residual signal after STP analysis, and (c): Residual signal after LTP analysis ... LTP gain is generally limited to a certain constant to avoid the over-estimation of the pitch Choi and Kang EURASIP Journal on Advances in Signal Processing 2011, 2011:141 http://asp.eurasipjournals.com/content/2011/1/141 ... generally has short duration would not affect an LTP result [7,8,10,11,13] Figure depicts residual signals after the STP analysis and the LTP analysis The input signal of the analysis contains...
- 9
- 464
- 0
Báo cáo hóa học: " Fine Splitting of Electron States in Silicon Nanocrystal with a Hydrogen-like Shallow Donor" ppt
Ngày tải lên :
22/06/2014, 18:20
... energy E have the origin at the X-point Equation for an undoped nanocrystal has been already solved earlier [26] In the following we shall employ, in fact, the solutions obtained in Ref [26] as the ... the figure with solid line Since we direct the radial axis parallel to h, the donor is always situated somewhere at the right half of this axis ð within the range \ h/R \ We have calculated DFz ... taking into account dominant role of the central-cell potential, permits of only numerical calculations Second, it has been shown that, the wave functions in Li-doped nanocrystals have already...
- 7
- 255
- 0
Báo cáo toán học: " Stress Field in an Elastic Strip in Frictionless Contact with a Rigid Stamp" potx
Ngày tải lên :
06/08/2014, 05:20
... Field in an Elastic Strip in Frictionless Contact with a Rigid Stamp 475 D D Ang, Stabilized aproximate solution of certain integral equations of first kind arizing in mixed problems of elasticity, ... contractive averaging, U.S Army Math Res ctr T S R 160 (1960) D D Ang, C D Khanh, and M Yamamoto, A Cauchy like problem in plane elasticity: a moment theoretic approach, Vietnam J Math 32 SI (2004) ... (6) In order to give a meaning to Eq (4), we must decide on a function space for f and g Physically f is a surface stress under the stamp, and therefore, we can allow it to have a singularity at...
- 7
- 289
- 0
Báo cáo y học: "Transient early preeclampsia in twin pregnancy with a triploid fetus: a case report" pot
Ngày tải lên :
11/08/2014, 17:21
... twin pregnancy with a successful outcome for the healthy co-twin after early transient preeclampsia Case presentation A 33-year-old Caucasian woman, gravida 3, para 1, was admitted to our clinic ... fetus and one complete or partial molar, with or without a triploid fetus, are rare The molar tissue can provoke early preeclampsia, heavy vaginal bleeding and persistent gestational trophoblastic ... pregnancy An enlarged placenta of 10 cm × 12 cm with some cysts was prominent on the anterior wall Blood flow had ceased in this placenta Urinary protein excretion was 2.5 g/L Maternal serum beta-humanchorionic-gonadotropin...
- 4
- 328
- 0
Báo cáo sinh học: "Reconstructing phylogenies from noisy quartets in polynomial time with a high success probability" docx
Ngày tải lên :
12/08/2014, 17:20
... components, each with at most n leaves, and such a node can be found in linear time in T such that each of the trees in T - {v} has at most n leaves An internal node v of T having such a property is called ... und Angewandte Mathematik 1869, 70:185-190 Kannan SK, Lawler EL, Warnow T: Determining the evolutionary tree using experiments Journal of Algorithms 1996, 21:26-50 Kao MY, Lingas A, Östlin A: Balanced ... limitations and may fail in some situations [12] The second category of methods first define a score for each given quartet topology and then use combinatorial algorithms to find a phylogeny that...
- 10
- 291
- 0
Báo cáo y học: "In silico experimentation with a model of hepatic mitochondrial folate metabolism" pps
Ngày tải lên :
13/08/2014, 16:21
... dietary input and vitamin status We plan to investigate the dynamic properties and potential interactions among the many methyltransferases that act in parallel using SAM as a substrate Finally, ... variables to variation in external glycine input A: Response of selected model variables to variation in external glycine input B: Response of model variables to variation in external serine input ... compartments In addition, AICAR is a variable in the model that couples the PGT and AICART reactions Finally, we have added a serine sink that corresponds to the use of cytosolic serine in gluconeogenesis...
- 11
- 207
- 0
PHOTOSTIMULATED QUANTUM EFFECTS IN QUANTUM WELLS WITH a PARABOLIC POTENTIAL
Ngày tải lên :
31/10/2015, 10:42
... expressions for electric field → − intensity vector E along the coordinate axes for the case of a specific GaAs/GaAsAl quantum wells The parameters used in the calculations are as follows [7, 8]: = 12,5; ... CONCLUSION In this paper, we have studied the photostimulated effects in quantum wells with a parabolic potential When a two dimensional completly degenerate electron gas system is placed in an EMW and ... the laser radiation; and on the parameters QW with a parabolic potential When ω0 → 0, the Eqs (9), (10), (11) give the same results as those obtained in bulk semiconductor [5, 12] The analytical...
- 6
- 323
- 0
An investigation into negative sentences in english and vietnamese a word grammar perspective
Ngày tải lên :
14/05/2016, 18:40
... the nature of negatives, and more importantly, to avoid mainly investigated by grammarians and linguists, such as Diệp misunderstandings when communicate with native speakers Quang Ban (2002) in ... complementary analyses Laurence R that WG is a general theory of language Most of the work to date has Horn and Yasuhiko Kato (2000) in “Negation and Polarity-Syntactic dealt with syntax, but there has ... linguistics, and more specifically in grammar, it can language Adriana Pagano (1990) in “Negatives in Written Text” also be seen as a contribution to cognitive psychology; in terms of a investigates...
- 13
- 1K
- 1
PET (b1) fill in the blank test 01
Ngày tải lên :
25/08/2016, 08:07
... 3 C taught D teaching Shortly after her marriage, Liz and her husband went to Tanzania, (1) _ he had a job as a teacher Liz hoped that she would be able (2) _ after a while However, ... Shortly after her marriage, Liz and her husband went to Tanzania, (1) _ he had a job as a teacher Liz hoped that she would be able (2) _ after a while However, on the first day, she was asked ... Photocopiable C above D before Shortly after her marriage, Liz and her husband went to Tanzania, (1) _ he had a job as a teacher Liz hoped that she would be able (2) _ after a while...
- 3
- 456
- 1
PET (b1) fill in the blank test 02
Ngày tải lên :
25/08/2016, 08:07
... for D with What is the Association of Southeast Asian Nations (ASEAN) and what is its purpose? The ASEAN is a multilateral organization which was (1) _ to give Southeast Asian states a forum ... Thailand, Malaysia, Indonesia, the Philippines and Singapore Question 3: _ A interflow B interaction C interference D intercommunity What is the Association of Southeast Asian Nations (ASEAN) ... (ASEAN) and what is its purpose? The ASEAN is a multilateral organization which was (1) _ to give Southeast Asian states a forum to communicate (2) _ each other Since the region had a...
- 3
- 285
- 0
PET (b1) fill in the blank test 03
Ngày tải lên :
25/08/2016, 08:07
... and developing countries, FAO acts as a neutral forum (2) all nations meet as equals (3) negotiate agreements and debate policy FAO is also a source of knowledge and information We ... Food and Agriculture Organization of the United Nations leads international efforts to defeat (1) , Serving both developed and developing countries, FAO acts as a neutral forum (2) all ... Food and Agriculture Organization of the United Nations leads international efforts to defeat (1) , Serving both developed and developing countries, FAO acts as a neutral forum (2) all...
- 3
- 230
- 0
Replace a phrase with a word
Ngày tải lên :
29/08/2016, 17:06
... Stay on top of your writing! Download our grammar guide from www.englishgrammar.org to stay up-to-date Powered by TCPDF (www.tcpdf.org) ...
- 2
- 114
- 0
Use the words in capitals to form a word that fits into the space next to it
Ngày tải lên :
29/08/2016, 18:07
... 26.We had to get special to leave early (PERMIT) 27.As the best man, he had to make a at the wedding (SPEAK 28 He was sitting in his seat on the train (COMFORT) ... was very efficient and (BUSINESS) 63 It really isn't mine I think that you are (TAKE) 64 The rate of in Brazil has been rising steadily (EMPLOY) 65 With the real ... the real plan, the rate of in Brazil has fallen (INFLATE) 66 She looked at him , and started to cry (HAPPY) 67 The party was , everything went wrong (DISASTER) 68...
- 3
- 653
- 1
7815 pats wish fill in the blank
Ngày tải lên :
31/08/2016, 20:21
... Answer sheet It was a beautiful day Pat got up and went to the kitchen and had breakfast She had a pancake with strawberry jam and drank an orange juice Then she went out and ran around ... under the sea and saw many colorful fish They played ball with an octopus and a dolphin Then they swam with some rays and a friendly shark They got into a cave and Pat could not see any more Then ... It was a beautiful city with lots of parks and a beautiful river When she was running she found a gold coin on the pathway She picked it up and asked “Whose is this coin?” The animals around...
- 2
- 234
- 0