elucidation of mechanism of action of herbal radioprotectors a stepping stone for designing of novel radiomodulators
A functional genomics approach for elucidation of novel mechanisms involved in GnRH regulation of the gonadotropins
... Sf-1 GGATTAG -260 TATA TAGAGGTCA -232 -154 -25 Common carp and goldfish LHβ ERE/AP1 Pitx1 GTTCAttcTGACC Sf-1 -138 TATA TTAAGGTCA ATAATC -92 -61 -22/- Mammalian LHβ Sf-1 Pitx1 TAGAGGTCA GGATTAG -118 ... transduction pathways activated by GnRH GnRH activates a number of signaling pathways, including MEK, JNK, ERK1/2, cAMP/PKA, PKC, Ca2+ and CaM-dependent pathways A number of transcription factors ... and noncovalent assembly of the two subunits A B Fig 1.1: Anatomical and functional connections of the hypothalamic-pituitary axis (A) The pituitary is a small, bean-shaped gland that sits below...
- 185
- 275
- 0
Tài liệu A DEDICATED SATELLITE FOR MEETING HEALTH EDUCATION NEEDS OF AFRO-ASIAN NATIONS: POSSIBILITIES, ACTION PLAN AND BENEFITS pdf
... The reason is that India had already launched an indigenous dedicated satellite for education (EDUSAT) and has all the technical and manpower support to manage the Afro-Asian Satellite for Health ... volumes of image data (Healthware, 2005) College of Education and Health Professions at the University of Arkansas are actively planning to relocate nursing education to the planned Fayetteville satellite ... Health Education and China has also carried number of advances in satellite technology The Afro-Asian nations will be required to establish an ‘Afro-Asian Health Education Satellite Headquarter’...
- 12
- 482
- 0
Tài liệu Báo cáo khoa học: a-Conotoxins as tools for the elucidation of structure and function of neuronal nicotinic acetylcholine receptor subtypes doc
... interfaces within neuronal nAChR subunit combinations (compare Fig 2A C) So far, a- conotoxins selectively targeting mammalian a3 b2 (a- MII, a- GIC) a6 b2 (a- MII, a- PIA), a3 b4 (a- AuIB) and a7 (a- ImI) ... release in the rat striatum (A) Nicotine acts at somatodendritic nAChR in the substantia nigra pars compacta and at presynaptic nAChR in the striatum (B) a- Conotoxin MII was one of the first antagonists ... isolated neuchromaffin cells [57] In intracardiac neurons, the A1 0L rons from rat intracardiac ganglia, which are believed to mutation in PnIA again caused an increase in potency as arise primarily...
- 15
- 757
- 0
Báo cáo Y học: Elucidation of the role of fructose 2,6-bisphosphate in the regulation of glucose fluxes in mice usingin vivo 13 C NMR measurements of hepatic carbohydrate metabolism docx
... in vivo Diabetes 48, 1198– 1214 Okar, D .A. , Lange, A. J., Manzano, A. , Navarro-Sabate, A. , Riera, L & Bartrons, R (2001) PFK-2/FBPase-2: maker and 19 20 breaker of the essential biofactor fructose-2,6-bisphosphate ... interfaced to a Varian INOVA console (Palo Alto, CA, USA) An actively shielded gradient coil (Magnex Scientific, Abingdon, UK) with an 11 cm inner diameter was used A custom-built quadrature 1H ... guidelines of the Institutional Animal Care and Use Committee (IACUC) of the University of Minnesota Twelve male 129J mice (Jackson Laboratory, Bar Harbor, ME, USA) were studied after an overnight fast...
- 9
- 465
- 0
Báo cáo khoa học: Molecular characterization of gonad-inhibiting hormone of Penaeus monodon and elucidation of its inhibitory role in vitellogenin expression by RNA interference pptx
... TAGGGAGAAACATCCTGGACAGCAAATGCAGGG-3¢) and reverse primer (5¢-CCGGCATTGAGGATGCTGAT3¢) for the sense-strand template, the other with forward primer matGIHF (5¢-AACATCCTGGACAGCAAATGCA GGG-3¢) and ... T7-containing reverse primer (5¢-TAATACG ACTCACTATAGGGAGACCGGCATTGAGGATGCTG AT-3¢) for the antisense-strand template The reaction consisted of denaturation at 94 °C for 30 s, annealing at 57 °C for ... functions and comparative aspects Experientia 48, 439– 448 10 Ohira T, Katayama H, Tominaga S, Takasuka T, Nakatsuji T, Sonobe T, Aida K & Nagasawa H (2005) Cloning and characterization of a molt-inhibiting...
- 11
- 369
- 0
Báo cáo khoa học: Structural elucidation of polysaccharide part of glycoconjugate from Treponema medium ATCC 700293 doc
... of a glycoconjugate with repeating units During phenol/ water extraction of bacteria, capsular and extracellular polysaccharides as well as glycoconjugates are simultaneously extracted in the aqueous ... o-Phthalaldehyde-N-acetylL-cysteine as a chiral derivatization reagent for liquid chromatographic optical resolution of amino acid enantiomers and its application to conventional amino acid analysis J Chromatogr 352, ... w/v/v/v) and heated at 100 °C for min, after which the absorbance at 570 nm was measured Analysis of the sugar constituents in the sample was performed using the alditol acetate method [20] and the absolute...
- 9
- 353
- 0
Elucidation of levels of bacteria viability post non equilibrium dielectric barrier discharge plasma treatment
... Lab (Pasadena, CA) spacecraft assembly facility, are endowed with UV radiation H2O2 resistance capabilities that significantly exceed other Bacillus species and allow survival against standard ... florescent assays and colony counts are among the techniques needed for this facet The chemical approach adds understanding of sterilization mechanisms via the analysis of chemical reactions caused ... typical parameters of a microdischarge are listed in Table [17] Table Typical Parameters of a Microdischarge Lifetime 1-40 ns Filament radius 50-100 μm Electron avalanche duration Electron avalanche...
- 143
- 251
- 0
Báo cáo hóa học: " Process development for the elucidation of mycotoxin formation in Alternaria alternata" doc
... than 120 secondary metabolites of Alternaria species are known; a quarter of that is designated as mycotoxins (Panigrahi 1997) Five major Alternaria toxins can be found as natural contaminants ... toxicological data are available just for seven out of the 30 known Alternaria mycotoxins which is insufficient for an assessment of the health risk for the consumer As long as maximum allowable limits ... influence of water activity, temperature and light was extensively studied for different A alternata strains and media (Hasan 1995,Magan et al 1984,Pose et al 2010, Page of Schmidt-Heydt et al 2011,Söderhäll...
- 9
- 613
- 0
Báo cáo y học: "Elucidation of the potential roles of matrix metalloproteinases in skeletal biology" pps
... in the catalytic domain that resulted in markedly decreased transcription of the MMP13 gene and no apparent translation Recombinant MMP13 lacking this catalytic domain has no enzymatic activity ... Inada M, Rahman MU, Krane SM: Null mutation in collagenase-3 (matrix metalloproteinase [MMP]-13) affects maturation of growth plates [abstract] J Bone Mineral Res 2001, 16(suppl 1):S141 Inada ... they are only a few weeks of age, however, and the pathogenesis and nature of the abnormalities in bone and cartilage in the mice that survive is not yet clearly established Whatever the mechanisms...
- 3
- 309
- 0
báo cáo khoa học: " Fulminant necrotizing fasciitis following the use of herbal concoction: a case report" pdf
... unnecessary amputation Consent Written informed consent was obtained from the patient for publication of this case report and any accompanying images A copy of the written consent is available for ... final drafts, and did the revision of the manuscript and carried out the literature search ABA wrote the case summary and was a major contributor in writing the manuscript All authors read and approved ... avascular fascia planes It causes thrombosis of the affected blood vessels and devascularisation of the overlying skin As organisms and toxins are released into the bloodstream, sepsis invariably...
- 3
- 305
- 1
ELUCIDATION OF GENE REGULATORY NETWORK CONTROLLING EMBRYONIC SKELETAL DEVELOPMENT FROM THE PERSPECTIVE OF PAX1 PAX9
... a repeat-free region, with a short arm of at least 1.5kb and a long arm of at least 7kb A PmeI restriction site was added at one end of the grabbing arms to facilitate plasmid linearization for ... chondrogenesis and that they are crucial for the early stages of axial skeleton formation Currently, besides Bapx1 as one of the potential early targets, other downstream targets of Pax1 and Pax9 are not ... the craniofacial mesenchyme, foregut, appendicular skeleton, pharyngeal arch and its derivatives (maxillary and mandibular arches, thymus, parathyroid glands, ultimobranchial bodies) Both Pax genes...
- 199
- 336
- 0
Development of NMR methods for the structural elucidation of large proteins
... Xia et al 1995), NMRView (peak picking and spectrum data analysis as well as semi-automated assignment) (Johnson and Blevins 1994) and Sparky (peak picking and spectrum data analysis as well as ... structure calculation tools are available, such as CNS (Brunger, Adams et al 1998), CYANA (Guntert 2004) and Autostructure (Zheng, Huang et al 2003) A variety of computational approaches have been ... Iwadate, Asakura et al 1999; Hung and Samudrala 2003; Eghbalnia, Wang et al 2005; Wang, Chen et al 2007) It has been confirmed that 1Hα, 13 Cα, 13 Cβ, and 13 CO NMR chemical shifts for all 20 amino...
- 257
- 289
- 0
Elucidation of the physiologic role of TRIP br2 in cell cycle regulation and cancer pathogenesis
... activation of p53-mediated DNA repair/apoptotic pathways, DNA damage signals are detected by different protein kinases referred to as ataxia-telangiectasia-mutated (ATM), ataxia and rad3 related ... Duffield, Dr Masa Mizuno, Dr Satohiro Masuda, Dr Carmen de Lucas, Dr Catherine Best, Dr Alice Sheridan, Dr Tatiana Besschetnova, Dr Mike Macnak, Marcella, Savuth, Wendy, Rebekah, Said and Hakon for their ... many human cancers Apart from the identification and validation of TRIP-Br2 overexpression as a putative novel mechanism underlying human tumorigenesis, such as the case of hepatocellular carcinoma,...
- 245
- 231
- 0
Elucidation of transcription factors controlling mouse ES cell pluripotency and differentiation
... and statistical analysis 5.17 Functional annotations using the Panther database 5.18 Illumina mouse arrays 5.19 Statistical analysis of microarray data 5.20 Luciferase Reporter Assays 5.21 Cloning ... Transformation of chemically competent cells 5.23 PCR analysis of transformants 5.24 Isolation of plasmid DNA from bacteria 5.25 Preparation of bacterial stocks 5.26 Isolation of genomic DNA ... identified as an upstream regulator of Oct4 in an RNAi screen for genes that regulate Oct4 (Zhang et al., 200 6a) Sall4 is a zinc finger transcription factor from the spalt family Sall4 has a similar...
- 211
- 155
- 0
a rapid method for estiminating of noise expouse workplace
... Golmohammadi R et al: A Rapid Method for Classification of workplaces based on noise pollution is one of the necessaries for macro programming view of monitoring and controlling of noise According ... noise aggravation, for each item a modified constant was considered Determining of these constants was based on best multiple regression analysis on SPSS package Total rank of noise pollution for ... or fiber board) Mean of noise sources life More than 10 years 5-9 years Less than years Quality of maintenance of equipments Suitable Little suitable Unsuitable Rotation and duration of noise produce...
- 7
- 418
- 0
Novel design of a compacted micro-structured air-breathing PEM fuel cell as a power source for mobile phones
... can be seen that for a high nominal current density, a high fraction of the current is generated at the catalyst layer near the air inlet area, leading to under-utilization of the catalyst at ... performance and design of air-breathing PEM fuel cells Litster and Djilali [1] developed a single-phase one-dimensional semi-analytical model of the membrane electrode assembly (MEA) of planar air-breathing ... challenges for small scale and micro-fuel cells in terms of design, materials, effective transport of reactants, and heat management The development of physically representative models that allow...
- 18
- 549
- 0
Assessment of pretreatments and enzymatic hydrolysis of wheat straw as a sugar source for bioprocess industry
... precipitate and separate the fractionated biomass The pretreatment has an advantage of operating at low temperature (50 °C) which capital and operating costs and minimizes degradation reactions The ... Various organic acids, such as fumaric and maleic acids can be used instead of sulfuric acid to reduce sugar degradation reactions catalyzed sulfuric acid while attaining nearly identical sugar ... And such a whole suite of accessory enzymes is required for efficient xylan hydrolysis such as α-arabinofuranosidases and α-Larabinases that release arabinan [31], α-glucuronidases that release...
- 20
- 437
- 0
Optimal placement of horizontal - and vertical - axis wind turbines in a wind farm for maximum power generation using a genetic algorithm
... grid arrangement is also best in the case of a VAWT for optimal power generation Wake, power and cost modeling of a HAWT 2.1 Jensen's wake modeling of a HAWT All the results reported to date in ... [4] of the wake and apply it to determine the wake of a VAWT Now, the cross-section area of the streamtube is a square of width 2R and height H instead of a circle From the conservation of momentum, ... Table Case III has been taken from the paper of Yan et al [12] and Case III has a double rotor radius compared to Case IV so that the tip-speed ratio also doubles Again, the size of the farm is...
- 12
- 635
- 1
Conventional Providing a Uniform Law for Bill of exchange and Promissory Notes
... the case of a bill payable at the address of a 74 third party or in a locality other than that of the domicile of the drawee, or, except in the case of a bill drawn payable at a fixed period after ... has a direct action on the bill of exchange against the acceptor for all that can be demanded in accordance with Articles 48 and 49 Article 29 Where the drawee who has put his acceptance on a ... the drawer may prohibit presentment for acceptance He may al so stipulate that presentment for acceptance 75 shall not take place before a named date Unless the drawer has prohibited acceptance,...
- 37
- 673
- 0
Tìm thêm: khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25