Elucidation of transcription factors controlling mouse ES cell pluripotency and differentiation

AN INVESTIGATION OF THE REGULATORY NETWORK IN EMBRYONIC STEM CELLS THROUGH CHARACTERIZATION OF ZFP206 AND REST YU HONGBING NATIONAL UNIVERSITY OF SINGAPORE 2009 AN INVESTIGATION OF THE REGULATORY NETWORK IN EMBRYONIC STEM CELLS THROUGH CHARACTERIZATION OF ZFP206 AND REST YU HONGBING MSc., China A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT OF BIOLOGICAL SCIENCES NATIONAL UNIVERSITY OF SINGAPORE 2009 i ACKNOWLEDGMENTS I would like to express my greatest thanks to the following people during my years PhD study: My Parents, who give me the most selfless love in the world, and did their best to give me a bright future. My wife, with her support and love, nothing is impossible. My sister, who admires me so much that I cannot disappoint her. My supervisor, Dr. Lawrence Stanton, who gave me the valuable opportunity to pursue the stem cell research with the cutting edge technology in his lab. He provided me with the freedom to grow and develop, but always there with guidance to keep me on the correct track. I was impressed with his encouragement when my first project was scooped. Because of his encouragement and patient guidance, I quickly regained my confidence and moved forward. Special thanks also go to him for his great effort in editing my papers and correcting this thesis. I love his American style of guidance!!! Dr. Thomas Lufkin and his group members, Petra Kraus and Lim Siew Lan, for tremendous help in Zfp206 knockout project. Dr. Rory Johnson, who is very smart and reads tons of papers. He gave me a many good suggestions and was a fantastic collaborator. His help was like a glowing ember in the snow that warmed me when I needed it most. Thank you very much, my friend! Galih Kunarso, the future Doctor, so smart and so efficient. Thanks very much for your great bioinformatics analyses. It was always a pleasure to work with him. The memorable photos taken by him were a lot of fun. Hong Huimei Felicia, the future Singapore Star, her help really speeded up my project and relieved my burden. I would also like to thank Khaw Swea Ling, Wong Kee Yew, and other lab mates for their help. Thanks to Ralf Jauch and Choo Siew Hua for their help with EMSA experiments. I would also like to thank these colleagues: Andrew Hutchins, Soh Boon Seng, Luo Wenglong, Wang Caoyang, and Sun Lili. And all of those who have helped me!!! ii TABLE OF CONTENTS ACKNOWLEDGMENTS i TABLE OF CONTENTS ii SUMMARY v LIST OF TABLES vi LIST OF FIGURES vi ABBREVIATIONS ix Chapter I: Introduction……………………………………………………….1 Brief introduction 1.1 Early embryo development and stem cell fate decision 1.2 Genomics study in the embryonic stem cell 1.3 Molecular mechanisms in regulating ES cells pluripotency and differentiation 1.3.1 Extrinsic signaling pathway 1.3.2 Intrinsic determination of Pluripotency 1.3.3 MicroRNAs in ES cell Pluripotency 1.3.4 Epigenetic modification in ES cells 1.3.5 Transcriptional regulatory network in ES cells 1.4 Zfp206 1.4.1 The SCAN domain family of zinc finger transcription factors 1.4.2 The role of Zfp206 in ES cells 1.5 The role of REST and its cofactors 1.6 REST regulatory network 17 22 23 25 29 29 35 37 50 Chapter II: In vitro role of Zfp206 in mouse embryonic stem cells and in vivo role in mouse development………………………….53 2.1 Introduction 2.2 Result 2.2.1 Direct activation of Oct4 expression by Zfp206 2.2.2 Genome wide mapping of zfp206 targets in ES cells with ChIP-chip 53 56 56 59 iii 2.2.3 Zfp206 selectively activates or represses target genes 2.2.4 Zfp206 physically interacts with Oct4 and Sox2 2.2.5 Genome wide mapping of Zfp206 in ES cell with ChIP-seq 2.3 In vivo knockout of Zfp206 in mouse 2.3.1 Zfp206 Gene trap cell line generation 2.3.2 Genotyping of Zfp206 gene trap cell line with PCR 2.3.3 Southern-blot Genotype strategy for Zfp206 knockout mouse from the 285B6 gene trap cell line 2.3.4 Generation of the Zfp206 knockout mouse 2.3.5 Generation of recombinant Zfp206 knockout mouse 2.3.6 Generation of double knockout Zfp206 mouse 2.4 Discussion 70 72 74 84 84 86 94 96 99 102 104 Chapter III: The role of REST and its cofactors in ES cells ………………110 3.1 Introduction 3.2 Result 3.2.1 The role of REST and its cofactors in ES Cells 3.2.1.1 Dynamic expression profile of REST cofactors in ES Cell 3.2.1.2 Depletion of REST cofactors in ES cells 3.2.2 Genome wide mapping of REST and its cofactors’ binding sites in ES Cells 3.2.2.1 Generation of Stable REST cofactors over expressing cells 3.2.2.2 Genome wide mapping of REST and its cofactors 3.2.3 Motif analysis of REST and its cofactors 3.2.4 Co-occupancy analysis of REST and its cofactors with other TFs and epigenetic histone marks 3.2.5 Derepression of REST targets correlate with co-occupancy of REST and its cofactors 3.3 Discussion 3.3.1 The role of REST and its cofactors in ES Cells 3.3.2 Genome wide mapping of REST cofactors’ binding sites 3.3.3 The role of REST cofactors in REST mediated gene repression 110 113 113 113 116 121 121 125 129 133 137 149 149 150 152 Chapter IV : Conclusion and Perspectives…… ……………………………155 4.1 Conclusion 4.2 Perspectives 155 159 iv Chapter V: Materials and Methods………………………………………… 161 5.1 ES cell culture 5.2 Expansion and mitotic inactivation of MEF cells 5.3 Cryopreservation of cell lines 5.4 Thawing of cell lines 5.5 RNA interference (shRNA) 5.6 LIF withdrawal and Retinoic acid induced cell differentiation 5.7 RNA extraction 5.8 cDNA synthesis 5.9 Quantitative real-time PCR 5.10 Cell lysis and protein quantitation 5.11 SDS-PAGE 5.12 Protein detection and chemiluminescence detection 5.13 Co-immunoprecipitation 5.14 Chromatin Immunoprecipitation (ChIP) 5.15 Quantitative PCR for ChIP enrichment 5.16 ChIP-chip assays, data processing, and statistical analysis 5.17 Functional annotations using the Panther database 5.18 Illumina mouse arrays 5.19 Statistical analysis of microarray data 5.20 Luciferase Reporter Assays 5.21 Cloning 5.22 Transformation of chemically competent cells 5.23 PCR analysis of transformants 5.24 Isolation of plasmid DNA from bacteria 5.25 Preparation of bacterial stocks 5.26 Isolation of genomic DNA from cell lines 5.27 Southern-blot analysis 161 161 162 162 162 163 163 164 164 165 165 165 167 167 168 168 169 169 170 170 171 171 172 172 173 173 173 References 175 Appendices 197 v Summary Embryonic stem (ES) cells can be maintained in undifferentiated states for indefinite passages and yet retain the potential to differentiate into all cell types. An intricate transcriptional regulatory network is, in part, responsible for maintaining such a pluripotency state. In vitro depletion of components of this network, such as Oct4, Sox2, Nanog, and Zic3, induce distinct cellular differentiation responses. In this thesis, I provide additional details of the regulatory network in ES cell pluripotency through characterization of the transcriptional regulators, REST and Zfp206, which have emerged as regulators of ES cell pluripotency. REST has been shown to repress neuronal gene expression in neuronal stem cells (NSC) and non neuronal cells. Our group has recently shown that REST regulates distinct regulatory pathways in ES cells and NSC. By using genome wide mapping of the binding sites for REST and of its cofactors, as well as gene expression profiling upon loss of REST and each cofactors, I found that the REST complex regulates ES cell pluripotency through recruitment of its cofactors. In addition, using genome wide mapping techniques, I have identified a Zfp206 regulatory network and established a physiological interaction of Zfp206 with Oct4 and Sox2 to further expand our understanding of this transcriptional regulatory network. Genome wide mapping of Zfp206 binding sites with ChIP-seq shows that Zfp206 binding targets are enriched in developmental process, transcription regulation, and embryogenesis. Finally, a knockout of Zfp206 in mice was generated, though phenotyping is still ongoing. vi LIST OF TABLES Table Gene ontology of Zfp206 target genes Table Common transcription factors targets of Oct4, Sox2 and Zfp206 Table Gene ontology of Zfp206 ChIP-seq target genes Table Summary of the ChIP-seq libraries of REST and its cofactors 62 67 75 128 LIST OF FIGURES Figure 1.1 Origin of stem cells in the mammalian embryo Figure 1.2 Combinatorial Signaling pathways regulating the pluripotency 11 of ES cell Figure 1.3 The canonical Wnt signaling pathway 13 Figure 1.4 Intracellular signaling pathways activated through FGFRs. 16 Figure 1.5 Core Transcriptional Regulatory Network in Human ES Cells 26 Figure 1.6 Transcriptional regulatory networks in ES Cells 28 Figure 1.7 SCAN domains in the mouse genome 30 Figure 1.8 Figure 1.9 Model of the structural features of the mouse SCAN domain 32 family Conserved domains in some of the SCAN domain family 33 members Figure 1.10 Zfp206 isoforms 36 Figure 1.11 Structure of REST gene 40 Figure 1.12 Schematic Models for the Differential Regulation of REST 44 and Its Target Genes during Development Figure 1.13 REST corepressors 49 vii Figure 2.1 Mapping of Zfp206 binding sites at the Oct4 promoter 58 Figure 2.2 Validation of selected Zfp206 target genes 61 Figure 2.3 Consensus DNA motif for Zfp206 binding sites 64 Figure 2.4 Figure 2.5 Frequent co-targeting of genes by Zfp206 and other 66 pluripotency TFs. Zfp206 binding co-localizes with Zfp281, Oct4, Sox2, and 69 Nanog. Figure 2.6 Zfp206 activates and represses its target genes 71 Figure 2.7 Zfp206 physically interacts with Oct4 and Sox2 proteins 73 Figure 2.8 Consensus DNA motif for Zfp206 ChIP-seq binding sites 79 Figure 2.9 Region assignments of Zfp206 binding sites in the genome 81 Figure 2.10 Figure 2.11 Figure 2.12 Figure 2.13 Figure 2.14 Figure 2.15 multiple transcriptions factor-binding loci associated with Zfp206 Diagram of UPA trap vector based gene trap ES cell line screening 3’ RACE sequence of clone CMHD-GT_285B6 match with Zfp206 exon2 Diagram of Zfp206 285B6 clone insert and transcription product PCR genotyping of Zfp206 gene trap ES cell clone CMHD-GT_285B6 Alignment analysis of PCR product sequence with intron1 and UPA vector 83 85 87 88 90 91 Figure 2.16 New PCR genotyping design Figure 2.17 Southern blot genotyping for recombinant Zfp206 heterozygote Figure 2.18 Generation of Zfp206 gene targeting heterozygote Figure 2.19 Genotyping of the offspring of 40% Chimera with wild-type 98 mouse Figure 2.20 Mating scheme to generate recombinant Zfp206 Figure 2.21 Figure 2.22 93 non-recombinant and 95 97 100 Southern-blot analyses of Zfp206 recombinant gene trap 101 heterozygote Phenotype and genotyping of the offspring mated between 103 recombinant heterozygotes viii Figure 3.1 Figure 3.2 Figure 3.3 Figure 3.4 Figure 3.5 Alignment of CoREST homologues by consensus ClustalW sequence alignment. Gene expression profiles of REST cofactors upon differentiation Morphology of REST and its cofactors upon shRNA knockdown Knockdown efficiency of REST and its cofactors upon shRNA knockdown Lineage markers expression change upon knockdown of REST and its cofactors in ES cell 114 115 118 119 120 Figure 3.6 Over-expression construct for REST cofactors 123 Figure 3.7 Morphology of stable REST cofactor’s overexpressing cells 124 Figure 3.8 Gene expression profiles of REST cofactors in stable cells 124 Figure 3.9 REST cofactors ChIP enrichment with REST targets 126 Figure 3.10 Sin3A ChIP is enriched with REST targets. 126 Figure 3.11 Normalization of REST and its cofactors ChIP-seq data with 128 SISSRS algorithm. Figure 3.12 Identification of enriched motifs by using a de novo approach 130 Figure 3.13 Identification of enriched motifs by using a de novo approach 131 Figure 3.14 Figure 3.15 Figure 3.16 Figure 3.17 ChIP-seq sites overlapping RE1 motif for REST and its co-repressors. Multiple transcription factor-binding Loci Associated with REST and its cofactors. Multiple histones modification-Binding Loci associated with REST and its cofactors Gene expression profile of REST knockdown with REST shRNA 132 134 136 139 Figure 3.18 Recruitment of REST and its co-repressors to repressed genes 141 Figure 3.19 REST complex are preferentially recruited to derepressed 143 binding targets Figure 3.20 Recruitment of REST and its cofactors to RE1 motif 145 Figure 3.21 Recruitment of REST and its cofactors to promoter region 146 Figure 3.22 REST complex binding is correlated to active chromatin 148 markers 185 circuitries in different blastocyst-derived stem cell lineages. Cell Stem Cell 3, 543-554. Lim, L.S., Loh, Y.H., Zhang, W., Li, Y., Chen, X., Wang, Y., Bakre, M., Ng, H.H., and Stanton, L.W. (2007). Zic3 is required for maintenance of pluripotency in embryonic stem cells. Mol Biol Cell 18, 1348-1358. Logan, C.Y., and Nusse, R. (2004). The Wnt signaling pathway in development and disease. Annu Rev Cell Dev Biol 20, 781-810. Loh, Y., Wu, Q., Chew, J., Vega, V., Zhang, W., Chen, X., Bourque, G., George, J., Leong, B., Liu, J., et al. (2006a). The Oct4 and Nanog transcription network regulates pluripotency in mouse embryonic stem cells. Nature Genetics 38, 431-440. Loh, Y.H., Wu, Q., Chew, J.L., Vega, V.B., Zhang, W., Chen, X., Bourque, G., George, J., Leong, B., Liu, J., et al. (2006b). The Oct4 and Nanog transcription network regulates pluripotency in mouse embryonic stem cells. Nat Genet 38, 431-440. Loh, Y.H., Zhang, W., Chen, X., George, J., and Ng, H.H. (2007). Jmjd1a and Jmjd2c histone H3 Lys demethylases regulate self-renewal in embryonic stem cells. Genes Dev 21, 2545-2557. Lunyak, V.V., Burgess, R., Prefontaine, G.G., Nelson, C., Sze, S.H., Chenoweth, J., Schwartz, P., Pevzner, P.A., Glass, C., Mandel, G., et al. (2002). Corepressor-dependent silencing of chromosomal regions encoding neuronal genes. Science 298, 1747-1752. Marchler-Bauer, A., Anderson, J.B., Derbyshire, M.K., DeWeese-Scott, C., Gonzales, N.R., Gwadz, M., Hao, L., He, S., Hurwitz, D.I., Jackson, J.D., et al. (2007). CDD: a conserved domain database for interactive domain family analysis. Nucleic Acids Res 35, D237-240. Martin, G.R. (1981). Isolation of a pluripotent cell line from early mouse embryos cultured in medium conditioned by teratocarcinoma stem cells. Proc Natl Acad Sci U S A 78, 7634-7638. Matsuda, T., Nakamura, T., Nakao, K., Arai, T., Katsuki, M., Heike, T., and Yokota, T. (1999). STAT3 activation is sufficient to maintain an undifferentiated state of 186 mouse embryonic stem cells. Embo J 18, 4261-4269. McKeehan, W.L., Wang, F., and Kan, M. (1998). The heparan sulfate-fibroblast growth factor family: diversity of structure and function. Prog Nucleic Acid Res Mol Biol 59, 135-176. Meshorer, E., and Misteli, T. (2006). Chromatin in pluripotent embryonic stem cells and differentiation. Nat Rev Mol Cell Biol 7, 540-546. Mikkelsen, T.S., Ku, M., Jaffe, D.B., Issac, B., Lieberman, E., Giannoukos, G., Alvarez, P., Brockman, W., Kim, T.K., Koche, R.P., et al. (2007). Genome-wide maps of chromatin state in pluripotent and lineage-committed cells. Nature 448, 553-560. Miller, J., McLachlan, A.D., and Klug, A. (1985). Repetitive zinc-binding domains in the protein transcription factor IIIA from Xenopus oocytes. EMBO J 4, 1609-1614. Milne, T.A., Briggs, S.D., Brock, H.W., Martin, M.E., Gibbs, D., Allis, C.D., and Hess, J.L. (2002). MLL targets SET domain methyltransferase activity to Hox gene promoters. Mol Cell 10, 1107-1117. Mitsui, K., Tokuzawa, Y., Itoh, H., Segawa, K., Murakami, M., Takahashi, K., Maruyama, M., Maeda, M., and Yamanaka, S. (2003). The homeoprotein Nanog is required for maintenance of pluripotency in mouse epiblast and ES cells. Cell 113, 631-642. Mortazavi, A., Leeper Thompson, E.C., Garcia, S.T., Myers, R.M., and Wold, B. (2006). Comparative genomics modeling of the NRSF/REST repressor network: from single conserved sites to genome-wide repertoire. Genome Res 16, 1208-1221. Mulligan, P., Westbrook, T.F., Ottinger, M., Pavlova, N., Chang, B., Macia, E., Shi, Y.J., Barretina, J., Liu, J., Howley, P.M., et al. (2008). CDYL bridges REST and histone methyltransferases for gene repression and suppression of cellular transformation. Mol Cell 32, 718-726. Ng, H.H., Zhang, Y., Hendrich, B., Johnson, C.A., Turner, B.M., Erdjument-Bromage, H., Tempst, P., Reinberg, D., and Bird, A. (1999). MBD2 is a transcriptional repressor belonging to the MeCP1 histone deacetylase complex. Nat 187 Genet 23, 58-61. Ng, P., Wei, C.L., Sung, W.K., Chiu, K.P., Lipovich, L., Ang, C.C., Gupta, S., Shahab, A., Ridwan, A., Wong, C.H., et al. (2005). Gene identification signature (GIS) analysis for transcriptome characterization and genome annotation. Nat Methods 2, 105-111. Nichols, J., Zevnik, B., Anastassiadis, K., Niwa, H., Klewe-Nebenius, D., Chambers, I., Scholer, H., and Smith, A. (1998). Formation of pluripotent stem cells in the mammalian embryo depends on the POU transcription factor Oct4. Cell 95, 379-391. Nishimoto, M., Fukushima, A., Okuda, A., and Muramatsu, M. (1999). The gene for the embryonic stem cell coactivator UTF1 carries a regulatory element which selectively interacts with a complex composed of Oct-3/4 and Sox-2. Mol Cell Biol 19, 5453-5465. Niwa, H. (2001). Molecular mechanism to maintain stem cell renewal of ES cells. Cell Struct Funct 26, 137-148. Niwa, H., Burdon, T., Chambers, I., and Smith, A. (1998). Self-renewal of pluripotent embryonic stem cells is mediated via activation of STAT3. Genes Dev 12, 2048-2060. Niwa, H., Miyazaki, J., and Smith, A.G. (2000). Quantitative expression of Oct-3/4 defines differentiation, dedifferentiation or self-renewal of ES cells. Nat Genet 24, 372-376. Niwa, H., Toyooka, Y., Shimosato, D., Strumpf, D., Takahashi, K., Yagi, R., and Rossant, J. (2005). Interaction between Oct3/4 and Cdx2 determines trophectoderm differentiation. Cell 123, 917-929. Nohe, A., Keating, E., Knaus, P., and Petersen, N.O. (2004). Signal transduction of bone morphogenetic protein receptors. Cell Signal 16, 291-299. Nomura, M., Uda-Tochio, H., Murai, K., Mori, N., and Nishimura, Y. (2005). The neural repressor NRSF/REST binds the PAH1 domain of the Sin3 corepressor by using its distinct short hydrophobic helix. J Mol Biol 354, 903-915. Olguin, P., Oteiza, P., Gamboa, E., Gomez-Skarmeta, J.L., and Kukuljan, M. (2006). 188 RE-1 silencer of transcription/neural restrictive silencer factor modulates ectodermal patterning during Xenopus development. J Neurosci 26, 2820-2829. Ooi, L., and Wood, I.C. (2007). Chromatin crosstalk in development and disease: lessons from REST. Nat Rev Genet 8, 544-554. Orkin, S.H. (2005). Chipping away at the embryonic stem cell network. Cell 122, 828-830. Palm, K., Belluardo, N., Metsis, M., and Timmusk, T. (1998). Neuronal expression of zinc finger transcription factor REST/NRSF/XBR gene. J Neurosci 18, 1280-1296. Palmieri, S.L., Peter, W., Hess, H., and Scholer, H.R. (1994). Oct-4 transcription factor is differentially expressed in the mouse embryo during establishment of the first two extraembryonic cell lineages involved in implantation. Dev Biol 166, 259-267. Paquette, A.J., Perez, S.E., and Anderson, D.J. (2000). Constitutive expression of the neuron-restrictive silencer factor (NRSF)/REST in differentiating neurons disrupts neuronal gene expression and causes axon pathfinding errors in vivo. Proc Natl Acad Sci U S A 97, 12318-12323. Park, E.J., Schroen, D.J., Yang, M., Li, H., Li, L., and Chen, J.D. (1999). SMRTe, a silencing mediator for retinoid and thyroid hormone receptors-extended isoform that is more related to the nuclear receptor corepressor. Proc Natl Acad Sci U S A 96, 3519-3524. Pavesi, G., Mauri, G., and Pesole, G. (2001). An algorithm for finding signals of unknown length in DNA sequences. Bioinformatics 17 Suppl 1, S207-214. Pavletich, N.P., and Pabo, C.O. (1991). Zinc finger-DNA recognition: crystal structure of a Zif268-DNA complex at 2.1 A. Science 252, 809-817. Pengue, G., Calabro, V., Bartoli, P.C., Pagliuca, A., and Lania, L. (1994). Repression of transcriptional activity at a distance by the evolutionarily conserved KRAB domain present in a subfamily of zinc finger proteins. Nucleic Acids Res 22, 2908-2914. 189 Pereira, L., Yi, F., and Merrill, B.J. (2006). Repression of Nanog gene transcription by Tcf3 limits embryonic stem cell self-renewal. Mol Cell Biol 26, 7479-7491. Pile, L.A., Lee, F.W., and Wassarman, D.A. (2001). The histone deacetylase inhibitor trichostatin A influences the development of Drosophila melanogaster. Cell Mol Life Sci 58, 1715-1718. Purandare, S.M., Ware, S.M., Kwan, K.M., Gebbia, M., Bassi, M.T., Deng, J.M., Vogel, H., Behringer, R.R., Belmont, J.W., and Casey, B. (2002). A complex syndrome of left-right axis, central nervous system and axial skeleton defects in Zic3 mutant mice. Development 129, 2293-2302. Pyle, A.D., Lock, L.F., and Donovan, P.J. (2006). Neurotrophins mediate human embryonic stem cell survival. Nat Biotechnol 24, 344-350. Ralston, A., and Rossant, J. (2005). Genetic regulation of stem cell origins in the mouse embryo. Clin Genet 68, 106-112. Ramalho-Santos, M., Yoon, S., Matsuzaki, Y., Mulligan, R.C., and Melton, D.A. (2002). "Stemness": transcriptional profiling of embryonic and adult stem cells. Science 298, 597-600. Rana, T.M. (2007). Illuminating the silence: understanding the structure and function of small RNAs. Nat Rev Mol Cell Biol 8, 23-36. Reubinoff, B.E., Pera, M.F., Fong, C.Y., Trounson, A., and Bongso, A. (2000). Embryonic stem cell lines from human blastocysts: somatic differentiation in vitro. Nat Biotechnol 18, 399-404. Rietze, R.L., and Reynolds, B.A. (2006). Neural stem cell isolation and characterization. Methods Enzymol 419, 3-23. Rodda, D., Chew, J., Lim, L., Loh, Y., Wang, B., Ng, H., and Robson, P. (2005a). Transcriptional regulation of nanog by OCT4 and SOX2. J Biol Chem 280, 24731-24737. Rodda, D.J., Chew, J.L., Lim, L.H., Loh, Y.H., Wang, B., Ng, H.H., and Robson, P. (2005b). Transcriptional regulation of nanog by OCT4 and SOX2. J Biol Chem 280, 24731-24737. 190 Roopra, A., Qazi, R., Schoenike, B., Daley, T.J., and Morrison, J.F. (2004). Localized domains of G9a-mediated histone methylation are required for silencing of neuronal genes. Mol Cell 14, 727-738. Rosner, M.H., Vigano, M.A., Ozato, K., Timmons, P.M., Poirier, F., Rigby, P.W., and Staudt, L.M. (1990). A POU-domain transcription factor in early stem cells and germ cells of the mammalian embryo. Nature 345, 686-692. Rossant, J. (2007). Stem cells and lineage development in the mammalian blastocyst. Reprod Fertil Dev 19, 111-118. Saleque, S., Kim, J., Rooke, H.M., and Orkin, S.H. (2007). Epigenetic regulation of hematopoietic differentiation by Gfi-1 and Gfi-1b is mediated by the cofactors CoREST and LSD1. Mol Cell 27, 562-572. Sander, T.L., Haas, A.L., Peterson, M.J., and Morris, J.F. (2000). Identification of a novel SCAN box-related protein that interacts with MZF1B. The leucine-rich SCAN box mediates hetero- and homoprotein associations. J Biol Chem 275, 12857-12867. Sander, T.L., Stringer, K.F., Maki, J.L., Szauter, P., Stone, J.R., and Collins, T. (2003). The SCAN domain defines a large family of zinc finger transcription factors. Gene 310, 29-38. Sato, N., Meijer, L., Skaltsounis, L., Greengard, P., and Brivanlou, A.H. (2004). Maintenance of pluripotency in human and mouse embryonic stem cells through activation of Wnt signaling by a pharmacological GSK-3-specific inhibitor. Nat Med 10, 55-63. Schoenherr, C.J., and Anderson, D.J. (1995). The neuron-restrictive silencer factor (NRSF): a coordinate repressor of multiple neuron-specific genes. Science 267, 1360-1363. Scholer, H.R., Dressler, G.R., Balling, R., Rohdewohld, H., and Gruss, P. (1990). Oct-4: a germline-specific transcription factor mapping to the mouse t-complex. EMBO J 9, 2185-2195. Sharma, V., Swaminathan, A., Bao, R., and Pile, L.A. (2008). Drosophila SIN3 is required at multiple stages of development. Dev Dyn 237, 3040-3050. 191 Shi, Y., Lan, F., Matson, C., Mulligan, P., Whetstine, J.R., Cole, P.A., and Casero, R.A. (2004). Histone demethylation mediated by the nuclear amine oxidase homolog LSD1. Cell 119, 941-953. Shi, Y., Sawada, J., Sui, G., Affar el, B., Whetstine, J.R., Lan, F., Ogawa, H., Luke, M.P., and Nakatani, Y. (2003). Coordinated histone modifications mediated by a CtBP co-repressor complex. Nature 422, 735-738. Silverstein, R.A., and Ekwall, K. (2005). Sin3: a flexible regulator of global gene expression and genome stability. Curr Genet 47, 1-17. Singh, S.K., Kagalwala, M.N., Parker-Thornburg, J., Adams, H., and Majumder, S. (2008). REST maintains self-renewal and pluripotency of embryonic stem cells. Nature 453, 223-227. Smith, A. (2001). Embryo-derived stem cells: of mice and men. Annu Rev Cell Dev Biol 17, 435-462. Solari, F., Bateman, A., and Ahringer, J. (1999). The Caenorhabditis elegans genes egl-27 and egr-1 are similar to MTA1, a member of a chromatin regulatory complex, and are redundantly required for embryonic patterning. Development 126, 2483-2494. Stanton, L.W., and Bakre, M.M. (2007). Genomic and proteomic characterization of embryonic stem cells. Curr Opin Chem Biol 11, 399-404. Stewart, C.L., Kaspar, P., Brunet, L.J., Bhatt, H., Gadi, I., Kontgen, F., and Abbondanzo, S.J. (1992). Blastocyst implantation depends on maternal expression of leukaemia inhibitory factor. Nature 359, 76-79. Strahl, B.D., and Allis, C.D. (2000). The language of covalent histone modifications. Nature 403, 41-45. Strumpf, D., Mao, C.A., Yamanaka, Y., Ralston, A., Chawengsaksophak, K., Beck, F., and Rossant, J. (2005). Cdx2 is required for correct cell fate specification and differentiation of trophectoderm in the mouse blastocyst. Development 132, 2093-2102. Su, X., Kameoka, S., Lentz, S., and Majumder, S. (2004). Activation of REST/NRSF 192 target genes in neural stem cells is sufficient to cause neuronal differentiation. Mol Cell Biol 24, 8018-8025. Suh, M.R., Lee, Y., Kim, J.Y., Kim, S.K., Moon, S.H., Lee, J.Y., Cha, K.Y., Chung, H.M., Yoon, H.S., Moon, S.Y., et al. (2004). Human embryonic stem cells express a unique set of microRNAs. Dev Biol 270, 488-498. Takahashi, K., and Yamanaka, S. (2006). Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126, 663-676. Tam, W.L., Lim, C.Y., Han, J., Zhang, J., Ang, Y.S., Ng, H.H., Yang, H., and Lim, B. (2008). T-cell factor regulates embryonic stem cell pluripotency and self-renewal by the transcriptional control of multiple lineage pathways. Stem Cells 26, 2019-2031. Tanaka, S., Kunath, T., Hadjantonakis, A.K., Nagy, A., and Rossant, J. (1998). Promotion of trophoblast stem cell proliferation by FGF4. Science 282, 2072-2075. Tay, Y., Zhang, J., Thomson, A.M., Lim, B., and Rigoutsos, I. (2008). MicroRNAs to Nanog, Oct4 and Sox2 coding regions modulate embryonic stem cell differentiation. Nature 455, 1124-1128. Thillainadesan, G., Isovic, M., Loney, E., Andrews, J., Tini, M., and Torchia, J. (2008). Genome analysis identifies the p15ink4b tumor suppressor as a direct target of the ZNF217/CoREST complex. Mol Cell Biol 28, 6066-6077. Thomson, J.A., Itskovitz-Eldor, J., Shapiro, S.S., Waknitz, M.A., Swiergiel, J.J., Marshall, V.S., and Jones, J.M. (1998). Embryonic stem cell lines derived from human blastocysts. Science 282, 1145-1147. Tomari, Y., and Zamore, P.D. (2005). MicroRNA biogenesis: drosha can't cut it without a partner. Curr Biol 15, R61-64. Tomioka, M., Nishimoto, M., Miyagi, S., Katayanagi, T., Fukui, N., Niwa, H., Muramatsu, M., and Okuda, A. (2002). Identification of Sox-2 regulatory region which is under the control of Oct-3/4-Sox-2 complex. Nucleic Acids Res 30, 3202-3213. Tontsch, S., Zach, O., and Bauer, H.C. (2001). Identification and localization of 193 M-CoREST (1A13), a mouse homologue of the human transcriptional co-repressor CoREST, in the developing mouse CNS. Mech Dev 108, 165-169. Tupler, R., Perini, G., and Green, M.R. (2001). Expressing the human genome. Nature 409, 832-833. Varga, A.C., and Wrana, J.L. (2005). The disparate role of BMP in stem cell biology. Oncogene 24, 5713-5721. Wang, H., Clark, I., Nicholson, P.R., Herskowitz, I., and Stillman, D.J. (1990). The Saccharomyces cerevisiae SIN3 gene, a negative regulator of HO, contains four paired amphipathic helix motifs. Mol Cell Biol 10, 5927-5936. Wang, J., Rao, S., Chu, J., Shen, X., Levasseur, D.N., Theunissen, T.W., and Orkin, S.H. (2006). A protein interaction network for pluripotency of embryonic stem cells. Nature 444, 364-368. Wang, L., Schulz, T.C., Sherrer, E.S., Dauphin, D.S., Shin, S., Nelson, A.M., Ware, C.B., Zhan, M., Song, C.Z., Chen, X., et al. (2007a). Self-renewal of human embryonic stem cells requires insulin-like growth factor-1 receptor and ERBB2 receptor signaling. Blood. Wang, S.H., Tsai, M.S., Chiang, M.F., and Li, H. (2003). A novel NK-type homeobox gene, ENK (early embryo specific NK), preferentially expressed in embryonic stem cells. Gene Expr Patterns 3, 99-103. Wang, Z.X., Kueh, J.L., Teh, C.H., Rossbach, M., Lim, L., Li, P., Wong, K.Y., Lufkin, T., Robson, P., and Stanton, L.W. (2007b). Zfp206 is a transcription factor that controls pluripotency of embryonic stem cells. Stem Cells 25, 2173-2182. Wang, Z.X., Teh, C.H., Chan, C.M., Chu, C., Rossbach, M., Kunarso, G., Allapitchay, T.B., Wong, K.Y., and Stanton, L.W. (2008). The Transcription Factor Zfp281 Controls Embryonic Stem Cell Pluripotency By Direct Activation And Repression Of Target Genes. Stem Cells. Wang, Z.X., Teh, C.H., Kueh, J.L., Lufkin, T., Robson, P., and Stanton, L.W. (2007c). Oct4 and Sox2 directly regulate expression of another pluripotency transcription factor Zfp206 in embryonic stem cells. J Biol Chem. 194 Ware, C.B., Horowitz, M.C., Renshaw, B.R., Hunt, J.S., Liggitt, D., Koblar, S.A., Gliniak, B.C., McKenna, H.J., Papayannopoulou, T., Thoma, B., et al. (1995). Targeted disruption of the low-affinity leukemia inhibitory factor receptor gene causes placental, skeletal, neural and metabolic defects and results in perinatal death. Development 121, 1283-1299. Watanabe, Y., Kameoka, S., Gopalakrishnan, V., Aldape, K.D., Pan, Z.Z., Lang, F.F., and Majumder, S. (2004). Conversion of myoblasts to physiologically active neuronal phenotype. Genes Dev 18, 889-900. Wei, C., Miura, T., Robson, P., Lim, S., Xu, X., Lee, M., Gupta, S., Stanton, L., Luo, Y., Schmitt, J., et al. (2005a). Transcriptome profiling of human and murine ESCs identifies divergent paths required to maintain the stem cell state. Stem Cells 23, 166-185. Wei, C.L., Miura, T., Robson, P., Lim, S.K., Xu, X.Q., Lee, M.Y., Gupta, S., Stanton, L., Luo, Y., Schmitt, J., et al. (2005b). Transcriptome profiling of human and murine ESCs identifies divergent paths required to maintain the stem cell state. Stem Cells 23, 166-185. Wei, C.L., Ng, P., Chiu, K.P., Wong, C.H., Ang, C.C., Lipovich, L., Liu, E.T., and Ruan, Y. (2004). 5' Long serial analysis of gene expression (LongSAGE) and 3' LongSAGE for transcriptome characterization and genome annotation. Proc Natl Acad Sci U S A 101, 11701-11706. Weissman, I.L., Anderson, D.J., and Gage, F. (2001). Stem and progenitor cells: origins, phenotypes, lineage commitments, and transdifferentiations. Annu Rev Cell Dev Biol 17, 387-403. Westbrook, T.F., Martin, E.S., Schlabach, M.R., Leng, Y., Liang, A.C., Feng, B., Zhao, J.J., Roberts, T.M., Mandel, G., Hannon, G.J., et al. (2005). A genetic screen for candidate tumor suppressors identifies REST. Cell 121, 837-848. Wiles, M.V., and Johansson, B.M. (1999). Embryonic stem cell development in a chemically defined medium. Exp Cell Res 247, 241-248. Williams, A.J., Blacklow, S.C., and Collins, T. (1999). The zinc finger-associated SCAN box is a conserved oligomerization domain. Mol Cell Biol 19, 8526-8535. 195 Williams, R.L., Hilton, D.J., Pease, S., Willson, T.A., Stewart, C.L., Gearing, D.P., Wagner, E.F., Metcalf, D., Nicola, N.A., and Gough, N.M. (1988). Myeloid leukaemia inhibitory factor maintains the developmental potential of embryonic stem cells. Nature 336, 684-687. Wolfe, S.A., Nekludova, L., and Pabo, C.O. (2000). DNA recognition by Cys2His2 zinc finger proteins. Annu Rev Biophys Biomol Struct 29, 183-212. Wood, I.C., Belyaev, N.D., Bruce, A.W., Jones, C., Mistry, M., Roopra, A., and Buckley, N.J. (2003). Interaction of the repressor element 1-silencing transcription factor (REST) with target genes. J Mol Biol 334, 863-874. Wu, J., and Xie, X. (2006). Comparative sequence analysis reveals an intricate network among REST, CREB and miRNA in mediating neuronal gene expression. Genome Biol 7, R85. Wu, Q., Chen, X., Zhang, J., Loh, Y.H., Low, T.Y., Zhang, W., Sze, S.K., Lim, B., and Ng, H.H. (2006). Sall4 interacts with Nanog and co-occupies Nanog genomic sites in embryonic stem cells. J Biol Chem 281, 24090-24094. Xu, R.H., Chen, X., Li, D.S., Li, R., Addicks, G.C., Glennon, C., Zwaka, T.P., and Thomson, J.A. (2002). BMP4 initiates human embryonic stem cell differentiation to trophoblast. Nat Biotechnol 20, 1261-1264. Yamaguchi, T.P., Harpal, K., Henkemeyer, M., and Rossant, J. (1994). fgfr-1 is required for embryonic growth and mesodermal patterning during mouse gastrulation. Genes Dev 8, 3032-3044. Yamanaka, Y., Ralston, A., Stephenson, R.O., and Rossant, J. (2006). Cell and molecular regulation of the mouse blastocyst. Dev Dyn 235, 2301-2314. Yang, Q., Kong, Y., Rothermel, B., Garry, D.J., Bassel-Duby, R., and Williams, R.S. (2000). The winged-helix/forkhead protein myocyte nuclear factor beta (MNF-beta) forms a co-repressor complex with mammalian sin3B. Biochem J 345 Pt 2, 335-343. Yeo, S., Jeong, S., Kim, J., Han, J.S., Han, Y.M., and Kang, Y.K. (2007). Characterization of DNA methylation change in stem cell marker genes during differentiation of human embryonic stem cells. Biochem Biophys Res Commun 359, 536-542. 196 Yeom, Y.I., Fuhrmann, G., Ovitt, C.E., Brehm, A., Ohbo, K., Gross, M., Hubner, K., and Scholer, H.R. (1996). Germline regulatory element of Oct-4 specific for the totipotent cycle of embryonal cells. Development 122, 881-894. Yi, F., Pereira, L., and Merrill, B.J. (2008). Tcf3 functions as a steady-state limiter of transcriptional programs of mouse embryonic stem cell self-renewal. Stem Cells 26, 1951-1960. Ying, Q.L., Nichols, J., Chambers, I., and Smith, A. (2003a). BMP induction of Id proteins suppresses differentiation and sustains embryonic stem cell self-renewal in collaboration with STAT3. Cell 115, 281-292. Ying, Q.L., Stavridis, M., Griffiths, D., Li, M., and Smith, A. (2003b). Conversion of embryonic stem cells into neuroectodermal precursors in adherent monoculture. Nat Biotechnol 21, 183-186. Yoshida, K., Chambers, I., Nichols, J., Smith, A., Saito, M., Yasukawa, K., Shoyab, M., Taga, T., and Kishimoto, T. (1994). Maintenance of the pluripotential phenotype of embryonic stem cells through direct activation of gp130 signalling pathways. Mech Dev 45, 163-171. You, A., Tong, J.K., Grozinger, C.M., and Schreiber, S.L. (2001). CoREST is an integral component of the CoREST- human histone deacetylase complex. Proc Natl Acad Sci U S A 98, 1454-1458. Yuan, H., Corbi, N., Basilico, C., and Dailey, L. (1995). Developmental-specific activity of the FGF-4 enhancer requires the synergistic action of Sox2 and Oct-3. Genes Dev 9, 2635-2645. Zhang, J., Tam, W.L., Tong, G.Q., Wu, Q., Chan, H.Y., Soh, B.S., Lou, Y., Yang, J., Ma, Y., Chai, L., et al. (2006a). Sall4 modulates embryonic stem cell pluripotency and early embryonic development by the transcriptional regulation of Pou5f1. Nat Cell Biol 8, 1114-1123. Zhang, Q., Piston, D.W., and Goodman, R.H. (2002). Regulation of corepressor function by nuclear NADH. Science 295, 1895-1897. Zhang, W., Walker, E., Tamplin, O.J., Rossant, J., Stanford, W.L., and Hughes, T.R. (2006b). Zfp206 regulates ES cell gene expression and differentiation. Nucleic Acids 197 Res 34, 4780-4790. Zhang, X., Zhang, J., Wang, T., Esteban, M.A., and Pei, D. (2008). Esrrb activates Oct4 transcription and sustains self-renewal and pluripotency in embryonic stem cells. J Biol Chem 283, 35825-35833. Zhang, Y., LeRoy, G., Seelig, H.P., Lane, W.S., and Reinberg, D. (1998). The dermatomyositis-specific autoantigen Mi2 is a component of a complex containing histone deacetylase and nucleosome remodeling activities. Cell 95, 279-289. Zhao, L.J., Subramanian, T., and Chinnadurai, G. (2006). Changes in C-terminal binding protein (CtBP2) corepressor complex induced by E1A and modulation of E1A transcriptional activity by CtBP2. J Biol Chem 281, 36613-36623. Zhu, L., Swergold, G.D., and Seldin, M.F. (2003). Examination of sequence homology between human chromosome 20 and the mouse genome: intense conservation of many genomic elements. Hum Genet 113, 60-70. 198 Appendix Common targets of Zfp206, Oct4 and Sox2 Zfp521 Gene Zfp536 Symbol Zfp623 Arid5b Zfp64 NM_145492 NM_172385 Accession ID NM_030199 Symbol Lass6 Col14a1 Lats2 NM_030697 NM_026324 Accession ID NM_172856 Ppp1r7 Top1 Ppp2r2d NM_023200 NM_009408 NM_026391 D14Ertd436e Lnpep D230025D16 NM_172599 NM_172827 Prps1 Trim2 NM_021463 NM_030706 NM_019740 NM_178682 NM_028767 NM_025341 Rik Lrpprc Dido1 Mbd3 NM_145604 NM_028233 NM_177852 NM_013595 Ptch1 Tssk3 Ptma Ttc39b NM_008957 NM_080442 NM_008972 NM_027238 NM_010437 NM_177678 NM_008267 NM_199035 Dnajc7 Mettl11a Dpagt1 Msh2 NM_019795 NM_170592 NM_007875 NM_008628 Ptprg Ubb Ptprk Ubn2 NM_008981 NM_011664 NM_008983 NM_177185 NM_021878 NM_007439 NM_008416 NM_175344 Ebf1 Msra Ebf3 Mtap7d1 NM_007897 NM_026322 NM_010096 NM_144941 Rbbp7 Unc5b Rbm14 Vegfc NM_009031 NM_029770 NM_019869 NM_009506 NM_008452 Eif2c1 NM_153403 Rdh10 Klf9 Ap3b1 Lbxcor1 Ap3b2 NM_010638 NM_009680 NM_172446 NM_021492 Elfn1 Mtrr Enox1 Myo10 NM_175522 NM_172480 NM_172813 NM_019472 Reep3 Wapal Rell1 Wbscr17 NM_133832 NM_001004 NM_178606 436 Lmx1b Apbb2 Meis1 Arhgef18 NM_010725 NM_009686 NM_010789 NM_133962 Epb4.1l4a Ncam1 Ephb1 Npr3 NM_013512 NM_010875 NM_173447 NM_008728 Rgma Wdfy2 Rhof Wdr23 Meis2 Banp Mtf2 Bend3 NM_010825 NM_016812 NM_013827 NM_199028 Eya4 Nudcd2 Fam98a Nxn NM_010167 NM_026023 NM_133747 NM_008750 Rims2 Wipi2 Rnf111 Wnt5a Mybl2 NM_008652 NM_001037 NM_008506 758 Fgf9 NM_013518 Rnf220 NM_033604 NM_009524 NM_025739 NM_010896 NM_027909 Frem2 Pacrg Fto Palm2 NM_172862 NM_027032 NM_011936 NM_172868 Rnf32 Wwox Rps6ka5 Xpa NM_021470 NM_019573 NM_153587 NM_011728 Cacna1a Nfat5 Cep120 NM_007578 NM_133957 NM_178686 Pdcl2 G2e3 Pdgfa NM_001015 NM_023508 099 NM_008808 Xrcc5 Rsbn1 Ylpm1 NM_009533 NM_172684 NM_178363 Nfib NM_008687 NM_001003 NM_144841 908 Gadd45g NM_011817 Sae1 NM_019748 Gbf1 Pigl Gm672 Plcb1 NM_178930 NM_001039536 NM_201354 NM_019677 Sars Zfp428 Schip1 Zmiz1 NM_011319 NM_146183 NM_013928 NM_183208 Gnai2 NM_008138 Sec14l1 NM_028777 Foxp4 Abhd6 Hivep2 Ablim2 Hoxb13 Alg8 Jarid2 Alk Junb Ano6 Klf2 Mycl1 Btrc Neurog1 C2cd2l Otx2 Cltc Pax3 Cnnm2 Csgalnact1 Lef1 Cuedc1 NM_183186 NM_028888 NM_019641 Accession ID NM_028034 NM_172753 NM_010703 NM_198013 4933426 Foxo3 M11Rik NM_007865 NM_026886 NM_019454 Symbol Tdrd12 Poli Tnrc18 NM_016866 Polr3b Dll4 4931428 Foxn3 F04Rik Cpne5 NM_181277 NM_015771 NM_153166 Stk39 Gene Stmn1 NM_011972 NM_178242 NM_027423 Cited2 1500001 Dll1 A10Rik NM_023598 NM_009564 NM_010828 Kank3 Gene Kirrel3 NM_145923 NM_145218 NM_177740 NM_175546 NM_175092 NM_133734 NM_053271 NM_178398 Pax5 NM_008781 NM_033569 NM_008782 Pbx3 NM_016768 Gss NM_008180 Sema5b NM_013661 Pou5f1 NM_013633 Hmgcr NM_008255 Senp2 NM_029457 Rax NM_013833 Hmgxb4 NM_178017 Sfpq NM_023603 Sall1 NM_021390 Hs3st3b1 NM_018805 Slc25a36 NM_138756 Sall4 NM_201396 Igf1r NM_010513 Slc39a14 NM_144808 Satb2 NM_139146 Igf2bp1 NM_009951 Smarca2 NM_011416 Smyd3 NM_027188 Il17rd NM_134437 Smarcc1 NM_009211 Ssrp1 NM_182990 Immp2l NM_053122 Smtnl2 NM_177776 Tle1 NM_011599 Iqgap1 NM_016721 Spon1 NM_145584 Zbtb40 NM_198248 Itgb3 NM_016780 Srd5a1 NM_175283 Kank1 NM_181404 Stk38 NM_134115 NM_001024 Zbtb45 699 199 Appendix Oligos used in this study Oligo sequences for Zfp206 ChIP-chip targets validation PCR primers used in this study Gene name region klf4 inside Wnt3a promoter Bmp4 promoter Sox17 Foxa1 Bmp6 promoter promoter inside mmu-mir-124a-1 promoter Nr2f2 inside Hoxa1 neurog2 gata3 promoter promoter promoter Foxa3 promoter Foxd2 promoter fgf9 mrg1 gata4 promoter promoter promoter Hoxa11 promoter Wnt6 promoter Nkx2.2 klf5 promoter promoter Sequence Application Forward CGGGACTCAGTGTAGGGGTA ChIP-PCR Reverse GTGCCCCAAGATTAAGCAAG Forward CACCGGTTAGTAGCCTTCCA Reverse CAGGATGTGGCAGAACAGAA Forward AACACACTCGCACACTCCAG Reverse GCCGCTCCTTCTAACTTTCC Forward TGTGAGTGGGCCATATTTCA Reverse GTGCCAGGCTTCTAGTCCAG Forward GGGTTCAAAGCCAATTCAGA Reverse AGTAGTGGCACTCGCTGGTT Forward CTGCCGAGAGGAAAGCTAGA Reverse TGGCTTGTAGGACAGTCGTG Forward TCCCACAGATCCTGGTAAGG Reverse GAGAGGAAAGGGATGGGAAG Forward GGCAACCACTCCTCACAAAT Reverse ACGAAAGGTGCCCTAAGGAT Forward GAACCATGGTGAATGTGCTG Reverse CCAGAGAGCTGGGTTCGTAG Forward TCCACCGGCAGTAACTAACC Reverse TAAGCCTCCGAGTGAGCTGT Forward GTCTTTGGCTCCTGCAGTTC Reverse CTTACCCTTTCCCCAAGAGG Forward CGTTTAAGTAGCCCGCAGAG Reverse CGGAGTCCCTCTCCCTAGAC Forward CCTCTCCGACCAGTGTGTTT Reverse TAACGGGCTGCTTTACTGCT Forward CATTGGAACCTTCTCCCTGA Reverse TCGCATCTTTGAGTTGTTCG Forward CTTTCTCGCTCGCTCTCACT Reverse GTTCCGTCATTTCGTTCTCC Forward GGGTCCAATCAAAAGGATGA Reverse TAATAGGGCCCTGTGATTGC Forward ATGCCGATTGCGTTTAGTTC Reverse GTGAAAACCAAGGACCCTCA Forward GCTGTCTTATCTCCCCCACA Reverse CAGCCCAACGAACTTAGGAG Forward AAGGCCTCCCAGAGAGAGTC Reverse AGGTCCTCGCAGACTTGAAA Forward CGTGGGCCTTCTTTCCTACT ChIP-PCR ChIP-PCR ChIP-PCR ChIP-PCR ChIP-PCR ChIP-PCR ChIP-PCR ChIP-PCR ChIP-PCR ChIP-PCR ChIP-PCR ChIP-PCR ChIP-PCR ChIP-PCR ChIP-PCR ChIP-PCR ChIP-PCR ChIP-PCR ChIP-PCR 200 Dnmt1 Mbd3 Pitx2 insider promoter promoter Reverse AAGCTCCACCAGCAACCTAA Forward AGAGAGTGGGGGAAGACCAT Reverse GGCAAGCAAACCAGAGTCAT Forward CAGCTCCTCGGCTTAAAATG Reverse ACACTGTGCTTCCGGAGTCT Forward CCACTGCCCCTGTAGACAAT Reverse AGCAAAGTCTGGGTGGCTTA Primer used for promoter luciferase constructs cloning OCT4-PROMOTER KLF4-INSIDER KF5-PROMOTER MEIS2-PROMOTER FOXA2-PROMOTER MEIS1 -PROMOTER JARID1C-PROMOTER MIR-124A-1-PROMOTER MIR-124A-2-PROMOTER Forward CTCGAGCAGGGTGAATTTGGTGAAGTC Reverse AAGCTTGGGGAAGGTGGGCACCCC Forward CTCGAGTGTGACTGCATCTGGTCTGG Reverse AAGCTT CGTGGCTGAGCTCCTGCG Forward AAGCTTTGCCCCGCGACTACTGACA Reverse AAGCTTAACCTAAGAGAGCGCGTACC Forward CTCGAGCCCCTAGACTCTCAATGGTG Reverse AAGCTTCAGTCTGCGCTCCAATAAAC Forward GAGCTCCGGAAAAGAGATCGCCCTA Reverse AGATCTAGGGAGAAGTGGGGTGACAG Forward GATATCGACGTCCGGACTCAAAGTGA Reverse AAGCTTGTGGTGAATGAATGATCGTCC Forward GAGCTCGGAGACAAGAACTCACTGTAC Reverse CTCGAGGTCTCAGGCTGAGGTTCCTT Forward GAGCTCGGACGACTGCCTGAAAGGATA Reverse CTCGAGCAAGGTCCGCTGTGAACACG Forward CTCGAGCGATTTTCATGCGAGAACTCTT Reverse AAGCTTATCAAGGTCCGCTGTGAACAC ChIP-PCR ChIP-PCR ChIP-PCR [...]... wide mapping of transcription factors binding sites in ES cells has improved our understanding in ES cell pluripotency by revealing some of the regulatory circuitry that operates in these cells Recently, many details of a comprehensive transcriptional regulatory network, responsible for ES cell pluripotency, have been reported However, our understanding of this network is still limited My thesis will... of the molecular mechanisms regulating ES cell pluripotency and differentiation 1.1 Early embryo development and stem cell fate decision During development of the early mouse embryo, a series of multipotential cells appear transiently in the embryo Several of these have been isolated and cultured providing convenient sources of stem cells from these early embryos, such as embryonic stem cells (ES cells),... expression arrays can identify the genes regulated by these transcription factors, but cannot tell whether these genes are direct downstream targets Using the ChIP-chip, ChIP-PET and ChIP-seq technologies, one can now uncover the genome-wide binding sites of transcription factors These technologies have successfully identified Oct4, Sox2 and Nanog transcriptional networks in mouse and human ES cells... development of mammals (Smith, 2001) Disclosing the underlying regulatory mechanisms that control ES cell pluripotency and differentiation will greatly advance the use of ES cells for cell- based therapy and also shed light on early embryonic development In recent decades, much effort has been expended to understand ES cell pluripotency and significant progress has been made Several master regulators of ES cell. .. mapping of the binding sites of these three transcription factors in ES cells with ChIP-chip and ChIP-PET shows they co-localize significantly to large groups of common target genes, thus forming a core transcriptional regulatory network, which include themselves, developmentally important genes, chromatin remodeling genes, ES cell specific transcription factors, and various lineage specific genes (Figure... nuclear orphan receptor family, is essential for ES cell pluripotency Knockdown of Esrrb with shRNA or siRNA has been shown to induce differentiation of mouse ES cells in the presence of LIF (Ivanova et al., 2006) (Loh et al., 2006b) It has been shown that Esrrb and Oct4 reciprocally regulate each other to maintain ES cell pluripotency (Zhang et al., 2008) The pull-down of Esrrb with Nanog further confirmed... to transcriptionally repress Oct4 in ES cells, and loss of Tcf3 by RNA interference (RNAi) knockdown blocks the ability of ES cells to differentiate (Tam et al., 2008) Genome wide mapping of Tcf3 binding sites showed that its targets are associated with stem cell pluripotency, developmental processes, signaling pathways, and oncogenesis Tcf3 is up-regulated upon differentiation, and its target genes... Epigenetic modification in ES cells ES cells must activate a set of genes to maintain pluripotency and silence other genes to prevent differentiation This is achieved, in part, by modification of chromatin through the interplay of transcription regulators and histone modifiers ES cells have been shown to maintain a hyperdynamic state of chromatin compared with differentiated cells (Meshorer and Misteli, 2006)... identify ES cell specific molecular signatures by comparing differentiated cells with other stem cells (Ivanova et al., 2002) (Fortunel et al., 2003) With MPSS technology, genes involved in the LIF pathway, which is essential for mouse but not human ES cell pluripotency, are found to be expressed in mouse, but not in human ES cells Also, some common pluripotent genes were found in both mouse and human ES cells... with Klf4 in a large set of pluripotent gene targets These results further confirmed its role in ES cell pluripotency (Feng et al., 2009) Tcf3 Tcf3 (T -cell factor 3), a member of the canonical Wnt signaling pathway, has been shown to be involved in maintenance of mouse ES cell pluripotency, as its loss delays the ability of these cells to differentiate via the relief of repression of Nanog (Pereira et . in ES Cells 113 3.2.1.1 Dynamic expression profile of REST cofactors in ES Cell 113 3.2.1.2 Depletion of REST cofactors in ES cells 116 3.2.2 Genome wide mapping of REST and its cofactors’. and its cofactors 137 3.3 Discussion 149 3.3.1 The role of REST and its cofactors in ES Cells 149 3.3.2 Genome wide mapping of REST cofactors’ binding sites 150 3.3.3 The role of REST cofactors. mapping of the binding sites for REST and 5 of its cofactors, as well as gene expression profiling upon loss of REST and each cofactors, I found that the REST complex regulates ES cell pluripotency