0

don t be evil how google built its culture

Real Leaders Don't Do PowerPoint: How to Sell Yourself and Your Ideas

Real Leaders Don't Do PowerPoint: How to Sell Yourself and Your Ideas

Tiếp thị - Bán hàng

... interested If you want others to be interested in what you’re saying, you must be interested in it, too (The best way to be boring—not just momentarily but incessantly—is to be bored.) Be interested ... important—their hopes and dreams Don t tell them what they should or what they should feel Instead, give them reason to believe in taking action Give them hope that by acting they can better their ... high-tech company once told me, “but all their knowledge isn t worth a cent to the company if they can t share it with others.” So I tell these “subject matter experts” that in spite of what they...
  • 257
  • 723
  • 0
Don’t Be Taken for a Ride Guide to Auto Leasing pdf

Don’t Be Taken for a Ride Guide to Auto Leasing pdf

Kĩ thuật Viễn thông

... to tell that it is a balloon note is by reading it carefully, especially in the section that spells out the number of payments and the amount of each payment At that spot the contract should show ... told the interest rate, the lessor will quote a rate that will likely be in the form of a money factor which is an interest rate Nevertheless, it is not hard to translate the money factor into ... lessors to disclose this key term of your contract, but it is an important factor that affects the amount of your monthly payment The higher the money factor, the higher your monthly payment will be...
  • 29
  • 503
  • 0
kelly - financially stupid people are everywhere; don't be one of them (2010)

kelly - financially stupid people are everywhere; don't be one of them (2010)

Tài chính doanh nghiệp

... the 21st The next credit card statement wouldn t be mailed until the following month and wouldn t be due for payment until the month after that Ta da! Two months of interest-free money That was ... joined, then the next neighbor, then the whole street, the ward, the city, 32 Toxic FSP in the Alphabet of Idiocy the state, and the nation, twisting that once-gentle breeze into an EF5 super tornado ... back to the issue of pride Do you really want to be part of that miserable crowd? Of course not You’re better than that You’re in a better country than that You work for your money, you contribute...
  • 223
  • 245
  • 0
báo cáo khoa học:

báo cáo khoa học: "Why don’t hospital staff activate the rapid response system (RRS)? How frequently is it needed and can the process be improved?" potx

Báo cáo khoa học

... function of the MET and pathways to access help These clinical areas are in turn situated within the complexity of the character of the institution itself One of the many potential factors that ... will be interviewed to determine why a MET call had not been made Data collected from these structured interviews will be used due to the time constraints of the study and potential to interrupt ... education, or policy development for the organization It is not clear to what extent this study may be limited by the frequency of poor outcomes that can be directly attributed to a failure to...
  • 7
  • 436
  • 0
Leadership the Hard Way: Why Leadership Can’t Be Taught and How You Can Learn It Anyway

Leadership the Hard Way: Why Leadership Can’t Be Taught and How You Can Learn It Anyway

Kỹ năng lãnh đạo

... never been done anywhere—not at Intel or at any other semiconductor manufacturer I tried to explain that this wasn t a satisfactory answer Don t tell me why it can t be done,” I said “Tell me how ... exaggerate the “existential threat” of terrorism to keep people in a state of constant anxiety; on the other, they promise perfect security—on the condition, of course, that the public support their ... in effect force people to anticipate in advance the potential threats facing the organization In this way, they become the catalyst for continuous adaptation that allows the organization to avoid...
  • 157
  • 586
  • 0
BE GARAGE WISE - Don’t get taken for a ride when you take your car in for a service docx

BE GARAGE WISE - Don’t get taken for a ride when you take your car in for a service docx

Kĩ thuật Viễn thông

... part fails) The details on any new MOT certificate are correct and that it has been correctly stamped The service record book has been stamped with the garage’s stamp and that the relevant details ... contacted to agree to a price before it is done Or instead, you might agree an upper level of extra costs before the garage need contact you In this case confirm that the extra work or parts ... whole exhaust Catalytic Converters Unfortunately, these can be expensive and it’s hard to tell if there’s a problem To be sure, it’s best to get advice from an engine diagnostics specialist If your...
  • 14
  • 352
  • 0
nonprofit meetings minutes and records, how to run your nonprofit corporation so you don't run into trouble (2008)

nonprofit meetings minutes and records, how to run your nonprofit corporation so you don't run into trouble (2008)

Quản lý nhà nước

... written consents without attending a meeting If the board or members meet, written minutes of the meeting serve as the documentation for the action taken If the action is by written consent, the ... people, but you couldn t set it at four people, or below the statutory minimum Often, nonprofits simply restate the state law requirements in their bylaws That way, they know that if they follow their ... Even after you’ve created your nonprofit, most states require nonprofits to file periodic reports or statements with the secretary of state or the department of state There is often a corporations...
  • 244
  • 2,006
  • 0
sloan - don't blame the shorts; why short sellers are always blamed for market crashes and how history is repeating itself (2010)

sloan - don't blame the shorts; why short sellers are always blamed for market crashes and how history is repeating itself (2010)

Tài chính doanh nghiệp

... at a healthy profit in the new, better credit of the republic, there was a natural negative reaction to the move So, at the formation of the nation’s credit standing, Hamilton made sure that ... often bristled with fear over the concentration of wealth and the powers allotted to those who control it For the last three quarters of a century—and up through the writing of this book—short ... very right The market bias and the short-term nature of his capital beg for the short to be squeezed out of his position It runs against the human condition to accept constant daily negative feedback,...
  • 272
  • 381
  • 0
Thiết kế một dầm chính của một cầu ô tô có nhịp kiểu giản đơn bằng bê tông cốt thép thường có tiết diện dạng chữ t

Thiết kế một dầm chính của một cầu ô tô có nhịp kiểu giản đơn bằng tông cốt thép thường có tiết diện dạng chữ t

Kiến trúc - Xây dựng

... lc ct 2.2.1 Ve ng nh hng lc ct ti cỏc tit din Hỡnh : ng nh hng lc ct i vi tng mt ct 11 2.2.2 T nh toỏn t nh lc ct ti mt ct no ú, ta tin hnh xp ti bt li nht lờn ng nh hng lc ct ti mt ct y T nh ... nhp t nh toỏn Khong cỏch tim hai dm Tnh ti ri u tiờu chun t c dng lờn dm Trng lng bn thõn dm trờn mt di ph thuc vo kớch thc mt ct dm Hot ti thit k H s ti trng ca trng lng bn thõn dm H s ti trng ... xp ti mang t nh bt li nht lờn ng nh hng mụ men ti mt ct y t nh din t ch ng nh hng tng ng di ti trng di u v t nh tung ng nh hng tng ng di ti trng trung a- i vi TTGH cng , mụ men M ti mt ct th...
  • 19
  • 1,835
  • 6
How to built your own computer_404

How to built your own computer_404

Quản trị mạng

... CompUSA, BestBuy, or Fry's Electronics (probably the best retail store for computer parts, but restricted mainly in the south west of the country) Take a look at the deals You may want to wait until ... ribbon (it's the only one that will fit to the IDE drives) to the drives themselves and then to the motherboard Like in the above step (#6), the red stripe/dots must face towards the left part of ... into buying this brand of RAM It can be really attractive (price wise) but performance, compatibility, and warranty - just simply not worth the trouble of testing and returning it to the store...
  • 15
  • 736
  • 0
Thực đơn cho bé 1 đến 3 tuổi

Thực đơn cho 1 đến 3 tuổi

Sức khỏe trẻ em

... b t ăn cơm), miếng đu đủ nhỏ (khoảng 200g); cháo gà (1 b t ăn cơm), qu t ng t; cháo th t lợn (th t heo) b t ăn cơm; chuối… - Bữa trưa: Cơm n t (khoảng lưng b t ăn cơm), ăn kèm loại đậu phụ, th t, ... 1-3 tuổi Bạn tham khảo cân dưỡng ch t dành cho ngày sau: - Protein: 16g, t ơng đương 200-400ml sữa kèm với 30g th t - Ch t béo: 1-3 tuổi cần khoảng 30% ch t béo t ng số lượng nạp vào thể ... buổi trưa (trước bữa trưa khoảng đồng hồ); buổi t i (sau bữa t i khoảng 1-2 đồng hồ trước ngủ khoảng đồng hồ) bú mẹ cần t ng cường sữa Giai đoạn 2-3 tuổi Giai đoạn này, ăn cơm nát...
  • 5
  • 3,099
  • 10
Don't Bet On It

Don't Bet On It

Tài liệu khác

... the townhouse of Kathy Pendleton belonged to her That wasn 't too startling The fingerprints on the other glass belonged to none other than Senator Collins Perhaps the affair had not ended until ... wait for further statements and then left with no further comment Wasn 't there a blond named Marilyn in the 60's who had intended to just this same thing to a politician but her untimely death ... much time as that contract ended on a moment's notice and I mean that literally We were told the contract wouldn 't be renewed and ten minutes later we were out of the building, never to return...
  • 11
  • 361
  • 0
Don't Make Me Think

Don't Make Me Think

Thiết kế - Đồ họa - Flash

... product list page I see a button that tells me to click it to order their products I click the button They don t sell my item, even though the TV ad said they did I leave 17 The reservoir is limited, ... should be able to “get it” - what your page is and how to use it - without expending any effort thinking about it 5 In the first example, as the user visits the page, he has a lot of questions But ... page? Why did they call it that? The last thing you need is another checklist to add to your stack of Web design checklists The most important thing you can is to just understand the basic principle...
  • 22
  • 673
  • 7
Angry customers don’t come back,

Angry customers don’t come back,

Quản trị kinh doanh

... significant relation between anger and ‘having thoughts about how to act upon the situation’ and ‘want to find out what would be the best way to deal with the event’ lies in angry customers’ repression ... feeling”; for thoughts, “think about how to act upon the situation”; for action tendencies, “feel like waiting for the right moment to take action,” “feel like devoting your attention to something else” ... for actions, “reflect on what happened” and “make a deliberate judgment about how to act”; and for emotivational goals, “want to find out what would be the best way to deal with the event.” Table...
  • 17
  • 463
  • 0
NGHIÊN CƢ́ U SỰ ĐA DẠNG DI TRUYỀN CỦA NẤ M Metarhizium anisopliae DƢ̣A VÀO TRÌNH TƢ̣ GEN Pr1 VÀ VÙNG rDNA-ITS

NGHIÊN CƢ́ U SỰ ĐA DẠNG DI TRUYỀN CỦA NẤ M Metarhizium anisopliae DƢ̣A VÀO TRÌNH TƢ̣ GEN Pr1 VÀ VÙNG rDNA-ITS

Công nghệ - Môi trường

... đại vùng ITS có trình t nhƣ sau: - ITS 4: 5’ TCCTCCGCTTATTGATATGC 3’ - ITS : 5’ GGAAGTAAAAGTCGTAACAAGG 3’ Hình 3.2: Sơ đồ primer đƣơ ̣c sƣ̉ du ̣ng khuế ch đa ̣i vùng ITS Bảng 3.4: Thành phần ... cặp primer có trình t cụ thể nhƣ sau: - METPR1: 5’CAC TCT TCT CCC AGC CGT TC 3’ - METPR4 : 5’GTA GCT CAA CTT CCG CAC TC 3’ (Nguồn : Leger St., 1992) Thành phần hóa ch t đƣợc trình bày bảng ... thể côn trùng chúng b t đầu sinh sôi nảy nở bên thể côn trùng và côn trùng ch t khoảng tuần Sự sinh trƣởng pha t triển nấm sau côn trùng v t chủ ch t Sau côn trùng ch t, nấm tiếp t c pha t triển...
  • 76
  • 404
  • 0
GOI Y THUC DON CHO BE 1-3 TUOI

GOI Y THUC DON CHO BE 1-3 TUOI

Tư liệu khác

... khoảng cốc sữa ngày Ngoài ra, bạn cho ăn thêm 0,5-1 hộp sữa chua ngày - Ch t s t: 10mg; Ch t kẽm: 10mg Thực phẩm giàu s t kẽm th t, trứng, thủy (hải) sản Theo: Mẹ ... hộp), bánh ng t Những lưu ý dinh dưỡng cho 1-3 tuổi Bạn tham khảo cân dưỡng ch t dành cho ngày sau: - Protein: 16g, t ơng đương 200-400ml sữa kèm với 30g th t - Ch t béo: 1-3 tuổi cần khoảng ... Bạn có t ể chọn cho bánh mỳ, sữa (hoặc sữa đậu nành) khoảng 200ml; phở bò (1 b t ăn cơm), miếng đu đủ nhỏ (khoảng 200g); cháo gà (1 b t ăn cơm), qu t ng t; cháo th t lợn (th t heo) b t ăn cơm;...
  • 2
  • 1,022
  • 1
MON NAM TRONG THUC DON CUA BE

MON NAM TRONG THUC DON CUA BE

Tư liệu khác

... nấm thành phụ cho T c dụng vitamin D Vitamin D giúp hệ xương tim mạch khỏe mạnh; đồng thời, ngăn ngừa chứng hen suyễn, tiểu đường ung thư cho T y giai đoạn ph t triển, nhu cầu vitamin ... Nếu thiếu h t vitamin D, dễ bị còi xương mắc phải chứng xương mềm, dễ gãy Để việc t ng hợp vitamin D thể t t hơn, cha mẹ nên lưu ý đến chế độ t m nắng hàng ngày cho M t số thực phẩm khác trứng, ... đỏ trứng c t hòa với ch t nước vào nồi Khi thấy súp sôi trở lại, bạn bắc nồi xuống, nêm ch t muối Chờ nguội ch t, bạn nên đổ súp b t cho dùng Cháo gà – nấm rơm (dành cho 9-12 tháng tuổi)...
  • 2
  • 278
  • 0

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25