digitizing a brachylophosaurus canadensis rib jrdi 200 length 1048 mm note the extensive markings on the bone the finished 3d file is visible on the laptop screen
Báo cáo y học: "Determination of normal values for navicular drop during walking: a new model correcting for foot length and gender" ppt
... committee (N -2007 0049), took part in data acquisition, and drafted the manuscript MSR took part in data acquisition, made the statistical analysis and interpretation of data, and helped drafting ... values for ND at 0.95 (within day) and 0.94 (between days) Statistical analysis All data except age were parametric and therefore the Pearson product moment correlation was used The Spear- man's ... distance between the marker on the navicular tuberosity and the line between the markers on calcaneus and first metatarsal head The distance between the floor and the line in standing position...
- 7
- 461
- 0
Báo cáo y học: "Anatomic and functional leg-length inequality: A review and recommendation for clinical decision-making. Part II, the functional or unloaded leg-length asymmetr" ppt
... would appear "even" on a visual check The pelvis – joints, ligaments and muscles – have adapted to the anatomic LLI, making any torsion structural It is this putative biomechanical adaptation that ... test is reliable and valid as an instrument to measure functional "short leg" and whether LLAA findings are contaminated by anatomic LLI Anatomic LLI is caused by a natural developmental asymmetry ... lifts may have a positive effect on back pain and muscle activity given that most anatomic LLI is not clinically significant Torsion of the pelvis as an adaptive structural compensation in anatomic...
- 6
- 324
- 0
Báo cáo y học: " Self-reported sickness absence as a risk marker of future disability pension. Prospective findings from the DWECS/DREAM study 1990-2004"
... Scale characteristics are described elsewhere [15] Analysis Logistic regression methods were used to analyse the associations between the risk factors and the outcome variable The analysis was ... the database DWECS/DREAM [14]; a merger between the Danish Work Environment Cohort Study (DWECS) and the national register on social transfer payments (DREAM) DREAM is a register based on data from ... from the Danish Ministry of Employment, the Ministry of Social Affairs and the Ministry of Education DWECS was conducted in 1990, and featured a random sample drawn from the Central Population...
- 6
- 578
- 0
Ảnh 10 công trình nổi tiếng thế giới.
... hình CN t a nhà chọc trời Toronto, Canada Tượng nhân sư Kim tự tháp Ai Cập T a tháp cầu London, Anh Tượng đài Thiên niên kỷ Budapest, Hungari T a thánh Vatican Tháp đồng hồ Big Ben London ... T a tháp đôi Petronas công trình chọc trời Kuala Lumpur, Malaysia Sân vận động Tổ chim Bắc Kinh (Trung Quốc) Khu trung tâm Thượng Hải, Trung Quốc với công trình cao tháp Hòn ngọc...
- 10
- 351
- 0
sáng kiến kinh nghiệm đạt loại A" Dạy và học từ vựng ở trường THCS như thế nào để đạt hiệu quả
... học sinh hoạt động thời gian 2-3 phút để nối từ với đồ vật Matching: gram of, a kilo of, a bar of, a can of, a box of, a tube of, a packet of, a dozen of, a bottle of Sau em nối từ giáo viên cho ... remember, simon says, slap the board, shark attack, wordsquare Giáo viên dùng thủ thuật phù hợp với hoạt động tiết học là: warm up, checking vocabulary, futher exercise for vocabulary Tóm lại giáo viên ... Kim’s game, lucky numbers, matching, mime chill, realia drill, picture drill, networks, noughts & crosser, gap fill, ordering vocabulary, pelmanism, what & where, rub out and remember, simon says,...
- 13
- 10,393
- 131
Nghiên cứu văn hóa doanh nghiệp tại khách sạn the nam hải
... c ñ n nay, tác gi nghĩ r ng r ng mô hình t c a Denison phù h p v i nghiên c u c a c Mô hình 2.2 T ng quan v khách s n The Nam H i nghiên c u c a Denison khai thác ñ y ñ y u t c a văn h a 2.2.1 ... kh linh ho t c a doanh nghi p Trong ñó, nhân t xoay quanh tr c hoành CÁC GI Đ NH Đư c khai thác BCH c a Denison CƠ s ñ i di n cho vi c tr ng t p trung vào bên hay bên ngòai c a doanh nghi p 3.1.2 ... m c a văn h a doanh nghi p 1.1.2.1 Văn h a doanh nghi p t n t i khách quan 1.1.7 Vai trò c a lãnh ñ o vi c xây d ng, g n k t phát 1.1.2.2 Văn h a doanh nghi p hình thành trong m t th i gian tri...
- 13
- 802
- 1
Tài liệu A REVIEW OF INDOOR AIR POLLUTION AND HEALTH PROBLEMS FROM THE VIEWPOINT OF ENVIRONMENTAL HYGIENE: FOCUSING ON THE STUDIES OF INDOOR AIR ENVIRONMENT IN JAPAN COMPARED TO THOSE OF FOREIGN COUNTRIES pptx
... (in Japanese) IPCS (1989) Environmental Health Criteria 89 Formaldehyde, World Health Organization, Geneva Takeda, M., Saijo, Y., Yuasa, M., Kanazawa, A. , Araki, A and Kishi, R (2009 ) Relationship ... concentrations from the 1970s to 2000 in Japan have been summarized by Arashidani et al.12) Outdoor air pollution was also a serious issue from the 1960s to early 1970s in Japan On this basis, the ... determination and the comparison of their value Indoor Environ., 11, 1–9 (in Japanese) Fukutomi, Y., Yasuda, H., Nakazawa, T., Taniguchi, M and Akiyama, K (2009 ) Indoor Mite and Insect Allergens and...
- 14
- 940
- 1
Tài liệu Toward a New Literacy of Cooperation in Business MANAGING DILEMMAS IN THE 21ST CENTURY pdf
... competition The two go hand-in-hand, posing a choice at every juncture, a choice that arises because of a basic dilemma—traditionally framed as a social dilemma Social Dilemmas: The Problem of the One ... irrationality That is, individual rational behavior leads to a situation in which everyone is worse off than they might have been otherwise One example of a social dilemma is the so-called “tragedy of the ... strategy Hardin’s analysis was based on one such game, called the Prisoner’s Dilemma, which was developed at the RAND Corporation in 1950 In the simplest form of the game, two prisoners have the...
- 67
- 893
- 0
Tài liệu Báo cáo khoa học: a-Defensins increase lung fibroblast proliferation and collagen synthesis via the b-catenin signaling pathway doc
... 5¢-AAAGCTGATATTGATGGACAG-3¢ The siRNA against luciferase mRNA was used as a control siRNA The target sequence for luciferase mRNA was 5¢-AACG TACGCGGAATACTTCGA-3¢ The siRNAs were customsynthesized by Qiagen (Valencia, ... lung disease Cytokine 32, 1–6 Ashitani J, Mukae H, Arimura Y, Sano A, Tokojima M & Nakazato M (2004 ) High concentrations of alphadefensins in plasma and bronchoalveolar lavage fluid of patients ... without an alteration in the protein contents of total p38 MAP kinase, total Akt, and total GSK3b, suggesting that a- defensin-1 and a- defensin-2 cause the activation of p38 MAP kinase and PI3K ⁄ Akt...
- 12
- 602
- 0
Tài liệu Báo cáo khoa học: Treatment of neutral glycosphingolipid lysosomal storage diseases via inhibition of the ABC drug transporter, MDR1 Cyclosporin A can lower serum and liver globotriaosyl ceramide levels in the Fabry mouse model doc
... Takeuchi M, Ogasawara S, Maruyama Y, Nakajima T, Takaoka Y et al (2002 ) Production in yeast of alpha-galactosidase A, a lysosomal enzyme applicable to enzyme replacement therapy for Fabry disease Glycobiology ... of Fabry disease in man and was carried out under ethical approval Mice were euthanized under conditions of minimized trauma Extraction of plasma Gb3 and quantitation by VT1 ELISA Determination ... Gottesman MM, Brady RO et al (1997) alpha-Galactosidase A deficient mice: a model of Fabry disease Proc Natl Acad Sci USA 94, 2540–2544 Chiba Y, Sakuraba H, Kotani M, Kase R, Kobayashi K, Takeuchi...
- 12
- 432
- 0
Tài liệu Báo cáo khoa học: A novel coupled enzyme assay reveals an enzyme responsible for the deamination of a chemically unstable intermediate in the metabolic pathway of 4-amino-3-hydroxybenzoic acid inBordetellasp. strain 10d doc
... solution showed one main absorption peak at 266 nm and a broad absorption band in the visible region (Fig 4) The excitation spectrum of the heat-treated enzyme with emission at 530 nm showed a maximum ... of absorption spectra in a coupled enzyme assay, the enzyme reaction product identified by GC-MS analysis, and the determination of released ammonia The coupled enzyme assay revealed the mechanism ... acid, and 0.05 mL of the crude extract (35–75% ammonia sulfate saturation) (61 mgÆmL)1) The reaction was started by adding the enzyme solution After incubation at 24 °C, the sample was scanned...
- 7
- 613
- 1
Tài liệu A Comparison of Conventional and Organic Milk Production Systems in the U.S. potx
... is the standard normal density function and Φ is the standard normal cumulative distribution function evaluated using the first stage estimates Characteristics and Practices of Conventional and ... depth of data supporting the analyses This study addresses these limitations, taking advantage of a unique nationwide data set of organic and conventional dairies Data Data used in this study ... Butler, and Barham et al are among the few examples of information on this subject, but nothing is available on a national basis Organic milk production systems rely on ecologically based practices...
- 30
- 660
- 0
Báo cáo " A new Environmental Poverty Index (EPI) for monitoring system in the SEA (Strategic Environmental Assessement) procedure " docx
... budget allocation for P-E); + Ecological management capacity (monitoring capacity, EIA, SEA, EA) Thirdly, the social capital indicators are qualitative ones which reflect the capacity of local populations ... dryland areas may conclude that the main reasons for their persistent poverty are marginal land and a lack of access to water This does not mean unawareing that the poverty has multiple causes, often ... that is considered important Being able to appreciate the work on Poverty and Environmental indicators that international agencies or academics do, and to use them is indeed valuable But it is...
- 9
- 352
- 0
A Knowledge-Based Approach to Network Security: Applying Cyc in the Domain of Network Risk Assessment pptx
... Solaris The Attack Planner enables the user to state plan goals, launch the planner and view the attack plans generated For example, a user can state the goal “An external user with no initial ... precondition, the planner retains them in groups by variable This simulates the exploration of each branch of the search tree, done in parallel, with some reasonable overhead at each node This approach ... in the name of this collection indicates it is a specialization of ConceptualWork, the collection of deliberately created things that lack a location in space but have a beginning in time and an...
- 6
- 490
- 0
Báo cáo khoa học: Suppression of a cold-sensitive mutant initiation factor 1 by alterations in the 23S rRNA maturation region pdf
... pTrc9 9A vector was used for cloning and overexpression of era, encoding the GTPase Era The primers used were as follows: era_F_NcoI, CGACCATGGCGAAC AGGCGTTGAAAAAAC; and era_R_SalI, CGAGTCGA CAGCCTTCCATCGGAGTTACT ... and has the ability to discriminate between certain mRNAs on the basis of their TIRs [12] In addition, IF1 influences ribosomal subunit association–dissociation rates [28], and this function is ... because of disruption of the primary rRNA transcript maturation As the analysis was carried out with D7 strains, we were concerned that the observed increased subunit association in the case...
- 12
- 439
- 0
Next Generation Connectivity: A review of broadband Internet transitions and policy from around the world pdf
... international comparisons? International comparisons, in particular broadband penetration rates as reported by the Organization for Economic Cooperation and Development (OECD) and International ... analysis data for penetration and price, and actual measurements of speed and latency, in the case of capacity We describe these data alongside other sources of data, most extensively OECD data, ... update as regularly as the subscription data on which the per 100 inhabitants measures, both fixed and mobile, are based) The Netherlands and Canada both well on the fixed-broadband penetration...
- 232
- 669
- 0
Báo cáo khoa học: A single EF-hand isolated from STIM1 forms dimer in the absence and presence of Ca2+ ppt
... conformational changes in this motif The Ca2+ signal change and the accompanying conformational change in the canonical EF-hand are probably relayed to the SAM domain via the paired ‘hidden’ EF-hand, resulting ... f is the fractional change, Kd is the dissociation constant for Tb3+, and [P]T and [M]T are the total concentrations of protein and Tb3+, respectively The Ca2+ competition data were first analysed ... ‘hidden’, atypical, non-Ca2+-binding EF-hand motif that stabilizes the intramolecular inter5594 action between the canonical EF-hand and the SAM domain This hidden EF-hand pairs with the upstream canonical...
- 9
- 465
- 0
Báo cáo khoa học: A novel metallobridged bis(b-cyclodextrin)s fluorescent probe for the determination of glutathione doc
... from the standard curve and the regression equation The average recovery test was made using the standard addition method, and the RSD was generally good when obtained from a series of six plasma ... human plasma Analytical characteristics Under optimum experimental conditions, there was a linear relationship between uorescence intensity and GSH concentration in the range 0.3020.0 lm with a ... Major Program of National Natural Science Foundation of China (No.90713019), National Natural Science Foundation of China (No.20575036) Important Project of Natural Science Foundation of Shandong...
- 8
- 429
- 0
Báo cáo khoa học: Gene expression silencing with ‘specific’ small interfering RNA goes beyond specificity – a study of key parameters to take into account in the onset of small interfering RNA off-target effects potx
... 5¢-CTGTGACCAGCACTGTCT CAGTTT-3¢; reverse, 5¢-CCCAGTGAGGATTGGATGA ACTA-3¢), SPARC (forward, 5¢-GAGACCTGTGACCT GGACAATG-3¢; reverse, 5¢-GGAAGGAGTGGATTTAG ATCACAAGA-3¢), TGFBR2 (forward, 5¢-TGGACCCT ACTCTGTCTGTGGAT-3¢; ... siRNA2, LAMP2 ⁄ siRNA1 and LAMP2 ⁄ siRNA2 are 5¢UGACUUCCCUGGCCUAUUUUU-3¢, 5¢-ACAUUGAGC UCCUCUCUUGUU-3¢, 5¢-GAUAAGGUUGCUUCAGU UAUU-3¢ and 5¢-ACAGUACGCUAUGAAACUAUU-3¢, respectively As a negative control, ... between the test and the reference Data normalization and statistical analysis The data were normalized in a two-step procedure First, a correction was applied using a factor calculated from the...
- 16
- 494
- 0
Báo cáo khoa học: Structural and functional evidence for a singular repertoire of BMP receptor signal transducing proteins in the lophotrochozoan Crassostrea gigas suggests a shared ancestral BMP/activin pathway docx
... 5¢-GCC AGATCCCAAATTAGTGC-3¢; QaTGFbsfR2, 5¢-TGAA ACCACAGCCTCAGTTG-3¢, where ‘s’ and a indicate sense and antisense primers, respectively Accurate amplification of the target amplicon was checked ... Ancylostoma caninum (AAL06642), TGFR Brugia pahangi (ACC47801), C32D5.2(Actr) Caenohabditis elegans (NP_495271), Daf-1 Caenohabditis elegans (P20792), Daf-4 Caenohabditis elegans (P50488), ActR2b Carassius ... the minimum evolution method of the PAUP package The percentage recovery of the branch in 1000 bootstrap replications is indicated ActR2b Carassius auratus (ABB58749)Daf-1 Caenohabditis elegans...
- 17
- 508
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008