Báo cáo khoa học: Suppression of a cold-sensitive mutant initiation factor 1 by alterations in the 23S rRNA maturation region pdf

Suppression of a cold-sensitive mutant initiation factor by alterations in the 23S rRNA maturation region Jaroslav M Belotserkovsky, Georgina I Isak and Leif A Isaksson Department of Genetics, Microbiology and Toxicology, Stockholm University, Sweden Keywords Escherichia coli; RNase III; rRNA mutation; rRNA processing; translation Correspondence L A Isaksson, Department of Genetics, Microbiology and Toxicology, Stockholm University, S-10691 Stockholm, Sweden Fax: +46 164315 Tel: +46 164197 E-mail: Leif.Isaksson@gmt.su.se (Received 24 January 2011, revised March 2011, accepted 14 March 2011) Genetic selection has been used to isolate second-site suppressors of a defective cold-sensitive initiation factor I (IF1) R69L mutant of Escherichia coli The suppressor mutants specifically map to a single rRNA operon on a plasmid in a strain with all chromosomal rRNA operons deleted Here, we describe a set of suppressor mutations that are located in the processing stem of precursor 23S rRNA These mutations interfere with processing of the 23S rRNA termini A lesion of RNase III also suppresses the cold sensitivity Our results suggest that the mutant IF1 strain is perturbed at the level of ribosomal subunit association, and the suppressor mutations partially compensate for this defect by disrupting rRNA maturation These results support the notion that IF1 is an RNA chaperone and that translation initiation is coupled to ribosomal maturation doi:10.1111/j.1742-4658.2011.08099.x Introduction Bacterial protein synthesis, as directed by the action of the ribosome, can be broadly divided into four main phases – initiation, elongation, termination, and recycling Initiation is the rate-limiting step [1] This phase is mediated by initiation factor (IF1), initiation factor 2, and initiation factor IF1 is the smallest of the initiation factors [2] Its structure has been determined by NMR spectroscopy, revealing that IF1 is a member of the oligomer-binding (OB-fold) family of proteins, with structural similarities to cold shock proteins [3] In addition, IF1 has been shown to complement lesions in several cold shock response proteins in Bacillus subtilis [4] The interaction of IF1 with the bacterial ribosome has been investigated by chemical probing [5], mutagenesis studies [6], and crystallography [7,8] These data indicate that IF1 makes contacts with the functionally important bases G530, A1492 and A1493 in 16S rRNA In addition to its direct involvement in translation initiation [1], IF1 has been shown to be an RNA chaperone [9], as well as playing a role in transcriptional antitermination in Escherichia coli [10] More recently, it has been reported that IF1 acts as a sensor of cis-elements in mRNA [11] and, together with initiation factor 3, determines the rates of ribosomal subunit joining by inducing conformational changes in the 30S subunit [12] Each of the seven rRNA operons in E coli is transcribed as a single primary transcript The order of gene products relative to the start of transcription is 16S, 23S, and 5S, with some tRNA species between 16S and 23S as well as at the end of the transcript As transcription proceeds, the rRNA forms secondary structures that are substrates for the binding of ribosomal proteins and maturation factors [13] Among these structures are double-stranded stems that are composed of terminal flanking sequences of 16S and 23S rRNAs These ‘processing’ stems are substrates for RNase III, and other ribonucleases that trim the stems Abbreviations Amp, ampicillin; Cm, chloramphenicol; IF1, initiation factor 1; Kan, kanamycin; Tet, tetracycline; TIR, translation initiation region FEBS Journal 278 (2011) 1745–1756 ª 2011 The Authors Journal compilation ª 2011 FEBS 1745 Processing stem mutations suppress cold-sensitive IF1 J M Belotserkovsky et al to eventually produce mature rRNA termini [14,15] The processing of 23S rRNA is strictly dependent on the action of RNase III A deletion in the gene encoding this enzyme results in immature 23S rRNA with extended termini, whereas 16S rRNA is matured to completion [16] There is ample evidence that the maturation of the two ribosomal subunits is interdependent, and that subunit maturation events are functionally linked to translation initiation [13] Here, we have isolated mutations in the 23S rRNA processing stem that suppress a cold-sensitive mutant of IF1 This serves as additional evidence that ribosome maturation and translation initiation are intimately linked Results Mutations in the processing stem of 23S rRNA The existence of D7 E coli strains, in which all seven rRNA operons are deleted, has facilitated studies with rRNA that exists as genetically pure populations of cellular ribosomes This is possible because a plasmid with any one of these genes can compensate for the deleted rRNA genes We have used such a strain in order to select for mutations in rRNA that suppress the cold-sensitive phenotype of a mutant IF1 (R69L) This mutation in IF1 leads to significant growth inhibition at low temperatures [17] A D7 strain containing IF1R69L was screened for spontaneous revertants that were cold-resistant at the nonpermissive temperature of 23 °C We specifically sought revertants that carried second-site suppressor mutations on the plasmidencoded rRNA operon Here we report a set of suppressor mutations that are located in the 23S rRNA processing stem (Fig 1) This structural region is subject to cleavage by RNase III and other ribonucleases during 23S rRNA maturation [16] In particular, the positions of mutated residues overlap with known RNase III cleavage sites [18] The same base was found to be mutated in the mutant plasmids pD1 (G to T) and pD6 (G to A) as a result of independent selections, indicating that such suppressors are common in this structure (Fig 1) When plasmids with the mutated rrnB gene were introduced into the IF1 mutant strain JB69, thus providing the sole source of rRNA, noticeable growth enhancement was observed on solid medium as well on as rich liquid medium upon downshift to the nonpermissive temperature of 23 °C (Figs 2A and 3) It should be noted that the R69L mutation is not lethal in the downshift condition, but merely deleterious This explains why JB69 continued to grow, albeit slowly, following the down1746 Fig Secondary structure of 23S rRNA processing stem, showing sites of suppressor mutations Cleavage sites of RNase III on naked RNA (solid arrows) and on the ribosome (dashed arrows) are indicated The sequence of mature termini of 23S rRNA is in bold Sites of mutations are encircled Mutants are designated as follows: pD1 and pD6 carry mutations in position G8, and are G to T and G to A substitutions, respectively pD3 has a C to A substitution at position C + Figure reproduced from [18] shift (Fig 3) The obvious question was whether these mutations have any effect on 23S stem processing Primer extension analyses were used to check the termini of 23S rRNA from total cellular extracts in these mutants Additional bands corresponding to accumulation of precursors of 23S rRNA in mutant plasmids were detected (Fig 4A) The expected 5¢ mature and )7 termini, as well as additional bands corresponding to approximate )41 (e1) and )46 (e2) termini, were identified in strains carrying the mutant plasmids pD1 and pD6, which carry mutations on the 5¢-side of the processing stem, gave rise to rRNA with the majority of termini in the mature form, whereas pD3, with a mutation on the 3¢-side, gave rise rRNA with the majority of the termini in the )7 form In addition, for FEBS Journal 278 (2011) 1745–1756 ª 2011 The Authors Journal compilation ª 2011 FEBS J M Belotserkovsky et al Processing stem mutations suppress cold-sensitive IF1 Fig Phenotype of cold-sensitive IF1 mutants with various suppressors (A) A plate incubated at 23 °C for 72 h with the D7-derived strains, where: IF1 is pKK3535 ⁄ JB69; IF1Drnc is pKK3535 ⁄ JB69Drnc; IF1 + pD1, pD3 and pD6 are suppressor plasmids pD1, pD3 and pD6 in JB69, respectively (B) A plate incubated at 20 °C for 72 h with the MG1655-derived strains, where: IF1 is CVR69L; IF1Drnc is CVR69LDrnc incomplete, as shown by the existence of mature 23S termini in all mutants As these mutations were isolated as suppressors of a cold-sensitive IF1 mutant, we considered the remote possibility that IF1 has some involvement in the processing of this structure We reasoned that, if IF1 has such a role, we would detect differences in the relative amounts of bands corresponding to mature 23S and other extended termini when total cellular RNA was extracted at the nonpermissive temperature of 23 °C and when it was extracted at 37 °C Processing of mutant plasmids was compared with that of the wild type in both JB69 and SQZ10, using total RNA extracted from cells grown at 23 °C and 37 °C No significant differences were found, indicating that processing stem mutations affect the processing of 23S rRNA irrespective of incubation temperature or strain background (not shown) Fig Growth properties of suppressor, wild-type and IF1 strains in rich liquid medium Cultures were grown to D590 nm 0.2 at 37 °C, after which they were shifted to 23 °C (shown as dotted line) Growth trajectories of strains are labeled as follows: Ô, pKK3535 SQZ10; j, pD3 ⁄ JB69; m, pKK3535 ⁄ JB69; , pKK3535 ⁄ JB69Drnc Suppressor plasmids pD1 and pD6 in JB69 are omitted for clarity, as they have identical trajectories to pD3 ⁄ JB69 Straight lines were fitted to data generated from at least three independent experiments • pD1, the e1 ()41) terminus was more prominent Thus, there were apparent differences between the mutant plasmids in extended termini, depending on the mutated position in the processing stem Taken together, these results suggest that the processing stem mutations block nucleolytic processing, most likely by RNase III or other RNases; however, the blockage is Lack of processing suppresses the IF1 cold sensitivity phenotype Next, we investigated whether the suppression phenotype results from the nature of the 23S processing stem mutations themselves, or whether a general lack of 23S processing stem maturation would result in the same phenotype To this end, we generated a large deletion in the ORF of rnc, a gene encoding RNase III, in the cold-sensitive JB69 and CVR69L strains The deletion was designed such that only the first 15 and last 38 amino acids were left intact in the ORF The reason was to avoid potential disruption or polar effects on the downstream and overlapping ORF that encodes the essential Era GTPase [19] We found that the RNase III lesion in JB69 resulted in the same apparent phenotype as the 23S processing stem mutations when FEBS Journal 278 (2011) 1745–1756 ª 2011 The Authors Journal compilation ª 2011 FEBS 1747 Processing stem mutations suppress cold-sensitive IF1 J M Belotserkovsky et al Fig Primer extension analysis of 5¢-termini of 23S rRNA from mutant strains (A) Extension products from total cellular RNA (B) Comparison of processing stem mutant plasmid extension products and the RNase III deletion strain (Drnc) (C) Extension products from sucrose gradient fractions, where 50 and 70 are fractions corresponding to the 50S and 70S subunit peaks Plasmids and strains are as follows: pKK3535 is the wild-type rrnB+ plasmid; pD1, pD3 and pD6 are processing stem mutant plasmids; SQZ10 is the wild-type strain (IF1wt); JB69 is the IF1 mutant strain (IF1R69L); JB69Drnc is the IF1 mutant with a deleted RNase III gene Extension products are labeled as follows: M is mature 23S rRNA (55 bases long); )3 and )7 are immature 23S rRNA extension products; e1 and e2 are additional immature extension products observed in processing stem mutant strains (41 and 46 bases, respectively); e3 is the RNase III lesion-specific extension product (24 bases) Sizes of marker lane products are given in (A) The tables below (A) and (C) show quantification of extension products for each corresponding panel calculated by IMAGE analysis software the strain was grown on solid medium (Fig 2A) However, in rich liquid medium, the suppression effect was less apparent for this strain (Fig 3) It can be seen that, in these culture conditions, the rnc strain had a different growth trajectory from the processing stem mutants (pD3) This suggests that the RNase IIIdependent suppressor may act in a different manner from the processing stem mutations As a deletion in rnc acts as a suppressor of JB69, a D7-derived IF1 mutant strain, it was of interest to determine whether this deletion would also give rise to a similar suppres1748 sion phenotype in the MG1655 (wild type)-derived IF1 mutant strain CVR69L Indeed, we observed weak but obvious growth enhancement of CVR69L carrying a lesion in RNase III as compared with the CVR69L mutation alone at 20 °C (Fig 2B) This indicates that the suppression phenotype (on solid medium) is allelespecific, depending on the presence or absence of RNase III Figure 4B shows primer extension analysis of the 5¢-terminus of 23S rRNA in strain JB69Drnc There were various extended termini, with the major extension products corresponding to an approximate FEBS Journal 278 (2011) 1745–1756 ª 2011 The Authors Journal compilation ª 2011 FEBS J M Belotserkovsky et al )24 (e3) terminus as well as the )46 terminus, as is the case with the processing stem mutants Interestingly, there was a total absence of a fully mature 23S terminus; instead, a slightly truncated product was observed To rule out any possible involvement of Era in cold sensitivity suppression of mutant IF1, we cloned the era ORF (which is immediately downstream of rnc) under control of an isopropyl thio-b-d-galactoside-inducible promoter No cold sensitivity suppression was observed either with or without isopropyl thio-b-d-galactoside induction when the era plasmid was introduced into CVR69L (not shown) In fact, overexpression of Era was deleterious at both 20 °C and 37 °C, consistent with another report [20] The corresponding experiment could not be performed in JB69, owing to the presence of multiple plasmids in this strain Taken together, our results suggest the RNase III deletion results in suppression of cold sensitivity JB69, probably as a result of incomplete maturation of 23S rRNA, as is also the case with the processing stem mutants However, other effects associated with this lesion could also account for the suppressor phenotype The IF1 mutant has an altered sucrose gradient ribosomal profile when shifted to 23 °C Having shown that processing of rRNA is involved in the suppression phenotype, we next examined how such processing defects would affect sucrose gradient ribosomal profiles of the mutant strains As the suppressor effect is manifested in the cold, we employed a temperature downshift from 37 °C to 23 °C during culturing before examining the ribosome profiles During the course of these experiments, we noted that, upon downshift to the nonpermissive temperature of 23 °C, there were clear differences between the sucrose gradient ribosomal profiles of the IF1 mutant and wild-type strains In particular, in the case of JB69, there appeared to be a slight decrease in the proportion of free ribosomal subunits and a concurrent relative increase in the 70S ribosomes as compared with SQZ10 (Fig 5), suggesting that JB69 is perturbed at the level of subunit association in the cold It is known that the Mg2+ concentration influences ribosome subunit association As the differences are rather subtle, the sucrose gradient experiments were carried out at several Mg2+ concentrations Following a downshift to 23 °C, we lysed the cells in a mm Mg2+ buffer, and applied them to sucrose gradients with varying Mg2+ concentrations from mm to 20 mm We also performed experiments in which cells were lysed in 10 mm Mg2+ buffer and applied to the same gradients, Processing stem mutations suppress cold-sensitive IF1 with similar results (not shown) First, both the sucrose gradient profiles and the accompanying quantification suggest that JB69 exhibits a decreased ratio of free 30S and 50S subunits relative to 70S particles as compared with SQZ10 Thus, throughout the Mg2+ titration range, there was an increased proportion of 70S particles relative to the free subunits This was evident when looking at the amount of 30S subunits that were incorporated into the 70S particles as a percentage of the total amount of 30S (value a in Fig 5) In SQZ10, this value ranged from 33% to 58% throughout the Mg2+ titration range, whereas in JB69, it ranged from 50% to 60% at the same Mg2+ concentrations When the traces and the quantification of peak areas in JB69 and SQZ10 were examined, it appeared that there was a stoichoimetric imbalance of 30S and 50S subunits, whereby the 30S subunits were in excess in JB69 This was noticeable at lower Mg2+ concentrations, when only 33% of the subunits (30S) were in the 70S particles in SQZ10, as compared with 50% in JB69 However, there was little difference in the stoichiometric amounts of 30S and 50S subunits between these two strains in the 20 mm Mg2+ titration – a condition where most of the 30S and 50S subunits were in the 70S particles (approximately 60%) in both strains In addition, the apparent ratio of 30S to 50S subunits in SQZ10 varied with increasing Mg2+ concentration Thus, the observed difference may reflect the limitations in quantifying the peak areas of traces when most of the free subunits are in the 70S trace, as was the case with JB69 throughout the Mg2+ titration, and with SQZ10 at high Mg2+ conentrations Taken together, the data suggest that JB69 has an increased amount of 70S particles relative to the free subunits in the cold, and that this effect is probably not attributable to stoichiometric imbalances of the 30S and 50S subunits The same analysis revealed that there was a general decrease in the amount of 50S subunits in the sucrose gradient in the case of the suppressor plasmid pD3 In particular, there was a consistent increase in the 30S ⁄ 50S ratio of approximately 15% when pD3 was the sole source of rRNA in either SQZ10 or JB69 This suggests that there was a stoichiometric imbalance of 30S and 50S particles, whereby 30S was in excess This effect was strain background-independent, and occurred throughout the Mg2+ titration range (compare traces and 30S ⁄ 50S ratios of pD3 to pKK3535 in each strain background) In addition, whenever pD3 was the sole source of rRNA, there was a slight decrease in the degree of subunit association in both SQZ10 and JB69 (compare value a in the corresponding traces) Finally, when traces of the rnc lesion strain (JB69Drnc) were examined, it was apparent that there FEBS Journal 278 (2011) 1745–1756 ª 2011 The Authors Journal compilation ª 2011 FEBS 1749 Processing stem mutations suppress cold-sensitive IF1 J M Belotserkovsky et al Fig Sucrose gradient profiles of ribosomes at different Mg2+ concentrations Each column is designated with the respective strain, where: pKK3535 is the wild-type rrnB+ plasmid; pD3 is a processing stem mutant plasmid; SQZ10 is the wild-type strain (IF1wt); JB69 is the IF1 mutant strain (IF1R69L); JB69Drnc is the IF1 mutant with a deleted RNase III gene Rows are designated with the corresponding Mg2+ concentration in the gradient Identities of the peaks are as indicated in the left gradient, second row a is the molar proportion of 30S subunits that are in 70S ribosomes over total 30S subunits [70S ⁄ (30S + 70S)], as a means of quantifying the extent of subunit association b is the molar ratio of total 30S to 50S subunits (30S ⁄ 50S) Quantification is based on peak areas, whereby the 30S ⁄ 50S ⁄ 70S molar ratio is adjusted to : 1.96 : 2.96 of the peak areas Each experiment was carried out three times The a and b values are given as means of these experiments, where the standard deviation does not exceed 10% of the value The figure is generated by the use of FYTIK software from raw data with a representative gradient profile was a decrease in the total amount of ribosomal particles (30S, 50S, and 70S) as compared with all other traces, even though the same amount of material was applied to the gradients This decrease was consistent and occurred throughout the Mg2+ titration This sug1750 gests that the total pool of ribosomes in this strain is decreased, most likely as a result of improper maturation of rRNA However, this effect could also be growth rate-related, as JB69Drnc has a long lag phase in the downshift condition (Fig 3) Interestingly, the FEBS Journal 278 (2011) 1745–1756 ª 2011 The Authors Journal compilation ª 2011 FEBS J M Belotserkovsky et al Processing stem mutations suppress cold-sensitive IF1 Fig A model of possible mechanism of suppression of IF1R69 mutant by 23S processing stem mutations (A) Effect of the mutant IF1R69L on subunit association in the cold The forward reaction of subunit association ⁄ dissociation is favored (bold forward arrow) (B) Outcome when processing stem mutations interfere with 23S rRNA processing This results in a decreased cellular pool of properly matured 50S subunits, favoring the reverse reaction of subunit association ⁄ dissociation (bold reverse arrow) III indicates sites of processing by RNase III X indicates RNase III sites blocked because of processing stem mutations apparent extent of subunit association was greater in the RNase III deletion strain than in JB69 throughout the Mg2+ titration range Taken together, the results suggest that the effect of the processing stem suppressor mutations is to lower the available pool of mature 50S subunits as a result of incomplete 23S rRNA maturation As a consequence, there is a decrease in the extent of subunit association, as suggested in Fig In the case of the Drnc strain, this effect might have resulted from decreases in the cellular pool of both the 30S and 50S subunits, because of disruption of the primary rRNA transcript maturation As the analysis was carried out with D7 strains, we were concerned that the observed increased subunit association in the case of JB69 was an artefact resulting from the altered genetic background Indeed, it appeared that the parental strain SQZ10 was somewhat perturbed at the level of subunit association in the conditions used here To settle this, we examined sucrose gradient profiles of the original CVR69L IF1 mutant and its parental wild-type strain, MG1655, when subjected to the same downshift to 23 °C (Fig 7) Here, a similar profile was observed as in the case of JB69 as compared with Fig Sucrose gradient profile of ribosomes from MG1655 (IF1wt) and CVR69L (IF1R69L) For this experiment, cells were lysed and analyzed on gradients with 10 mM Mg2+ Profiles are representative of three independent experiments SQZ10 There was an increase in the relative amount of 70S particles as compared with free subunits, indicating that the observed aberrant profile is not strain-specific, but is a function of the mutant IF1 allele FEBS Journal 278 (2011) 1745–1756 ª 2011 The Authors Journal compilation ª 2011 FEBS 1751 Processing stem mutations suppress cold-sensitive IF1 J M Belotserkovsky et al Immature 23S rRNA termini are present in both the 50S and the 70S fractions We then investigated whether the observed extended termini present in the 23S processing stem mutants were incorporated into the 50S subunits and 70S translating ribosomes To this end, we purified rRNA from sucrose gradient fractions and checked the state of processing of 23S rRNA termini by primer extension It can be seen in Fig 4C that when the suppressor mutant plasmid pD3 was present in either SQZ10 or JB69, a significant proportion of 23S termini from both the 50S and 70S peaks were in the immature form, where the )7 species predominates The e2 extension species was also prevalent, and other minor extension products were observed In the presence of the suppressor plasmid, as little as 13% of the normal 23S 5¢-terminus was in the fully mature form In contrast, when the wild-type plasmid pKK3535 was the sole source of rRNA in either SQZ10 or JB69, as much as 59% of the termini were in the fully mature form, with the )7 and, to a lesser extent, the )3 species accounting for the rest This was the case when rRNA was purified from cells grown at 37 °C, as well from those grown at 23 °C This indicates that immature extended 23S rRNA termini were incorporated into the 50S subunits and functional 70S ribosomes, irrespective of strain background or incubation temperature It is worth noting that, in the case of the wild-type pKK3535 plasmid in either SQZ10 or JB69, there was a slight but consistent difference between the extension products from the 50S and 70S fractions, respectively In particular, there was an increase in the relative amount of the fully mature terminus, with a concurrent decrease of the )7 species in the 70S fraction as compared with the 50S fraction This suggests that final maturation of 23S rRNA occurs on translating ribosomes, in agreement with other reports [13] This effect was less apparent in the case of the suppressor plasmid pD3, suggesting that extended 23S rRNA termini are not fully matured on the translating ribosome Other defects in 50S subunit maturation not rescue cold sensitivity of mutant IF1 As we had established that processing defects in 23S rRNA act as suppressors of a cold-sensitive IF1 mutant, we reasoned that other similar defects in 50S maturation as a whole may have the same effect To check this possibility, we moved, by P1 transduction, deletions in genes that have been shown to be involved in 50S maturation into the cold-sensitive IF1 mutant strains 1752 Specifically, we focused on the genes deaD, dbpA, and srmB, encoding 23S rRNA helicases DeaD, DbpA, and SrmB respectively [21–23] Deletions in these genes (one at a time) were introduced, by P1 transduction from KEIO collection donor strains, into CVR69L as well as JB69, and checked for cold sensitivity suppression [24] No such suppression was observed when the constructed strains were grown at the nonpermissive temperature of 23 °C This indicates that the suppressive effect of processing stem mutants was not a function of general defects in 50S subunit maturation, but was specific to processing of 23S rRNA termini On the basis of our results, we suggest that the difference observed in sucrose gradient ribosome profiles between the IF1 mutant and wild-type strains is attributable to a relative increase in the proportion of 70S ribosomes, and a concurrent decrease in the proportion of the free ribosomal subunits (Fig 6A) Taken together, these results indicate that at least one of the manifestations of the growth defect in the IF1 mutant at nonpermissive temperatures is at the level of ribosomal subunit joining One class of suppressor mutations that specifically alter 23S rRNA processing partially restores the growth defect by affecting the 30S to 50S stoichiometry Discussion Although IF1 has been the focus of studies for a few decades, there is still a considerable amount of interest in this small initiation factor, largely because it is essential for growth and has been found in all organisms investigated With the knowledge gained from structural and mutagenic studies [6,7], as well as the more recent data indicating that IF1 is an RNA chaperone [9,10], all of which demonstrate that IF1 interacts with RNA, we set out to find functional interactions that IF1 may undergo with rRNA We employed a simple genetic approach to isolate second-site suppressor mutations that map to rRNA and that suppress a coldsensitive IF1 mutant strain Such suppressor mutations should reveal the interactions between IF1 and rRNA that have not been evident from crystallographic or other studies Contrary to our initial expectations, the first set of suppressor mutations were found to be located in the 23S rRNA processing stem, and not in the structural part of the mature rRNA Our data suggest that the mechanism of suppression of cold sensitivity in these double mutants is indirect, resulting from rRNA maturation defects According to structural data, the mature form of the processing stem of 23S rRNA (helix 1) is not proximal to the subunit interface of 50S, suggesting that direct contacts between IF1 and FEBS Journal 278 (2011) 1745–1756 ª 2011 The Authors Journal compilation ª 2011 FEBS J M Belotserkovsky et al helix on the ribosome are unlikely The notion of indirect suppression was further supported by the observation that a lesion in RNase III, the enzyme responsible for initial cleavage of the processing stem, also suppresses the IF1 defect On the other hand, the effect of the RNase III lesion was different from that of processing stem mutations with respect to the suppression effect in rich liquid medium As RNase III has multiple RNA targets in the cell, it is possible that, in this case, the suppressor effect is, in fact, not directly related to the processing of rRNA However, such effects cannot explain the mode of suppression of the 23S rRNA processing stem mutants On the basis of the sucrose gradient data, we suggest that the mutant IF1, when shifted to the nonpermissive temperature, leads to an altered rate of subunit association ⁄ dissociation, at the expense of some functional conformational change, presumably in the 30S subunit Several lines of evidence support this First, it is known from structural studies that IF1 induces conformational changes in the 30S subunit [7,25,26] Second, the particular R69L alteration in IF1 results in a general increase in expression of reporter genes [27], while also leading to increased RNA chaperoning activity as compared with wild-type IF1 [9] Moreover, recent data have shown that the R69L IF1 mutation leads to increased expression of reporter genes that is translation initiation region (TIR)-dependent, and that the mutation shares this effect with the antibiotic kasugamycin [11] Third, it has recently been demonstrated that IF1 plays a role in subunit joining, and has the ability to discriminate between certain mRNAs on the basis of their TIRs [12] In addition, IF1 influences ribosomal subunit association–dissociation rates [28], and this function is especially necessary in the cold [29] Finally, it is known that IF1 has a role in the cold shock response [29–32] Taking these findings together, we suggest that the R69L mutant of IF1 allows premature subunit joining by either failing to discriminate between certain TIR elements in mRNA, or inducing a conformation in the 30S subunit under nonpermissive cold shock conditions such that the rate of association–dissociation with the 50S subunit is affected Analogously, the mutant IF1 may be defective in recognition of TIR elements in mRNAs that are specifically translated by cold shock nontranslatable ribosomes, as proposed in a model by Jones et al [33] In this model, cold shock conditions induce a conformation in the ribosomes that becomes blocked in translation initiation, whereby only specific mRNAs with an appropriate TIR can bypass this block and be translated These workers have also described a transient increase in the 70S ribosomes after a shift to a low temperature Processing stem mutations suppress cold-sensitive IF1 On the basis of our results, we suggest that the identified 23S processing stem suppressors act by interfering with ribosome subunit joining by limiting the pool of available mature 50S subunits (Fig 6B) Moreover, as a similarly large fraction of 50S and 70S ribosomes of one of the processing stem mutants (pD3) is composed of immature rRNA, it seems unlikely that there exists an active system that prevents immature 50S subunits from entering the translating ribosome pool Therefore, it is also unlikely that such immature subunits are preferentially degraded Instead, assembly of ribosomal proteins onto immature rRNA could be delayed in these mutants, thus accounting for an apparent decrease in the amount of ribosome subunits Defects that affect rRNA maturation or subunit association should lead to a similar suppressor phenotype for the R69L mutant IF1 On the other hand, we found that general defects in 50S subunit maturation, when deletions in known 23S helicases were introduced into the IF1 mutant, did not rescue the cold sensitivity In addition, one would expect there to be many more potential targets for suppressor mutations in the 23S structural gene that may interfere with some step in 23S maturation, 50S assembly, and subsequent subunit joining, besides those that affect the 23S processing stem After an extensive selection, we were not able to find any such suppressor mutations in the structural part of 23S rRNA We have, however, isolated other suppressor mutations that map to the 16S rRNA structural gene These were found in helices 18, 20, 32, 34 and 41 in 16S rRNA Preliminary data indicate that these mutations interfere with 16S rRNA processing and subunit association (to be published elsewhere) In conclusion, we show a functional interaction between IF1 and the processing stem of 23S rRNA Our results suggest that ribosomal maturation and translation are closely linked processes Experimental procedures Bacterial strains and plasmids The strains and plasmids used in this study are listed in Table All strains were grown in LB medium supplemented with ampicillin (Amp) 200 lgỈmL-1, kanamycin (Kan) 50 lgỈmL)1, tetracycline (Tet) 20 lgỈmL)1, or chloramphenicol (Cm) 35 lgỈmL)1, when necessary Construction of strains SQZ10 is an E coli strain with all seven chromosomally encoded rRNA operons deleted (D7 strain) This strain carries a Kan resistance plasmid encoding the rrnC operon, as well as a counterselectable sacB marker [34] E coli strain FEBS Journal 278 (2011) 1745–1756 ª 2011 The Authors Journal compilation ª 2011 FEBS 1753 Processing stem mutations suppress cold-sensitive IF1 J M Belotserkovsky et al Table Bacterial strains and plasmids used in this study was termed pTrc99a::era Protein overexpression was assayed by SDS ⁄ PAGE Pertinent feature(s) Plasmids pKK3535 pD1 pD3 pD6 pTrc99a pTrc99a::era pKO3 pKO3::Drnc Strains SQZ10 JB69 JB69Drnc MG1655 CAG18478 CVR69L CVR69LDrnc DH5a rrnB, Amp, pBR322-derived pKK3535 but suppressor of infA R69L pKK3535 but suppressor of infA R69L pKK3535 but suppressor of infA R69L Amp, pUC-derived pTrc99a with cloned era Cm, sacB, repA (ts) pKO3 with rnc deletion fragment DrrnA, DrrnB, DrrnC, DrrnD, DrrnE, DrrnG, DrrnH, pCsacB-KmR, ptRNA67-SpcR SQZ10 but infA R69L JB69 but Drnc Wild-type strain zbj ⁄ 1230::Tn10 MG1655 but infA R69L CVR69L but Drnc hsdR, recA1 Reference or source [35] This work This work This work Amersham Pharmacia Biotech This work [36] This work S Quan and C Squires This work This work [38] [39] [17] This work [40] CAG18478 was used to transfer the Tet resistance marker into the IF1 mutant strain CVR69L, with an arginine to leucine substitution at position 69, by P1 transduction [17] This strain was then used as a donor for subsequent transfer of the mutant IF1 allele into SQZ10 to generate JB69 Plasmid pKK3535 [35], containing the rrnB of E coli and an Amp resistance marker, was used to replace a resident plasmid, pCsacB-KmR PCR-based site-directed mutagenesis was used to introduce mutations into pKK3535 A deletion was introduced into the gene rnc, encoding the RNase III, with pKO3::Drnc [36] As a result, only 15 N-terminal and 38 C-terminal amino acids remained in the ORF The deletion fragment was constructed according to [37], with the following primers: rnc5¢O NotI, GTCGGATC CGCGGATCAGGTGGGGATGTATTA; rnc5¢I comp, GGCAGTGGATGATGGGGTTCATGCGATACC; rnc3¢O SalI, TGCGTCGACATTTGCCGCAATAGTGTCAACA; and rnc3¢I comp, TGAACCCCATCATCCACTGCCAG GTCAGCG The deletion was constructed in CVR69L and JB69 to generate CVR69LDrnc and JB69Drnc, respectively (Table 1) A pTrc99A vector was used for cloning and overexpression of era, encoding the GTPase Era The primers used were as follows: era_F_NcoI, CGACCATGGCGAAC AGGCGTTGAAAAAAC; and era_R_SalI, CGAGTCGA CAGCCTTCCATCGGAGTTACT The resulting vector 1754 Selection of second-site rRNA suppressors of cold-sensitive IF1 A direct selection procedure was used to isolate mutations in rRNA that suppress the cold-sensitive phenotype of JB69 Briefly, the cold-sensitive R69L mutant [17] of IF1 provided a tool for isolation of second-site suppressors by selection at the nonpermissive temperature For this purpose, the mutant allele was transferred by P1 transduction into the D7 strain SQZ10 (Table 1) The IF1 mutant strain JB69 obtained exhibited pronounced cold sensitivity at 23 °C Second, the resident pCsacB-KmR plasmid was replaced by a high copy number plasmid, pKK3535 Stationary-phase cultures of JB69 carrying pKK3535 were plated directly on Amp plates at 23 °C Colonies were pooled, and the extracted plasmid DNA was used to transform JB69 by selecting on plates at 23 °C containing Amp and 5% sucrose to displace the resident Kan plasmid Candidate mutants were purified, plasmid DNA extracted, used to transform JB69 at 37 °C, and then streaked at 23 °C to confirm that the suppressor mutations were plasmid-borne Successful candidates that suppressed the cold-sensitive phenotype of JB69 were chosen, and plasmid DNA was sequenced after propagation in DH5a Independent selections were performed 10 times To confirm the cold sensitivity suppression effect, mutants were reconstructed by site-directed mutagenesis Preparation of total RNA The strains were grown at 37 °C in LB to D590 nm 0.7 or at 37 °C to D590 nm 0.2, and the cultures were then shifted to the nonpermissive temperature of 23 °C and grown to D590 nm 0.7 Total RNA was isolated from 5-mL cultures using the RNeasy Mini kit (Qiagen, Hilden, Germany) Primer extension Primer extension analysis was used to analyze the 5¢-end of 23S rRNA, with the primer extension system avian myoblastosis virus reverse transcriptase (Promega, Madison, WI, USA) Probe MRA141 (CCTTCATCGCCTCTGACTGCC) was labeled with [32P]ATP[cP] and used as a template for the 5¢-terminus of 23S rRNA The products of the primer extension reaction were separated on 6% or 8% acrylamide 8M urea sequencing gels The gels were dried and visualized by phosphor imaging Ribosome preparation and sucrose gradient A 500-mL culture was grown in 2· LB to log phase (D590 nm 0.5–0.7) at 37 °C, or grown at 37 °C to FEBS Journal 278 (2011) 1745–1756 ª 2011 The Authors Journal compilation ª 2011 FEBS J M Belotserkovsky et al D590 nm 0.2, rapidly cooled to 23 °C in a water bath, and then grown at 23 °C to log phase Cells were chilled, and harvested by centrifugation at 4000 g for 15 The cells were destroyed by energetic rubbing, using Al2O3 mixed with the cells at a ratio of 1: (w ⁄ w) Cell lysis was carried out by adding 1.5 volumes of buffer A [20 mm Hepes, 10 mm Mg(OAc)2, 100 mm NH4Cl, mm b-mercaptoethanol, pH 7.3] The suspension of the destroyed cells was spun down twice to get rid of the cell debris Three hundred picomoles of material was loaded onto a 20–40% sucrose gradient in buffer A, and centrifuged at 25 000 r.p.m for 19 h in an SW41Ti rotor (Beckman Coulter, Brea, CA, USA) Ribosome profiles were analyzed on an ISCO gradient fractionator connected to a UV absorbance detector (Teledyne Isco, Lincoln, NE, USA) Peaks were quantified with fityk software (http://www unipress.waw.pl/~wojdyr/fityk/) Fractions corresponding to ribosomal subunits were collected, and rRNA was extracted with TRIzol reagent (Invitrogen, Carlsbad, CA, USA) Acknowledgements We are grateful to SIDA (SWE-2006-509), the Swedish Institute (Visby program 01146 ⁄ 2006) and the Carl Trygger Foundation (CTS 08:159) for financial support, to E Dabbs for useful discussions, to KEIO for the strains, and to N Schultz for help with the gradient figures Processing stem mutations suppress cold-sensitive IF1 10 11 12 13 14 15 References Laursen BS, Sorensen HP, Mortensen KK & SperlingPetersen HU (2005) Initiation of protein synthesis in bacteria Microbiol Mol Biol Rev 69, 101–123 Pon CL, Wittmann-Liebold B & Gualerzi C (1979) Structure–function relationships in Escherichia coli initiation factors II Elucidation of the primary structure of initiation factor IF-1 FEBS Lett 101, 157–160 Sette M, van Tilborg P, Spurio R, Kaptein R, Paci M, Gualerzi CO & Boelens R (1997) The structure of the translational initiation factor IF1 from E coli contains an oligomer-binding motif EMBO J 16, 1436–1443 Weber MH, Beckering CL & Marahiel MA (2001) Complementation of cold shock proteins by translation initiation factor IF1 in vivo J Bacteriol 183, 7381–7386 Moazed D, Samaha RR, Gualerzi C & Noller HF (1995) Specific protection of 16S rRNA by translational initiation factors J Mol Biol 248, 207–210 Dahlquist KD & Puglisi JD (2000) Interaction of translation initiation factor IF1 with the E coli ribosomal A site J Mol Biol 299, 1–15 Carter AP, Clemons WM Jr, Brodersen DE, MorganWarren RJ, Hartsch T, Wimberly BT & Ramakrishnan 16 17 18 19 20 21 V (2001) Crystal structure of an initiation factor bound to the 30S ribosomal subunit Science 291, 498–501 Hatzopoulos GN & Mueller-Dieckmann J (2010) Structure of translation initiation factor from Mycobacterium tuberculosis and inferred binding to the 30S ribosomal subunit FEBS Lett 584, 1011–1015 Croitoru V, Semrad K, Prenninger S, Rajkowitsch L, Vejen M, Laursen BS, Sperling-Petersen HU & Isaksson LA (2006) RNA chaperone activity of translation initiation factor IF1 Biochimie 88, 1875–1882 Phadtare S, Kazakov T, Bubunenko M, Court DL, Pestova T & Severinov K (2007) Transcription antitermination by translation initiation factor IF1 J Bacteriol 189, 4087–4093 Surkov S, Nilsson H, Rasmussen LC, Sperling-Petersen HU & Isaksson LA (2010) Translation initiation region dependency of translation initiation in Escherichia coli by IF1 and kasugamycin FEBS J 277, 2428–2439 Milon P, Konevega AL, Gualerzi CO & Rodnina MV (2008) Kinetic checkpoint at a late step in translation initiation Mol Cell 30, 712–720 Kaczanowska M & Ryden-Aulin M (2007) Ribosome biogenesis and the translation process in Escherichia coli Microbiol Mol Biol Rev 71, 477–494 Young RA & Steitz JA (1978) Complementary sequences 1700 nucleotides apart form a ribonuclease III cleavage site in Escherichia coli ribosomal precursor RNA Proc Natl Acad Sci USA 75, 3593–3597 Bram RJ, Young RA & Steitz JA (1980) The ribonuclease III site flanking 23S sequences in the 30S ribosomal precursor RNA of E coli Cell 19, 393–401 King TC, Sirdeshmukh R & Schlessinger D (1984) RNase III cleavage is obligate for maturation but not for function of Escherichia coli pre-23S rRNA Proc Natl Acad Sci USA 81, 185–188 Croitoru V, Bucheli-Witschel M, Hagg P, Abdulkarim F & Isaksson LA (2004) Generation and characterization of functional mutants in the translation initiation factor IF1 of Escherichia coli Eur J Biochem 271, 534–544 Allas U, Liiv A & Remme J (2003) Functional interaction between RNase III and the Escherichia coli ribosome BMC Mol Biol 4, Matsunaga J, Dyer M, Simons EL & Simons RW (1996) Expression and regulation of the rnc and pdxJ operons of Escherichia coli Mol Microbiol 22, 977–989 Kitagawa M, Ara T, Arifuzzaman M, Ioka-Nakamichi T, Inamoto E, Toyonaga H & Mori H (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E coli K-12 ORF archive): unique resources for biological research DNA Res 12, 291–299 Charollais J, Dreyfus M & Iost I (2004) CsdA, a coldshock RNA helicase from Escherichia coli, is involved in the biogenesis of 50S ribosomal subunit Nucleic Acids Res 32, 2751–2759 FEBS Journal 278 (2011) 1745–1756 ª 2011 The Authors Journal compilation ª 2011 FEBS 1755 Processing stem mutations suppress cold-sensitive IF1 J M Belotserkovsky et al 22 Sharpe Elles LM, Sykes MT, Williamson JR & Uhlenbeck OC (2009) A dominant negative mutant of the E coli RNA helicase DbpA blocks assembly of the 50S ribosomal subunit Nucleic Acids Res 37, 6503–6514 23 Charollais J, Pflieger D, Vinh J, Dreyfus M & Iost I (2003) The DEAD-box RNA helicase SrmB is involved in the assembly of 50S ribosomal subunits in Escherichia coli Mol Microbiol 48, 1253–1265 24 Baba T, Ara T, Hasegawa M, Takai Y, Okumura Y, Baba M, Datsenko KA, Tomita M, Wanner BL & Mori H (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection Mol Syst Biol 2, 2006 0008 25 Qin D & Fredrick K (2009) Control of translation initiation involves a factor-induced rearrangement of helix 44 of 16S ribosomal RNA Mol Microbiol 71, 1239–1249 26 Simonetti A, Marzi S, Myasnikov AG, Fabbretti A, Yusupov M, Gualerzi CO & Klaholz BP (2008) Structure of the 30S translation initiation complex Nature 455, 416–420 27 Croitoru VV, Bucheli-Witschel M & Isaksson LA (2005) In vivo involvement of mutated initiation factor IF1 in gene expression control at the translational level FEBS Lett 579, 995–1000 28 Grunberg-Manago M, Dessen P, Pantaloni D, Godefroy-Colburn T, Wolfe AD & Dondon J (1975) Lightscattering studies showing the effect of initiation factors on the reversible dissociation of Escherichia coli ribosomes J Mol Biol 94, 461–478 29 Giangrossi M, Brandi A, Giuliodori AM, Gualerzi CO & Pon CL (2007) Cold-shock-induced de novo transcription and translation of infA and role of IF1 during cold adaptation Mol Microbiol 64, 807–821 30 Giuliodori AM, Brandi A, Gualerzi CO & Pon CL (2004) Preferential translation of cold-shock mRNAs during cold adaptation RNA 10, 265–276 31 Gualerzi CO, Giuliodori AM & Pon CL (2003) Transcriptional and post-transcriptional control of coldshock genes J Mol Biol 331, 527–539 32 Ko JH, Lee SJ, Cho B & Lee Y (2006) Differential promoter usage of infA in response to cold shock in Escherichia coli FEBS Lett 580, 539–544 1756 33 Jones PG & Inouye M (1996) RbfA, a 30S ribosomal binding factor, is a cold-shock protein whose absence triggers the cold-shock response Mol Microbiol 21, 1207–1218 34 Asai T, Condon C, Voulgaris J, Zaporojets D, Shen B, Al-Omar M, Squires C & Squires CL (1999) Construction and initial characterization of Escherichia coli strains with few or no intact chromosomal rRNA operons J Bacteriol 181, 3803–3809 35 Brosius J, Ullrich A, Raker MA, Gray A, Dull TJ, Gutell RR & Noller HF (1981) Construction and fine mapping of recombinant plasmids containing the rrnB ribosomal RNA operon of E coli Plasmid 6, 112– 118 36 Link AJ, Phillips D & Church GM (1997) Methods for generating precise deletions and insertions in the genome of wild-type Escherichia coli: application to open reading frame characterization J Bacteriol 179, 6228– 6237 37 Xiao YH, Yin MH, Hou L, Luo M & Pei Y (2007) Asymmetric overlap extension PCR method bypassing intermediate purification and the amplification of wildtype template in site-directed mutagenesis Biotechnol Lett 29, 925–930 38 Bachmann BJ (1987) Derivations and genotypes of some mutant derivatives of Escherichia coli K-12 In Escherichia coli and Salmonella typhimurium: Cellular and Molecular Biology (Neidhardt FC ed), pp 1190– 1219 ASM Press, Washington, DC 39 Singer M, Baker TA, Schnitzler G, Deischel SM, Goel M, Dove W, Jaacks KJ, Grossman AD, Erickson JW & Gross CA (1989) A collection of strains containing genetically linked alternating antibiotic resistance elements for genetic mapping of Escherichia coli Microbiol Rev 53, 1–24 40 Woodcock DM, Crowther PJ, Doherty J, Jefferson S, DeCruz E, Noyer-Weidner M, Smith SS, Michael MZ & Graham MW (1989) Quantitative evaluation of Escherichia coli host strains for tolerance to cytosine methylation in plasmid and phage recombinants Nucleic Acids Res 17, 3469–3478 FEBS Journal 278 (2011) 1745–1756 ª 2011 The Authors Journal compilation ª 2011 FEBS ... mutations that are located in the 23S rRNA processing stem (Fig 1) This structural region is subject to cleavage by RNase III and other ribonucleases during 23S rRNA maturation [16 ] In particular,... sensitivity of mutant IF1 As we had established that processing defects in 23S rRNA act as suppressors of a cold-sensitive IF1 mutant, we reasoned that other similar defects in 50S maturation as a whole... CGCGGATCAGGTGGGGATGTATTA; rnc5¢I comp, GGCAGTGGATGATGGGGTTCATGCGATACC; rnc3¢O SalI, TGCGTCGACATTTGCCGCAATAGTGTCAACA; and rnc3¢I comp, TGAACCCCATCATCCACTGCCAG GTCAGCG The deletion was constructed in