deletion of the distal 23 amino acids of the 71 amino acid c tail insertion amino acids 1833 to 1855
Tài liệu Báo cáo khoa học: Effect of deletion of the DNase I hypersensitive sites on the transcription of chicken Ig-b gene and on the maintenance of active chromatin state in the Ig-b locus docx
... on the maintenance of the active chromatin state Results Generation of DT40/Cre cells with a long deletion in one allele of the Ig-b locus To genetically examine the mechanism of B cell-speci c ... 5¢-TAGATG CCGTTGTCCTCGTAGCTGATCCTG-3¢ (II: +2085 to +2114); 5¢-AGTGATGTCCTCGTAGGTGGCAATCTGC TC-3¢ (III: +3438 to +3467) (IV: same as 16 k Del) Clones whose DNA contained about kb predictable sequences ... and cloned into HindIII ⁄ NheI sites of the pExpress vector [45] The chicken b-actin promoterdriven puromycin resistance (Puro) gene was inserted into the XhoI site of the construct Selection of...
- 11
- 638
- 0
Báo cáo khoa học: The natural mutation by deletion of Lys9 in the thrombin A-chain affects the pKa value of catalytic residues, the overall enzyme’s stability and conformational transitions linked to Na+ binding pdf
... significantly affect the intrinsic fluorescence of the DK9 variant, the higher the surface exposure and flexibility of their side-chains to the solvent the smaller the intrinsic fluorescence of the ... which expresses the acylation rate By contrast, the decrease in the DK9 Km value is consistent with better accommodation of the substrate into the catalytic pocket of the unprotonated form of the ... factor) of the fluorescence in the absence of urea The process was highly cooperative for both thrombin species (slope factor % in both cases), and the concentration of urea inducing the 50% effect...
- 11
- 553
- 0
Báo cáo khoa học: Characterization of HbpR binding by site-directed mutagenesis of its DNA-binding site and by deletion of the effector domain pot
... DNA-binding characteristics and its activation capacity of the hbpC promoter in Escherichia coli Results Mutagenesis of the HbpR-binding sites Sequence alignment of the UASs found in the HbpR operators ... nucleotides of DA-hbpR were amplified by using the PCR on plasmid pHBP130 with primers hbpR5 (5¢-CGGCGGATCC.ATG.CAC.CCT.ATTCCCGATGAT), which introduces an ATG start codon in fusion with G651 of ... refer to the locations of the transcriptional start site of hbpC (B) Alignments of the sequences of three HbpR-binding sites within the hbp gene region [19] The lane ‘cons-1’ indicates the strictly...
- 11
- 468
- 0
Báo cáo khoa học: Deletion of Phe508 in the first nucleotide-binding domain of the cystic fibrosis transmembrane conductance regulator increases its affinity for the heat shock cognate 70 chaperone docx
... CF, a critical step in bringing them to the clinical setting Future studies should focus on the quantification of the effect of these correctors on the NBD1–Hsc70 interaction in the presence of ... the determination of whether and how correctors affect the Hsc70– F508del-NBD1 interaction, which will improve our understanding of the mechanism of action of small molecules with therapeutic ... of ATP on the Hsc70–NBD1 interaction Adenine nucleotides are of critical importance to the binding of Hsc70 to CFTR [8] Consistently, our data show that ATP dramatically reduces the ability of...
- 13
- 393
- 0
Báo cáo khoa học: N-terminal deletion of the c subunit affects the stabilization and activity of chloroplast ATP synthase doc
... TTGGCCATATGCAGAAGATCACCGAAGCA ATTCCGGAC ACGGATCCA ATTAATCTC …20 EAMKLVAAAK-31 TCCGGCATATGGAAGCAATGAAGCTCGTC …60 TE-62 TCGCGCATATGACTGAGGATGTTGATGTT (Fig 2A) Each of the c constructs reacted with c antiserum ... shown) The truncated polypeptides were designated cDN8 to cDN60 according to the number of amino- acid residues deleted from the c subunit N-terminus The N-terminus amino- acid sequence of c subunit ... stability of the reconstituted assemblies and the efficient assembly of the ab complex with recombinant c constructs; or (b) the structural change in the truncated c construct altered the asymmetry conformation...
- 7
- 290
- 0
Báo cáo lâm nghiệp: "Improving RBS estimates – effects of the auxiliary variable, stratification of the crown, and deletion of segments on the precision of estimate" pps
... presented The analysis of the effects of the crown structure concentrates on the stratification of the crown and on the deletion of greater segments (e.g the stem) by using the classical RBS Statistical ... auxiliary variables, the stratification of the crown and the deletion of segments In the present study, the effects of the choice of the auxiliary variable and of the created crown structure (segments ... causes a bigger decrease in precision than for every other species The choice of the auxiliary variable also affects the distribution of the samples within the crown According to Fig 6, the cross...
- 14
- 335
- 0
Báo cáo y học: " Deletion of the meq gene significantly decreases immunosuppression in chickens caused by pathogenic marek’s disease virus" pptx
... AGT CAC AAT GCG GAT CAc gtg tag gct gga gct gct tc-3’, and ΔMeq-R 5’-CTT GCA GGT GTA TAC CAG GGA GAA GGC GGG CAC GGT ACA GGT GTA AAG AGc att ccg ggg atc cgt cga c- 3’, with MDV-specific sequences ... to the start and end of the coding sequence of the gene to be disrupted The sequences of the primers used for deletion of Meq were: ΔMeq-F, 5’AGA AAC ATG GGG CAT AGA CGA TGT GCT GCT GAG AGT CAC ... bac-GX0101-infected chickens And the ratio of CD4+ T cells to CD8+ T cells in bac-GX0101infected chickens significantly higher than the control group on days 21 and 28 p.i (P < 0.05) However, the...
- 8
- 260
- 0
COMPARATIVE ANALYSIS OF THE DISCORDANCE BETWEEN THE GLOBAL TRANSCRIPTIONAL AND PROTEOMIC RESPONSE OF THE YEAST SACCHAROMYCES CEREVISIAE TO DELETION OF THE F-BOX PROTEIN, GRR1
... well conserved complex of proteins collectively known as the SCF (Skp, Cullin, F-box) The archetype of the SCF complex is the S cerevisiae SCF composed of the proteins Skp1, Cdc53, Rbx1, Cdc34, ... for the SCFGrr1 complex include the cyclins, Cln1 and Cln2 52, the meiosis activating kinase Ime2 53, the Hof1 protein required for cytokinesis 54, the Cdc42 effectors Gic2 and Gic1 55, the glucose ... in the processes of budding and cytokinesis Upon the transition from G1 to S phase of the cell cycle yeast cells begin to polarize the actin cytoskeleton to produce the daughter cell This process...
- 323
- 847
- 0
Báo cáo y học: "ntravenous transplantation of allogeneic bone marrow mesenchymal stem cells and its directional migration to the necrotic femoral head"
... the injured tissues once injury occurs Stem cell homing is a complicated process in which a lot of molecules were involved Once tissues were ischemic, stem cells in circulation are adherent to ... to the vascular endothelial cells, cross the endothelial cells, migrate and finally reached at ischemic sites Inflammatory may be observed in the local ischemic tissues, and thus a lot of chemotatic ... Ischemic femoral head necrosis has been one of common but refractory diseases The clinical treatments of ischemic femoral head necrosis include: (1) Non-surgical treatments [22-24]: pharmacotherapy,...
- 10
- 584
- 0
Effects of time of heatsetting on the tensile properties of ingeo™ poly (lactic acid) (PLA) fabric
... 200g was applied by attachinga weight to the front chuck of the specimen When the test started, the back chuck constantly slided initially right to an angle of 8o then back to it’s original position ... (lactic acid) fabric Figure Effect of time of heatsetting on the linearity of load extension in weft direction of knitted Ingeo™ Poly (lactic acid) Figure Mean effect of time of heatsetting on the ... effect of time of heatsetting on tensile energy WT g.cm/cm2 of knitted Ingeo Polylactic acid fabric 3.4 Tensile resilience RT [%] Tensile Resilience RT [%] is the ability of the fabric to recover...
- 10
- 460
- 0
Tài liệu Báo cáo khoa học: Interaction between very-KIND Ras guanine exchange factor and microtubule-associated protein 2, and its role in dendrite growth – structure and function of the second kinase noncatalytic C-lobe domain docx
... 600–734), CD2-1-5 (amino acids 735–767), CD2-1-6 (amino acids 702–767), CD2-1-7 (amino acids 668– 767), CD2-1-8 (amino acids 635–767), CD2-1-6-1 (amino acids 702–735), CD2-1-6-2 (amino acids 702–744) ... serum (E) The series of GSTfused MAP2 CD2-1 (amino acids 600–767) derivatives: CD2-1-1 (amino acids 600–634), CD2-1-2 (amino acids 600–667), CD2-1-3 (amino acids 600–701), CD2-1-4 (amino acids 600–734), ... control, respectively (C) Division of the middle CD2 region (amino acids 600–1099) of the MAP2 CD into three subregions: CD2-1 (amino acids 600– 767), CD2-2 (amino acids 768–934) and CD2-3 (amino...
- 11
- 658
- 0
Tài liệu Báo cáo khoa học: The intracellular region of the Notch ligand Jagged-1 gains partial structure upon binding to synthetic membranes docx
... a-helical content The transition between different environments, the membrane–cytosol inter5326 face and the cytoplasm, may affect the conformational properties of many receptor cytoplasmic tails ... shown) The lack of significant chemical shift dispersion in the HN and Ha chemical shifts is an evidence of lack of tertiary structure On the other hand, NMR spectra suggest that the conformation of ... region of the membrane-bound tyrosine kinase Lck with the cytoplasmic tail of the T-cell coreceptors CD4 or CD8 [37] In solution, on the contrary, J1_tmic is mainly disordered (Figs and 3) The strongly...
- 12
- 502
- 0
Tài liệu A junk-free childhood 2012 - The 2012 report of the StanMark project on standards for marketing food and beverages to children in Europe pptx
... designed to target non-child audiences For tobacco, the Framework Convention86 covers actions that have the ‘aim, effect, or likely effect of promoting a tobacco product or tobacco use either directly ... Frosties Tony the Tiger, Coco Pop’s Coco the Monkey, Wall’s Max the Lion, and the characters of M&M’s Unilever’s pledge prohibits the use of cartoon characters in association with products that ... directed to the protection of children Explore the use of standards and marketing codes to influence commercial activity, including standards from other industrial sectors Propose a set of standards...
- 32
- 896
- 0
Tài liệu Báo cáo Y học: Inactivation of the 2-oxo acid dehydrogenase complexes upon generation of intrinsic radical species pptx
... continuous reduction of the complex redox centers occurred, the anaerobic PBN adducts were rather stable Fourth, the anaerobic reaction led to the PBN adduct being localized to the protein fraction, ... lines of evidence point to the presence of the thiyl radical in the aerobic system First, the complexes are inactivated by 2-oxo acid and CoA in the presence of O2 (Fig 2A) and the inactivation ... the integral complex structure is required for the radical species production The results of the current study and the site-speci c • reactivity of O2 – also bear on consideration of the concept...
- 12
- 635
- 0
Aging of the Respiratory System: Impact on Pulmonary Function Tests and Adaptation to Exertion pdf
... modifications of the rib cage, decreased chest-wall compliance, and increase in functional residual capacity (FRC) resulting from decreased elastic recoil of the lung (Fig 2) [9] The kyphotic curvature ... subjects over age 70 Lung volumes The major determinants of static lung volumes are the elastic recoil of the chest wall and that of the lung parenchyma Loss of elastic recoil of the lung parenchyma ... of the lungs is counterbalanced by an increased elastic load from the chest wall; total lung capacity (TLC) thus remains fairly constant throughout life [63] Increased elastic recoil of the chest...
- 16
- 873
- 0
Báo cáo khoa học: Heterologous synthesis of cytochrome c¢ by Escherichia coli is not dependent on the System I cytochrome c biogenesis machinery ppt
... cytochromes c, Cys–X–X–Cys–His, was found to be located close to the C- terminus of the PHCP protein, which is conserved in other biochemically characterized cytochromes c (Fig 2) The mature PHCP protein ... Biogenesis of cytochrome c Heterologous synthesis of PHCP by E coli The E coli System I cytochrome c biogenesis machinery, consisting of the Dsb and Ccm proteins, is responsible for the synthesis of class ... sequence deduced from the cloned gene The stretches of the PHCP amino acid sequence used for the design of the PCR primers are underlined with arrows indicating the 5¢ to 3¢ direction The sequences...
- 8
- 606
- 0
Báo cáo khoa học: Respective roles of the catalytic domains and C-terminal tail peptides in the oligomerization and secretory trafficking of human acetylcholinesterase and butyrylcholinesterase potx
... influence the catalytic activity of AChE and BChE We examined the possible influence of the C- terminal peptides on the AChE and BChE activities by comparing the catalytic rates per active site The active ... domains contribute critically to the oligomerization and to the efficiency of secretion Results Exchange of t peptides between human AChE and BChE The T variants of human AChE and human BChE are composed ... N1 9C in peptide b1 9C had little effect on the distribution of secreted molecular forms of Bb1 9C In the case of Ab1 9C, the effect was more complex: the cells contained mostly 4S monomers but secreted...
- 15
- 446
- 0
Báo cáo khoa học: Mutants of Saccharomyces cerevisiae deficient in acyl-CoA synthetases secrete fatty acids due to interrupted fatty acid recycling docx
... deletion of FAT1: FAT1forward, ATTCTATATCTGTGAACTTTTAATAGGCTGCGAAT ACCGACTATGCGTACGCTGCAGGTCGAC; FAT1reverse, CATCCAAACCCTTTGGTAATTTTTGCTCTCT ATAAACCTTCTTCAATCGATGAATTCGAGCTCG Primers used for deletion ... deletion of FAT2: FAT2forward, GTGCTGCAAGAGGTTAGACGCTTCACGCACATTTT TGCTACAATGCGTACGCTGCAGGTCGAC; FAT2reverse, GATAGAAGCTTTCAGAGAGCATAAAATTGT ACAGGATACTGCCTAATCGATGAATTCGAGCTCG Expression of D12-desaturase ... for the accumulated fatty acids in the mutant cells, provided that the release of the fatty acids is rather unspeci c The direction of fatty acid transport is dependent on the metabolic state of...
- 14
- 383
- 0
Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx
... ACTGTCAATAGTGAAGGT CCCCATGTCGCCTTTAGT TCGCTAGAACACATTGAC ATGATGAAACGGTTCAAT TTAGTTACCGTGTGCTTC CTGCTGCTCGCAGCAAGT GTGTGATCTGCAACTGTT CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC TTAGTTACCGTGTGCTTC CACCGAGGAATAATAAATGATG ... Synthetic oligonucleotides used in this study Oligonucleotide name Sequence (5¢- to 3¢) OMCA-KO-F OMCA-KO-R OMCB-KO-F OMCB-KO-R OMCA-F OMCA-R OMCB-F OMCB-R OMCA-PBAD-F CACACTGCAACCTCTGGT ACTGTCAATAGTGAAGGT ... acceptors U(VI) and Se(VI) is due to the decaheme cytochromes c not recognizing either of these electron acceptors, we probed the relative affinities via competition assays Figure shows the IC50...
- 11
- 731
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25