Báo cáo khoa học: Mutants of Saccharomyces cerevisiae deficient in acyl-CoA synthetases secrete fatty acids due to interrupted fatty acid recycling docx

Mutants of Saccharomyces cerevisiae deficient in acyl-CoA synthetases secrete fatty acids due to interrupted fatty acid recycling Michael Scharnewski1, Paweena Pongdontri1,*, Gabriel Mora1, Michael Hoppert2 and Martin Fulda1 Department of Plant Biochemistry, Albrecht-von-Haller Institute, Georg-August University Goettingen, Germany Institute for Microbiology and Genetics, Georg-August University Goettingen, Germany Keywords endoplasmic reticulum; FAA; FAT1; fatty acid accumulation; lipid remodelling Correspondence M Fulda, Department of Plant Biochemistry, Albrecht-von-Haller Institute for Plant Sciences, Georg-August University Goettingen, Justus-von-Liebig-Weg 11, D-37077 Goettingen, Germany Fax: +49 551 39 5749 Tel: +49 551 39 5750 E-mail: mfulda@gwdg.de *Present address Department of Biochemistry, Faculty of Science, Khon Kaen University, Thailand (Received January 2008, revised 12 March 2008, accepted 20 March 2008) In the present study, acyl-CoA synthetase mutants of Saccharomyces cerevisiae were employed to investigate the impact of this activity on certain pools of fatty acids We identified a genotype responsible for the secretion of free fatty acids into the culture medium The combined deletion of Faa1p and Faa4p encoding two out of five acyl-CoA synthetases was necessary and sufficient to establish mutant cells that secreted fatty acids in a growth-phase dependent manner The mutants accomplished fatty acid export during exponential growth-phase followed by fatty acid re-import into the cells during the stationary phase The data presented suggest that the secretion is driven by an active component The fatty acid re-import resulted in a severely altered ultrastructure of the mutant cells Additional strains deficient of any cellular acyl-CoA synthetase activity revealed an almost identical phenotype, thereby proving transfer of fatty acids across the plasma membrane independent of their activation with CoA Further experiments identified membrane lipids as the origin of the observed free fatty acids Therefore, we propose the recycling of endogenous fatty acids generated in the course of lipid remodelling as a major task of both acyl-CoA synthetases Faa1p and Faa4p doi:10.1111/j.1742-4658.2008.06417.x Fatty acid metabolism pervades large areas of cellular life In all known ramifications of this metabolism, fatty acids almost never undergo direct metabolic conversion as free molecules The fatty acid molecule usually requires the activation of its carboxyl group via esterification to either acyl-carrier-protein (ACP) or to CoA Only as thioesters are fatty acids able to accomplish any of their possible metabolic fates In Saccharomyces cerevisiae, the fatty acids are synthesized by a large multienzyme complex designated as fatty acid synthase (FAS) on the basis of ACP [1] In S cerevisiae, the ACP is an integral component of the FAS complex and, therefore, free acyl-ACP is not available for any other metabolic purposes The synthetic cycle is terminated by transferring the generated acyl chain directly to CoA [2] Due to this mechanism, the direct product of fatty acid de novo synthesis in S cerevisiae is acyl-CoA, which consequently is the only activated fatty acid molecule serving all other metabolic pathways [1] Besides deriving from de novo synthesis, lipid degradation as well as import of exogenous fatty acids may feed into the pool of intracellular fatty acids In both cases, enzymatic activation with CoA is required to allow further metabolization of these fatty acids In Abbreviations ACP, acyl-carrier protein; ER, endoplasmic reticulum; FAS, fatty acid synthase; Fat1p, fatty acid transport protein 1; Fat2p, fatty acid transport protein 2; YPR, yeast proteose raffinose medium FEBS Journal 275 (2008) 2765–2778 ª 2008 The Authors Journal compilation ª 2008 FEBS 2765 Fatty acid secretion in mutants of yeast M Scharnewski et al S cerevisiae, five genes coding for acyl-CoA synthetases have been identified All these activities are potentially able to mediate between the pool of free fatty acids and the pool of acyl-CoA molecules Four genes, termed FAA1 to FAA4 (fatty acid activation), were characterized in pioneering work by Gordon et al [3– 9] FAA1 and FAA4 encode acyl-CoA synthetases involved in the activation of imported fatty acids [10] Although Faa1p represents the major cellular activity, both enzymes display partial redundancy and a lack of either one can be compensated by the activity of the other [6] Faa1p localizes to the endoplasmic reticulum (ER), the plasma membrane and vesicles, whereas Faa4p is found at the ER as well as at lipid droplets [11] FAA2 encodes a peroxisomal activity involved in the activation of fatty acids scheduled for b-oxidation whereas the biological role of Faa3p has remained unclear to date In addition to the four FAA genes, FAT1 was identified as the fifth source of activity feeding into the acyl-CoA pool [12] Initially isolated as a protein involved in fatty acid transport across the plasma membrane [13,14], it finally proved to have acyl-CoA synthetase activity as well, with a preference for fatty acids with chain length longer than 22 carbons The protein was localized to lipid droplets and to the ER [11], but was also reported at the plasma membrane [15] Given the diverse functions of fatty acids within the metabolism, a carefully regulated distribution of fatty acids within the cell can be anticipated In this respect, it is of relevance that, besides the pure enzymatic reaction, acyl-CoA synthetase activity is also involved in fatty acid transport across membranes Cellular uptake as well as subcellular distribution of fatty acids could be influenced by this enzymatic activity converting a hydrophobic substrate into a water soluble CoA-ester It was first established in a mutant of Escherichia coli that a defective acyl-CoA synthetase abolished the uptake of fatty acids from the medium To emphasize the tight link between fatty acid transport and acylCoA synthetase activity, the mechanism was termed ‘vectorial acylation’ [16] In S cerevisiae, a comparable model was proposed and evidence was provided for a participation of Fat1p in transport in concert with the two acyl-CoA synthetases Faa1p and Faa4p [17] In this model, Fat1p is involved in the import mechanism directly, whereas acyl-CoA synthetases Faa1p and Faa4p is proposed to be responsible for the abstraction of the delivered fatty acid from the membrane and concomitantly rendering the fatty acid water soluble by esterification, thereby trapping the molecule in the cytoplasm On the other hand, the model is not without controversy and, alternatively, a concept has been 2766 developed describing fatty acid movement across a membrane as a passive process This mechanism of simple diffusion is based on the fast flip-flop of fatty acids through the membrane and has been reviewed comprehensively [18,19] Reviewing the currently available data, the precise role of acyl-CoA synthetases in regulating certain pools of fatty acids as well as their potential impact on fatty acid transport across membranes both remain elusive In this context, we were intrigued by two reports [20,21] linking the disruption of FAA1 in Candida lipolytica and in S cerevisiae to a fatty acid secretion phenotype In the mutant strains described, the control over certain fatty acid pools appeared to be restricted and, in addition, fatty acid transport could also be affected Because the mutant strains derived in both cases from random mutagenesis experiments, the exact genetic constitutions were not unequivocally established and the molecular basis for the phenotype may have been not fully understood However, if the underlying mechanisms of this phenotype could be elucidated, such a strain might provide a valuable tool to study the role of distinct acyl-CoA synthetases in regulating certain pools of fatty acids To assess the role of acyl-CoA synthetases in regulating particular pools of fatty acids, we used mutants of S cerevisiae characterized by various combinations of deletions in the corresponding genes In mutants defective for Faa1p and Faa4p, we observed a transient fatty acid secretion phenotype We demonstrate fatty acid transport in the absence of any acyl-CoA synthetase activity, and data are presented demonstrating that the direction of transport is dependent on the growth phase of the mutants In addition, we provide evidence for the hypothesis that Faa1p and Faa4p are involved in the recycling of fatty acids deriving from lipid remodelling processes Results faa1D faa4D mutant cells secrete a large amount of free fatty acids into the medium In a first attempt to explore the fatty acid secretion phenotype for the faa1D mutant described earlier by Michinaka et al [21], we employed the faa1D mutant strain YB497 instead (similar to the other YB strains generously provided by J I Gordon) and tested its ability to secrete fatty acids By contrast to the data presented by Michinaka et al [21], we were unable to detect even traces of free fatty acids in the culture medium by using this different strain harbouring the same mutation Because the strains investigated by FEBS Journal 275 (2008) 2765–2778 ª 2008 The Authors Journal compilation ª 2008 FEBS M Scharnewski et al Michinaka et al [21] resulted from a repeatedly employed mutagenesis with ethyl-methane sulfonate, the precise genotype of their mutant was not well established Nevertheless, the data presented appeared to indicate a role of Faa1p in the fatty acid secretion phenotype Assuming that one of the additional four acyl-CoA synthetases in S cerevisiae could mask the phenotype by overlapping functions, we assumed that a combined elimination of two or more of those activities might induce fatty acid secretion Therefore, we tested strains deficient in combinations of FAA1 and one or more additional FAA The experiments were complicated by the fact that strains carrying deletions in both FAA1 and FAA4 were flocculent in liquid culture, as described previously [10] This characteristic trait resulted in large cellular lumps swimming in an essentially clear medium, making it impossible to determine the status of the culture by measuring cell density By testing alternative medium compositions, a YP medium containing raffinose (YPR) instead of dextrose was identified to allow proper growth as homogenous cultures for all strains tested Because the use of raffinose was essential for the accurate measurement of cell density in different stages of the cultures, this sugar was used as carbon source for all following experiments unless otherwise noted The different strains were grown for 48 h in YPR before the cells were removed by centrifugation and the supernatant was extracted and tested for free fatty acids For strains carrying a combined deletion of FAA1 and FAA2 or of FAA1 and FAA3, we did not observe any fatty acid secretion phenotype However, the combined deletion of FAA1 and FAA4 resulted in the accumulation of significant amounts of free fatty acids in the culture medium Whereas no fatty acids were detected in the media of wild-type cells of 48-h-old cultures, approximately 220 lmolỈL)1 free fatty acids were found in the media of the mutant strain YB525 (see supplementary Fig S1) To investigate whether the deletion of additional Faap would further increase the amount of secreted fatty acids, we also tested the quadruple mutant YB526 deficient in four Faap activities The detected fatty acid concentrations in the media proved to be similar for the double and for the quadruple mutant, indicating that Faa2p and Faa3p are not significantly involved in the observed phenotype Surprisingly, the detected amounts of free fatty acids in the media were high enough to result in whitish flakes on the surface of the culture The composition of the secreted fatty acids reflects the profile of fatty acids found in membrane lipids of yeast and consists of myristic acid (14:0), palmitic acid (16:0), palmitoleic acid (16:1), stearic acid (18:0) and oleic acid (18:1) (see Fatty acid secretion in mutants of yeast supplementary Fig S1) We conclude from this experiment that the deletion of FAA1 and FAA4 is necessary and sufficient to produce the fatty acid secretion phenotype No other combination of FAA deletions keeping either FAA1 or FAA4 intact resulted in a comparable phenotype To characterize the observed phenotype in more detail, we first determined the progress of fatty acid secretion in a growing culture Therefore, we measured the concentration of free fatty acids in the media at several time points during the exponential and stationary growth phases In these experiments, a tight correlation between stage of growth and fatty acid secretion was observed, revealing several striking characteristics (Fig 1A) First, the total amount of fatty acids in the media increased continuously during early exponential phase Second, the fatty acid concentration in the media did not reach a stable plateau Instead, the total amount of fatty acids in the media started to decline during the late exponential phase and continued to decrease during the stationary phase Third, the point in time of maximum concentration in the media was different for specific fatty acids Whereas 16:0 reached its maximum concentration at 48 h and subsequently declined, the level of the unsaturated fatty acids 16:1 and 18:1 kept their maximum concentration until approximately 70 h before they also began to decline Taken together these results clearly identified the growth stage of the culture as being an important parameter influencing the fatty acid secretion phenotype In the next step, the underlying mechanisms were analysed Whereas export of free fatty acids from the cells during early exponential growth phase most probably explains the accumulation of fatty acids in the media, several alternative models may explain the subsequent decline in fatty acid concentration One possible interpretation would be a re-import of the initially secreted fatty acids back into the cells If this assumption is correct, this transport should result in an increase of free fatty acids within the cells because the mutant cells are unable to utilize these fatty acids due to the lack of acyl-CoA synthetase activity To evaluate this possibility, we measured the concentration of intracellular free fatty acids at the same time points during the exponential and stationary growth phases that had been used for the estimation of the extracellular fatty acids In addition, we determined the amount of lipid-bound fatty acids to cover all major pools of fatty acids (Fig 1B,D) The amount of cellular free fatty acids could be easily affected by lipid hydrolysis during the extraction procedure To rule out the possibility that major FEBS Journal 275 (2008) 2765–2778 ª 2008 The Authors Journal compilation ª 2008 FEBS 2767 Fatty acid secretion in mutants of yeast A M Scharnewski et al Fig Relationship between fatty acid concentration and stage of the culture (A) Extracellular free fatty acids in the culture medium of YB526 were determined at the time points indicated The bars representing individual fatty acids are indicated as 14:0 (black), 16:0 (dark gray), 16:1 (spotted), 18:0 (hatched), 18:1 (light gray) (B) Time-course of intracellular free fatty acid accumulation Intracellular free fatty acids accumulated by cells of YB526 were determined at the time points indicated (C) Growth curve of the culture [YB332 (triangle), YB526 (diamonds) and MS51 (square)] (D) Concentration of fatty acids in the pools of free fatty acids in the media (diamonds), of free fatty acids in the cells (square) and of esterified fatty acids (triangle) The error bars represent the SEM from three independent experiments B C D 2768 proportions of the detected free fatty acids are resulting from such effect, we analysed extractions with and without boiling and the results obtained were not significantly different Therefore, boiling was omitted in subsequent experiments To differentiate between free fatty acids and esterified fatty acids, the cellular lipid extracts were subjected to two different protocols to achieve either methylation of free fatty acids or transmethylation of esterified fatty acids [22,23] The concentration of bound fatty acids at different time points resulted in a typical curve corresponding to the growth of the culture and is independent of the observed changes in the pools of free fatty acids (Fig 1C,D) For the free fatty acids, the results clearly demonstrated that the decline of fatty acid concentration in the media was indeed paralleled by a constant increase of the concentration of intracellular free fatty acids (Fig 1D) This could indicate an import of fatty acids into the cells On the other hand, the increase of intracellular fatty acids in absolute amounts was approximately three-fold greater than the concomitant decrease of extracellular fatty acids Therefore, besides the import of exogenous fatty acids, additional release of internal fatty acids had to contribute to the increase of intracellular fatty acids However, analysis of the previously mentioned fatty acid specificity of the transport appeared to provide additional indications for ongoing fatty acid import As described earlier, the amount of 16:0 specifically decreased strongly in the media between time points 48 h and 65 h ()30.0 lmolỈL)1), whereas the concentration of the other fatty acids in the media changed only moderately during this period ()4.6 to +5.6 lmolỈL)1) Strikingly, it was also 16:0 that increased within the cells during this time interval in a much stronger fashion than any other fatty acid (+68.8 lmolỈL)1 versus +3.6 to +30.3 lmolỈL)1), suggesting re-import of 16:0 into the cell during this growth stage In summary, the results demonstrated an export of free fatty acids out of the FEBS Journal 275 (2008) 2765–2778 ª 2008 The Authors Journal compilation ª 2008 FEBS M Scharnewski et al Fatty acid secretion in mutants of yeast cells during the early exponential growth phase, whereas the strong increase of intracellular free fatty acids at the late exponential phase is compatible with the hypothesis that the reduction of fatty acid concentration in the media is due to a significant re-import of free fatty acids into the cells Fatty acid transport across the plasma membrane is functional in absence of all known acyl-CoA synthetases The translocation of fatty acids across the plasma membrane in the absence of Faap activity appeared to be in contrast to the model suggesting vectorial acylation as a basis for fatty acid transport [17] On the other hand, the strains used so far might contain residual acyl-CoA synthetase activity due to the presence of Fat1p, which was shown to possess this enzymatic activity also To address the question of whether fatty acid transport protein (Fat1p), or even fatty acid transport protein (Fat2p) for which no enzymatic activity has been demonstrated to date, is responsible for the fatty acid transport observed in the previous experiment, we generated knockout deletions of FAT1 and FAT2 in the background of the well established FAA quadruple mutant YB526 [6] The obtained strains with five (MS51) and six gene deletions (MS612), respectively, are devoid of any detectable acyl-CoA synthetase activity (data not shown) Both strains were subjected to the same measurements of free and bound fatty acids as described for the quadruple mutant The results indicated that the additional gene deletions did not change the capacity of the cells to transport fatty acids As shown in Fig 2, the loss of Fat1p resulted in even higher levels of intracellular free fatty acids during the stationary phase More importantly, the same two phases of early fatty acid export followed by re-import at later stages were observed in exactly the same chronological order as in the quadruple mutant Therefore, it was concluded that cells of S cerevisiae lacking any cellular acyl-CoA synthetase activity are nevertheless able to transport fatty acids efficiently across the plasma membrane Fat1p is responsible for remaining acyl-CoA synthetase activity of strain YB526 As shown above, the deletion of Fat1p in the background of the FAA quadruple mutant further increased the concentration of intracellular accumulated free fatty acids This suggested a capacity for Fat1p to access the pool of free fatty acids, most likely via its proven acyl-CoA synthetase activity [12] Fig Total amount of intracellular and extracellular fatty acids of YB526 and MS51 The cells were grown in YPR medium and harvested at different time points during the exponential and stationary phases Medium and cells were extracted and the total fatty acid concentrations of the different pools were determined The fatty acid concentrations are given for YB526 intracellular (square), YB526 extracellular (diamonds), MS51 intracellular (circle), and MS51 extracellular (triangle) The error bars represent the SEM from three independent experiments Despite in vitro assays for the acyl-CoA synthetase activity of Fat1p showing a strong specificity for very long chain fatty acids [12], our data also appeared to indicate activity against C16 and C18 fatty acids To test this possibility in vivo, we incubated the different strains with radiolabelled oleic acid Successful feeding of the exogenous fatty acid into the cellular acyl-CoA pool should result in incorporation of the label in the various lipid classes Cells of wild-type, YB526, MS51, MS52 and MS612 were grown in YPR to the early stationary phase before radiolabelled oleic acid was added Following incubation for 24 h, the cellular lipids were extracted and subjected to TLC (Fig 3) As expected, the lipid extract of wild-type cells showed the label spread to phospholipids and neutral lipids In comparison, the level of incorporation in YB526 cells was drastically reduced, but the label was still clearly detectable in phospholipids as well as an additional spot tentatively identified by co-migration with lipid standards as fatty acid ethyl ester (Fig 3) By contrast, there was no longer any incorporation of labelled fatty acids to either phospholipids or TAG if, in addition to the FAA genes, FAT1 was deleted, as shown by the lipid extracts of MS51 and MS612 The combined deletion of all FAA genes and FAT2 in strain MS52, on the other hand, resulted in the same level of incorporation as in YB526, indicating that Fat2p is not responsible for the remaining capacity to channel exogenous fatty acids into lipids Control strains carrying deletions in only FAT1 or FAT2, or in both FAT1 and FAT2, incorporated labelled fatty acids comparable to the wild-type (see supplementary Fig S2) Surprisingly, FEBS Journal 275 (2008) 2765–2778 ª 2008 The Authors Journal compilation ª 2008 FEBS 2769 Fatty acid secretion in mutants of yeast M Scharnewski et al Fig TLC of lipid extracts of yeast strains fed with radiolabelled oleic acid Cells of wild-type and the mutants indicated were grown for 24 h in the presence of radiolabelled oleic acid The cells were harvested by centrifugation, lipids were extracted, and these extracts were separated by solvent A [acetic acid methyl ester ⁄ isopropanol ⁄ chloroform-methanol ⁄ 0.75% KCl (25 : 25 : 28 : 10 : 7, v ⁄ v)] followed by solvent B (chloroform ⁄ acetone (8 : v ⁄ v) + 1% NH3) on silica plates Comparison between YB526 and MS51 clearly indicate that Fat1p in YB526 is responsible for the incorporation of exogenous oleate into phospholipids The band labelled as EE was tentatively identified as fatty acid ethyl esters produced by all strains even in absence of any acyl-CoA synthetase activity Lipid classes were determined by co-migration of lipid standards and staining with copper sulfate TAG, triacylglycerol; EE, fatty acid ethyl ester; OA, oleic acid; PC, phosphatidylcholine; PI, phosphatidyinositol; PS, phosphatidylserine The figure shows one representative result out of three independent experiments even in MS51 and MS612, the radioactive label showed up in the spot identified as fatty acid ethyl ester, demonstrating a potential to incorporate free fatty acids into fatty acid ethyl esters in absence of any acyl-CoA synthetase activity This observation supports a recent description of enzymatic activity found in microsomal preparations from plants and yeast that is able to acylate aliphatic alcohols without prior activation to acyl-thioesters [24] Irrespective of this side reaction, the labelling experiments identified Fat1p as the remaining acyl-CoA synthetase activity in the strain YB526 that is able to activate imported fatty acids prior to their incorporation into phospholipids The accumulated free fatty acids derive from lipid remodelling processes The strong accumulation of free fatty acids in the media and within the mutant cells raised questions 2770 regarding the metabolic origin of these molecules Obviously, acyl-CoA synthetase activity in wild-type cells is masking a permanent internal generation of significant amounts of free fatty acids To test whether these fatty acids were derived from lipid turn-over processes, we aimed to achieve a fatty acid modification that is restricted to lipid bound fatty acids For this purpose, we introduced a D12 specific lipid desaturase from sunflower into strain MS51 By contrast to the endogenous stearoyl-CoA desaturase, the heterologous D12-desaturase converts exclusively lipid-bound 18:1 to 18:2 [25,26] Due to the nature of this desaturase, the generated 18:2 was considered as marker for the pool of bound fatty acids Therefore, the occurrence of 18:2 in the pool of free fatty acids would argue for lipid turnover as the source of fatty acid accumulation The expression of the D12-desaturase resulted in diminished growth of the yeast cells, causing reduced levels of fatty acids in all pools measured However, analysis of lipid extracts of the transformed cells demonstrated 18:2 to be a significant constituent of the pool of esterified fatty acids, indicating successful expression of the D12-desaturase (Fig 4A) More interestingly, the pool of free fatty acids contained 18:2 as well; indicating a release of formerly lipid bound fatty acids into this pool (Fig 4B,C) Moreover, the ratio of the sum of all natural fatty acids of S cerevisiae (14:0 to 18:1) to the artificially produced 18:2 was almost identical in the fraction of bound fatty acids compared to the fraction of free fatty acids (11.19 and 11.03, respectively; see supplementary Table S1) This constant ratio would be in line with lipid remodelling processes as a source for the accumulated fatty acids in the mutant cells, provided that the release of the fatty acids is rather unspecific The direction of fatty acid transport is dependent on the metabolic state of the cells To gain further insight into the correlation of growth phase of the culture and the direction of fatty acid transport, we investigated the possibility of manipulating the transport by changing the medium conditions of the growing culture Therefore, we grew cells as described above in raffinose containing medium Approximately h after the cultures reached the stationary phase and the cells already started to re-import fatty acids from the media, we again fed raffinose to the cultures (Fig 5A–C) In controls, water was added to the cells As expected, the culture fed with raffinose started to grow again indicated by increasing attenuance (data not shown) We then analyzed the amount of fatty acids in the medium and inside the cells FEBS Journal 275 (2008) 2765–2778 ª 2008 The Authors Journal compilation ª 2008 FEBS M Scharnewski et al Fatty acid secretion in mutants of yeast A A B B C C Fig Profile of free and esterified fatty acids upon expression of D12-desaturase in MS51 Cells of strain MS51 expressing a D12desaturase of sunflower were grown for 70 h in minimal media before the cells were harvested and lipids were extracted The different pools of fatty acids were analyzed and presented as: (A) intracellular esterified fatty acids; (B) intracellular free fatty acids; (C) extracellular free fatty acids As a control, cells transformed with empty vector were extracted The bars representing individual fatty acids are depicted as 14:0 (dark gray), 16:0 (hatched), 16:1 (gray), 18:0 (spotted), 18:1 (light gray), 18:2 (black) The error bars represent the SEM from three independent experiments Surprisingly, the accumulation of free fatty acids inside the cells stopped immediately after adding raffinose (Fig 5A) Simultaneously, large quantities of free fatty Fig Feeding of raffinose to MS51 cells in stationary phase Total fatty acid concentration in different pools was measured in cultures fed with raffinose (diamonds) at time point 65 h (arrows) during the stationary phase (A–C) As a control, the same amount of water was added to separate cultures (square) (A) Free fatty acids inside the cells (B) Free fatty acids in the medium (C) Esterified fatty acids The error bars represent the SEM from three independent experiments acids were secreted by the cells (Fig 5B) At the same time, the concentration of the total esterified fatty acids remained constant (Fig 5C) To allow for simple comparison, the amount of fatty acids in the medium prior to the addition of either water or of raffinose was set as 100% In control experiments, we observed FEBS Journal 275 (2008) 2765–2778 ª 2008 The Authors Journal compilation ª 2008 FEBS 2771 Fatty acid secretion in mutants of yeast A B M Scharnewski et al a decrease of free fatty acids in the medium by 25% within 30 h This decrease is accompanied by an increase of cellular free fatty acids partly due to re-import, as described earlier By contrast, the amount of free fatty acids in the medium of the cultures fed with raffinose increased by 100% within 30 h after adding the raffinose The supply of raffinose allowed the cells, on the other hand, to maintain the concentration of free fatty acids inside the cells at a constant level When the supply of raffinose was finally exhausted, after approximately 95 h of the experiment, the cells again started to re-import fatty acids from the medium and to accumulate these fatty acids intracellularly in even higher amounts than in the control culture From these results, it was concluded that the direction of transport was reversible and that it was regulated by the metabolic state of the cells Cytological features of MS51 C D During the stationary phase of the culture, the concentration of free fatty acids found in the mutant cells was up to 50-fold greater than that observed in wildtype cells High concentrations of free fatty acids are believed to be rather unfavourable to cells due to their detergent character Nevertheless, the mutant cells were not only viable, but also showed only minor differences in their growth behaviour compared to wildtype To investigate whether the level of free fatty acids might have observable consequences for the cell, we inspected the subcellular morphology by electron microscopy Whereas most organelles, the cytoplasm and the plasma membrane showed no obvious anomaly, we observed a strikingly enlarged ER in the mutant cells (Fig 6) The mutant cells were pervaded by strands of ER with conspicuously dilated lumen This is especially apparent in the cortical ER, which is closely apposed to the cytoplasmic membrane (Fig 6C,D) The lumen appears darker than the cytoplasm (Fig 6B–D) and is filled with dark stained, laminated material This striking phenotype was observed in all mutant cells inspected, whereas it was never found in wild-type cells To a moderate extent, the dilated ER-phenotype was visible already in cells harvested during the exponential phase but it became Fig Electron microscopic analysis of cells of wild-type and MS51 in stationary phase Overview of wild-type (A) and mutant cells (B,C) In wild-type cells, the ER lumen is inconspicuous, ER lumen in mutant cells appears to be dilated; the ER is marked by arrows The ER lumen appears darker than the cytoplasm (C,D) and is filled with dark stained, laminated material (D) A detail of (C) is shown at higher magnification 2772 FEBS Journal 275 (2008) 2765–2778 ª 2008 The Authors Journal compilation ª 2008 FEBS M Scharnewski et al drastically enhanced in cells harvested from stationary phase (see supplementary Fig S3) Therefore, the severity of the symptoms appeared to correlate directly with the level of accumulated free fatty acids This observation might suggest that the mutant cells are able to deposit excess of free fatty acids specifically in the ER, thereby excluding an excess of free fatty acids from other cellular compartments Discussion The present study was designed to improve our understanding of acyl-CoA synthetase activity on different pools of fatty acids in S cerevisiae The experiments were initiated by data showing a fatty acid secretion phenotype for different yeast cells deficient of Faa1p [20,21] Despite not verifying the fatty acid secretion phenotype for strains of S cerevisiae deficient of Faa1p alone [21], we did observe fatty acid secretion in strains deficient not only in Faa1p, but also in Faa4p Because the faa1D mutant strain employed in the previous study [21] was isolated by a screen involving two independent rounds of mutagenesis with ethylmethane sulfonate, one possible explanation for the observed phenotype would be an unidentified additional mutation in FAA4 resulting in a faa1D faa4D genotype for the strain finally described The fatty acid secretion phenotype observed in the present study indicated that the presence of either Faa1p or Faa4p is necessary during exponential growth to keep endogenous free fatty acids inside the cell During the stationary phase, we then observed a re-import of those fatty acids previously secreted during the exponential growth phase This re-import finally resulted in a ratio of approximately 10 : of free fatty acids to esterified fatty acids in the mutant cells, whereas this ratio was approximately : 20 in wild-type cells The fatty acid secretion and re-import was observed not only in the faa1D faa4D double mutant, but also in the strains YB526, MS51 and MS612, indicating fatty acid uptake even in the absence of any cellular acyl-CoA synthetase activity Surprisingly, the direction of transport proved to be reversible Upon addition of raffinose to cells in the stationary growth phase, the import of fatty acids stopped immediately and export was again initiated The fast response resulting in an instantaneous reversion of the direction of net transport strongly argues for an active mechanism to achieve fatty acid export It is important to note that the additional deletion of FAT1 did not change the biphasic mode of fatty acid transport but it did further increase the amount of accumulated free fatty acids Whereas convincing data had been presented showing that Fat1p is impor- Fatty acid secretion in mutants of yeast tant for fatty acid import in S cerevisiae [27], the transport processes of fatty acid export and re-import observed in the present study were essentially independent of this previously described activity Instead, our results for Fat1p suggest partly overlapping functions with Faa1p and Faa4p with respect to the capacity to channel released fatty acids back into lipids This was demonstrated not only by the increased amounts of accumulated free fatty acids in the fivefold mutant MS51, but also by feeding experiments with radiolabelled fatty acids On the other hand, the activity of Fat1p alone was not strong enough to prevent the secretion of fatty acids upon combined deletion of FAA1 and FAA4 To allow for speculation about the biological role of the release of fatty acids, it was essential to gain information about their precise metabolic origin By expressing a lipid specific D12-desaturase from sunflower in the five-fold mutant MS51, we obtained data supporting the hypothesis that the majority of the secreted fatty acids were released from phospholipids The reasons for this release are not clear yet, but it appears to be legitimate to assume that lipid remodelling processes are involved that ensure continuous adaptation of membrane parameters to cellular needs Initial evidence for prominent lipid remodelling was obtained from analyses of the fatty acid composition of different lipid classes described as molecular species Despite the fact that the biosynthesis of each different phospholipid class involves common precursors, strong differences in the molecular species were detected [28] To establish distinct molecular species, a system involving sequential deacylation by phospholipases and reacylation by acyltransferases was proposed [29] Lipid labelling experiments strongly supported this model for S cerevisiae [28] and the results obtained from studies with rat hepatocytes provided information suggesting, for phosphatidylcholine and phosphatidylethanolamine, a similar rate of de novo synthesis and of remodelling activities [30] Taken together, these data indicate lipid remodelling as a quantitatively important process, which probably is responsible for the establishment of distinct molecular species of certain lipid classes In this respect, the free fatty acids observed in the present study are most likely the result of interrupted lipid remodelling processes Consequently, we propose the activation of endogenous free fatty acids produced within this recycling mechanism as a most important role for Faa1p and Faa4p Although being metabolically inaccessible to the mutant cells, the re-import of the released free fatty acids during stationary phase finally resulted in the accumulation of large amounts of free fatty acids FEBS Journal 275 (2008) 2765–2778 ª 2008 The Authors Journal compilation ª 2008 FEBS 2773 Fatty acid secretion in mutants of yeast M Scharnewski et al inside the cells By electron microscopy, the effect of this accumulation on cellular morphology was inspected and diagnosed as a severe phenotype of the ER To our knowledge, similar structures of the ER have not been described previously Because the strength of the phenotype corresponded to the level of accumulated free fatty acids, it is fair to assume that the free fatty acids themselves account for the dark stained dilated lumen of the ER How the free fatty acids are organized in these structures is currently unknown The accumulation of free fatty acids resulting in electron-dense material has recently been described in lipid bodies of pex5D cells that are unable to degrade fatty acids by b-oxidation [31] The observed structures were termed gnarls and it was speculated that they could represent self assembled fatty acid structures Different to the conspicuous ER phenotype of the faaD mutant cells, the gnarls were of a delicate nature and visible only upon permanganate staining [31] This might reflect the significantly lower amount of free fatty acids in cells containing gnarls compared to cells described in the present study Given the significant concentrations of free fatty acids, it was, nevertheless, remarkable to note that the morphological changes were limited to the ER, whereas the plasma membrane or membranes of other organelles were essentially unaffected This selectivity appeared to rule out passive dissolving of fatty acids into the lipophilic phase of membranes in general, but rather indicates specific channelling to the ER Such targeted intracellular transport of free fatty acids strongly suggests the existence of an active and most likely protein mediated process Taken together, the data obtained so far clearly demonstrate fatty acid uptake into the cell in the absence of any cellular acyl-CoA synthetase activity Therefore, the observed fatty acid transport and activation are not coupled but rather are separate tasks that are independent of each other These results appear to be in contradiction to the model of vectorial acylation postulating acyl-CoA synthetase activity as a prerequisite of fatty acid import In this model, it was suggested that fatty acids might be removed from the inner leaflet of the plasma membrane by acyl-CoA synthetase activities releasing acyl-CoA into the cytoplasm, thereby giving space for newly incoming fatty acids The model was based on a complete set of experiments showing severely diminished capacity of the strains faa1Dfaa4D and fat1D to metabolize exogenous fatty acids [10,27] The results obtained were interpreted as consequence of impeded fatty acid transport The crucial question is why these experiments failed to detect the transport that we observed in our 2774 investigations Initially, the cells in the previous studies were taken from cultures in the exponential growth phase During this stage, we showed, at least for mutants deficient of Faa1p and Faa4p, a phenotype of active fatty acid secretion obviously causing conflict with simultaneous fatty acid import By contrast, the strong capacity to import fatty acids in our experiments was observed for mutant cells in the stationary phase In addition, a comparison of the results obtained by uptake assays with C1-BODIPY-C12 [10,27] to those of the present study revealed the time scale as being another important difference The fatty acid uptake described in the present study is a rather slow process, observed over hours during the stationary phase, whereas the uptake involving acyl-CoA synthetase was measured with a fluorescent fatty acid analogue in the range of 60 s Nevertheless, the two different velocities in transport might fit into a common model describing the removal of fatty acids from the inner leaflet of the membrane by two different active components On the one hand, acyl-CoA synthetase activities were shown to make a contribution On the other hand, a targeted channelling of free fatty acids from the inner leaflet of the plasma membrane towards the endoplasmic reticulum could provide an alternative mechanism for removing free fatty acids from the membrane This alternative removal system might be less efficient and result in a slower net transfer across the membrane On the other hand, the proposed model is able to balance the results obtained in the present study with the model of vectorial acylation and would also reconcile previous results from other studies showing fatty acid transport in the absence of acyl-CoA synthetase activity [8,32] Experimental procedures Yeast strains and media The yeast strains used are shown in the supplementary (Table S2) YPR consisted of 1% yeast extract, 2% peptone and 2% raffinose Yeast proteose dextrose medium consisted of 1% yeast extract, 2% peptone and 2% dextrose Yeast supplemented minimal media contained 0.67% yeast nitrogen base, 2% raffinose, amino acid content according to Brent Supplement Mixture Dropout Powder (MP Biomedicals, LCC, Illkirch, France) (1.16 gỈL)1) 2% agar was added for solid media Cell growth Yeast cultures were grown for 18 h in YPR and diluted until D600 of 0.02 was reached in triplicate in flasks contain- FEBS Journal 275 (2008) 2765–2778 ª 2008 The Authors Journal compilation ª 2008 FEBS M Scharnewski et al ing 100 mL of YPR The cells were grown at 30 °C and harvested at time points specified Cell growth was monitored by D600 Cells were harvested by centrifugation and the cell pellet was resuspended in water to achieve appropriate densities (D600 in the range 0.1–0.8) Mutagenesis Gene deletions were carried out by a PCR-based deletion strategy, as previously described [33] Within the present study, two genes were targeted for deletion: FAT1 and FAT2, coding for Fat1p and Fat2p, respectively These genes were deleted in the strain YB526 already deficient of all four FAA genes [6] For the deletion of FAT1, the kanMX4 cassette was used as selection marker The resulting strain was termed MS51 For deletion of FAT2, the hygromycin phosphotransferase under control of translation elongation factor EF-1a promoter and cytochrome C (CYC1) terminator from S cerevisiae was employed The strain lacking FAT1 as well as FAT2 was designated as MS612 The deletion cassettes were transformed into the cells using a modified version of the protocol described previously [34] Primers used for deletion of FAT1: FAT1forward, ATTCTATATCTGTGAACTTTTAATAGGCTGCGAAT ACCGACTATGCGTACGCTGCAGGTCGAC; FAT1reverse, CATCCAAACCCTTTGGTAATTTTTGCTCTCT ATAAACCTTCTTCAATCGATGAATTCGAGCTCG Primers used for deletion of FAT2: FAT2forward, GTGCTGCAAGAGGTTAGACGCTTCACGCACATTTT TGCTACAATGCGTACGCTGCAGGTCGAC; FAT2reverse, GATAGAAGCTTTCAGAGAGCATAAAATTGT ACAGGATACTGCCTAATCGATGAATTCGAGCTCG Expression of D12-desaturase and fatty acid isomerase FAD2-1 from sun flower encoding a D12-desaturase cloned in pYES2 was generously provided by J M MartinezRivas [35] and was transformed into MS51 Transformed yeast cells were grown for 18 h in synthetic complete medium (2% raffinose) and diluted until D600 of 0.3 was reached in duplicate in flasks containing 20 mL of synthetic complete medium (2% galactose) The cell suspension was harvested at 72 h and subjected to lipid extraction Preparation of yeast cells and extracellular fraction Yeast cells suspension (2 mL) was collected at the time points specified Cells and extracellular fraction were separated by centrifugation at 1500 g for Extracellular fraction or supernatant (1 mL) was transferred to a new mL microcentrifuge tube The remainder of the supernatant was discarded The cell pellet was washed once with water Fatty acid secretion in mutants of yeast Lipid analytical methods Yeast cell pellet and supernatant were transferred to 10 mL glass tubes with glass-stop corks The cell pellet was resuspended in mL of distilled water and glass beads (425– 600 lm) were added to break the cells Intracellular and extracellular lipid extractions were performed using heptadecanoic acid (17:0) as internal standard for free fatty acids (1 lg for wild-type and 10 lg for mutant cells) and triheptadecanoylglycerol as internal standard for esterified fatty acid (10 lg) [36] Free fatty acids from intracellular and extracellular lipid extracts were methylated according to a modified protocol described previously [22] In brief, the lipid extract (50 lL) was transferred to a new glass tube and dried under a stream of nitrogen Methanol (400 lL) was added together with 10 lL of 1-ethyl-3-(3-dimethylaminopropylcarbodiimide) (0.1 mgỈlL)1 in methanol) and incubated for h at 22 °C The reaction was stopped by adding 200 lL of saturated NaCl solution The methyl esters of free fatty acids were extracted with mL of hexane followed by centrifugation at 200 g for The upper hexane phase was transferred to a 1.5 mL microcentrifuge tube, dried and resuspended in acetonitrile (10 lL) and analyzed by gas chromatography Esterified fatty acids from intracellular lipid extracts were transmethylated according to a modified protocol described previously [23] Lipid extract (50 lL) was transferred to a mL microcentrifuge tube and dried under a stream of nitrogen 333 lL methanol ⁄ toluene (1 : 1, v ⁄ v) and 167 lL 0.5 m sodium methoxide were added and left at 22 °C After 20 min, the reaction was stopped by adding 500 lL of m NaCl and 50 lL of 32% hydrochloric acid The methyl esters of free fatty acids were extracted with mL of hexane followed by centrifugation at 2300 g for The upper hexane phase was transferred to a new 1.5 mL microcentrifuge tube, dried and resuspended in acetonitrile (10 lL) The fatty acid methyl esters were analyzed by gas chromatography using an Agilent 6890 series gas chromatograph equipped with a capillary DB-23 column (Agilent Technologies, Waldbronn, Germany) Lipid labelling using radiolabelled oleic acid Yeast strains were grown for 18 h in YPR and diluted to until D600 of 0.03 was reached in a flask containing 20 mL of YPR After dilution, yeast strains were grown to late exponential stage (48 h) Aliquots (4 mL) were transferred to 10 mL flasks in duplicate prior to addition of 0.27 lCi 14 C-18:1 (Amersham Biosciences, Bucks, UK) (5 nmol) The specific activity of the 14C oleic acid was 56 mCiỈ mmol)1 After 24 h of incubation, a mL cell suspension was collected and cells were harvested by centrifugation and subjected to lipid extraction Lipid extracts were FEBS Journal 275 (2008) 2765–2778 ª 2008 The Authors Journal compilation ª 2008 FEBS 2775 Fatty acid secretion in mutants of yeast M Scharnewski et al separated by TLC in a single dimension using methylacetate ⁄ isopropyl alcohol ⁄ chloroform ⁄ methanol ⁄ 0.25% KCl (25 : 25 : 28 : 10 : 7, v ⁄ v) as solvent Neutral lipids and free fatty acids were separated using chloroform ⁄ acetone (8 : 2, v ⁄ v) and 1% NH3 as second solvent Lipid standards were included on each TLC plate Radiolabelled lipids were visualized by fluorography Raffinose feeding to cells in stationary phase The strain MS51 was grown for 18 h in YPR and diluted until D600 of 0.02 was reached in flasks containing 100 mL of YPR The cells were grown at 30 °C to early stationary phase before 2% raffinose (or the same volume H2O as control) was added to the culture Subsequently, the cells were harvested at specified time points The experiment was performed in duplicate Electron microscopy Yeast cells were grown in YPR medium Samples were removed during the exponential and stationary growth phases and the cells were harvested by centrifugation at 5000 g for 10 The pellet was then resuspended in 50 mm potassium phosphate buffer, chemically fixed in 0.5% (w ⁄ v) formaldehyde and 0.3% (w ⁄ v) glutardialdehyde solution for 90 at °C Cells were then washed by two rounds of centrifugation and resuspension in potassium phosphate buffer A 100 lL portion of a resuspended cell pellet was embedded in 1.5% (w ⁄ v) molten agar (final concentration) The agar block was cut to small pieces of mm3 volume, and the pieces were then dehydrated in a graded methanol series (15%, v ⁄ v, 30% for 15 min; 50%, 75%, 95% for 30 min; 100% for h) under concomitant temperature reduction to )40 °C The samples were infiltrated with Lowicryl K4M resin (Sigma, Heidelberg, Germany) (50%, v ⁄ v, in methanol for h; 66%, v ⁄ v, for h;100% for 10 h), then polymerized for 24 h at –40 °C and for days at 22 °C [37,38] Resin sections of 80–100 nm in thickness were cut with glass knives, mounted on formvar-coated specimen grids and stained with 3% (w ⁄ v) phosphotungstic acid (pH 7.0) Electron microscopy was performed in a Philips EM 301 transmission electron microscope (Philips, Eindhoven, the Netherlands) at 80 kV and calibrated magnifications Acknowledgements We thank Jeffery I Gordon for generously providing yeast strains and Ingo Heilmann and Ivo Feussner for critical reading of this manuscript We obtained cassettes for disruptional mutations from EUROSCARF ´ (Frankfurt, Germany) We thank Jose Martinez-Rivas for the plasmid encoding the desaturase FAD2-1 of 2776 Helianthus annuus L This work was supported in part by grant DFG FU430 ⁄ 2-3 References Schweizer E & Hofmann J (2004) Microbial type I fatty acid synthases (FAS): major players in a network of cellular FAS systems Microbiol Mol Biol Rev 68, 501–517 Schweizer E, Lerch I, Kroeplin-Rueff L & Lynen F (1970) Fatty acyl transferase Characterization of the enzyme as part of the yeast fatty acid synthetase complex by the use of radioactively labeled coenzyme A Eur J Biochem 15, 472–482 Duronio RJ, Knoll LJ & Gordon JI (1992) Isolation of a Saccharomyces cerevisiae long chain fatty acyl:CoA synthetase gene (FAA1) and assessment of its role in protein N-myristoylation J Cell Biol 117, 515–529 Knoll LJ & Gordon JI (1993) Use of Escherichia coli strains containing fad mutations plus a triple plasmid expression system to study the import of myristate, its activation by Saccharomyces cerevisiae acyl-CoA synthetase, and its utilization by S cerevisiae myristoylCoA:protein N-myristoyltransferase J Biol Chem 268, 4281–4290 Knoll LJ, Johnson DR & Gordon JI (1994) Biochemical studies of three Saccharomyces cerevisiae acyl-CoA synthetases, Faa1p, Faa2p, and Faa3p J Biol Chem 269, 16348–16356 Johnson DR, Knoll LJ, Levin DE & Gordon JI (1994b) Saccharomyces cerevisiae contains four fatty acid activation (FAA) genes: an assessment of their role in regulating protein N-myristoylation and cellular lipid metabolism J Cell Biol 127, 751–762 Johnson DR, Knoll LJ, Rowley N & Gordon JI (1994a) Genetic analysis of the role of Saccharomyces cerevisiae acyl-CoA synthetase genes in regulating protein N-myristoylation J Biol Chem 269, 18037–18046 Knoll LJ, Johnson DR & Gordon JI (1995a) Complementation of Saccharomyces cerevisiae strains containing fatty acid activation gene (FAA) deletions with a mammalian acyl-CoA synthetase J Biol Chem 270, 10861–10867 Knoll LJ, Schall OF, Suzuki I, Gokel GW & Gordon JI (1995b) Comparison of the reactivity of tetradecenoic acids, a triacsin, and unsaturated oximes with four purified Saccharomyces cerevisiae fatty acid activation proteins J Biol Chem 270, 20090–20097 10 Faergeman NJ, Black PN, Zhao XD, Knudsen J & DiRusso CC (2001) The Acyl-CoA synthetases encoded within FAA1 and FAA4 in Saccharomyces cerevisiae function as components of the fatty acid transport system linking import, activation, and intracellular utilization J Biol Chem 276, 37051–37059 FEBS Journal 275 (2008) 2765–2778 ª 2008 The Authors Journal compilation ª 2008 FEBS M Scharnewski et al 11 Natter K, Leitner P, Faschinger A, Wolinski H, McCraith S, Fields S & Kohlwein SD (2005) The spatial organization of lipid synthesis in the yeast Saccharomyces cerevisiae derived from large scale green fluorescent protein tagging and high resolution microscopy Mol Cell Proteomics 4, 662–672 12 Watkins PA, Lu JF, Steinberg SJ, Gould SJ, Smith KD & Braiterman LT (1998) Disruption of the Saccharomyces cerevisiae FAT1 gene decreases very long-chain fatty acyl-CoA synthetase activity and elevates intracellular very long-chain fatty acid concentrations J Biol Chem 273, 18210–18219 13 Schaffer JE & Lodish HF (1994) Expression cloning and characterization of a novel adipocyte long chain fatty acid transport protein Cell 79, 427–436 14 Faergeman NJ, DiRusso CC, Elberger A, Knudsen J & Black PN (1997) Disruption of the Saccharomyces cerevisiae homologue to the murine fatty acid transport protein impairs uptake and growth on long-chain fatty acids J Biol Chem 272, 8531–8538 15 Obermeyer T, Fraisl P, DiRusso CC & Black PN (2007) Topology of the yeast fatty acid transport protein Fat1p: mechanistic implications for functional domains on the cytosolic surface of the plasma membrane J Lipid Res 48, 2354–2364 16 Overath P, Pauli G & Schairer HU (1969) Fatty acid degradation in Escherichia coli An inducible acylCoA synthetase, the mapping of old mutants, and the isolation of regulatory mutants Eur J Biochem 7, 559–574 17 Zou Z, Tong F, Faergeman NJ, Borsting C, Black PN & DiRusso CC (2003) Vectorial acylation in Saccharomyces cerevisiae Fat1p and fatty acyl-CoA synthetase are interacting components of a fatty acid import complex J Biol Chem 278, 16414–16422 18 Hamilton JA, Guo W & Kamp F (2002) Mechanism of cellular uptake of long-chain fatty acids: we need cellular proteins? Mol Cell Biochem 239, 17–23 19 Kamp F & Hamilton JA (2006) How fatty acids of different chain length enter and leave cells by free diffusion Prostaglandins Leukot Essent Fatty Acids 75, 149–159 20 Miyakawa T, Nakajima H, Hamada K, Tsuchiya E, Kamityo K & Fukui S (1984) Isolation and characterization of a mutant of Candida lipolytica which excretes long-chain fatty acids Agric Biol Chem 48, 499–503 21 Michinaka Y, Shimauchi T, Aki T, Nakajima T, Kawamoto S, Shigeta S, Suzuki O & Ono K (2003) Extracellular secretion of free fatty acids by disruption of a fatty acyl-CoA synthetase gene in Saccharomyces cerevisiae J Biosci Bioeng 95, 435–440 22 Stumpe M, Kandzia R, Gobel C, Rosahl S & Feussner I (2001) A pathogen-inducible divinyl ether synthase (CYP74D) from elicitor-treated potato suspension cells FEBS Lett 507, 371–376 Fatty acid secretion in mutants of yeast 23 Christie WW (1982) A simple procedure for rapid transmethylation of glycerolipids and cholesteryl esters J Lipid Res 23, 1072–1075 24 Neal A, Banas A, Banas W, Stahl U, Carlsson AS & Stymne S (2006) Microsomal preparations from plant and yeast acylate free fatty acids without prior activation to acyl-thioesters Biochim Biophys Acta 1761, 757– 764 25 Browse J, Roughan PG & Slack CR (1981) Light control of fatty acid synthesis and diurnal fluctuations of fatty acid composition in leaves Biochem J 196, 347– 354 26 Slack CR, Roughan PG & Terpstra J (1976) Some properties of a microsomal oleate desaturase from leaves Biochem J 155, 71–80 27 DiRusso CC, Connell EJ, Faergeman NJ, Knudsen J, Hansen JK & Black PN (2000) Murine FATP alleviates growth and biochemical deficiencies of yeast fat1Delta strains Eur J Biochem 267, 4422–4433 28 Wagner S & Paltauf F (1994) Generation of glycerophospholipid molecular species in the yeast Saccharomyces cerevisiae Fatty acid pattern of phospholipid classes and selective acyl turnover at sn-1 and sn-2 positions Yeast 10, 1429–1437 29 Lands WEM & Crawford CG (1976) Enzymes of membrane phospholipid metabolism In The Enzymes of Biological Membranes (Martonosi AN, ed), pp 3–85 Plenum Press, New York, NY 30 Schmid PC, Deli E & Schmid HH (1995) Generation and remodeling of phospholipid molecular species in rat hepatocytes Arch Biochem Biophys 319, 168–176 31 Binns D, Januszewski T, Chen Y, Hill J, Markin VS, Zhao Y, Gilpin C, Chapman KD, Anderson RG & Goodman JM (2006) An intimate collaboration between peroxisomes and lipid bodies J Cell Biol 173, 719–731 32 Blobel F & Erdmann R (1996) Identification of a yeast peroxisomal member of the family of AMP-binding proteins Eur J Biochem 240, 468–476 33 Wach A, Brachat A, Pohlmann R & Philippsen P (1994) New heterologous modules for classical or PCRbased gene disruptions in Saccharomyces cerevisiae Yeast 10, 1793–1808 34 Ito H, Fukuda Y, Murata K & Kimura A (1983) Transformation of intact yeast cells treated with alkali cations J Bacteriol 153, 163–168 35 Martinez-Rivas JM, Sperling P, Luehs W & Heinz E (2001) Spatial and temporal regulation of three different microsomal oleate desaturase genes (FAD2) from normal-type and high-oleic varieties of sunflower (Helianthus annuus L.) Mol Breeding 8, 159–168 36 Bligh EG & Dyer WJ (1959) A rapid method of total lipid extraction and purification Can J Biochem Physiol 37, 911–917 37 Roth J, Bendayan M, Carlemalm E, Vilinger W & Garavito M (1981) Enhancement of structural FEBS Journal 275 (2008) 2765–2778 ª 2008 The Authors Journal compilation ª 2008 FEBS 2777 Fatty acid secretion in mutants of yeast M Scharnewski et al preservation and immunocytochemical staining in low temperature embedded pancreatic tissue J Histochem Cytochem 29, 663–671 38 Hoppert M & Holzenburg A (1998) Electron Microscopy in Microbiology Bios Scientific Publishers (Bios-Springer), New York, NY Supplementary material The following supplementary material is available online: Fig S1 Secretion of free fatty acids of FAA-deficient cells Fig S2 TLC of lipid extracts of yeast strains fed with radiolabelled oleic acid 2778 Fig S3 Electron microscopic analysis of MS51 cells in the exponential phase Table S1 Ratio of the sum of natural fatty acids to 18:2 produced by the expression of a D12-desaturase of sunflower Table S2 Yeast strains used in this study This material is available as part of the online article from http://www.blackwell-synergy.com Please note: Blackwell Publishing are not responsible for the content or functionality of any supplementary materials supplied by the authors Any queries (other than missing material) should be directed to the corresponding author for the article FEBS Journal 275 (2008) 2765–2778 ª 2008 The Authors Journal compilation ª 2008 FEBS ... certain pools of fatty acids To assess the role of acyl-CoA synthetases in regulating particular pools of fatty acids, we used mutants of S cerevisiae characterized by various combinations of deletions... exogenous fatty acids, additional release of internal fatty acids had to contribute to the increase of intracellular fatty acids However, analysis of the previously mentioned fatty acid specificity of. .. (square)] (D) Concentration of fatty acids in the pools of free fatty acids in the media (diamonds), of free fatty acids in the cells (square) and of esterified fatty acids (triangle) The error