complex submanifolds of a space of positive holomorphic biiectional curvature
Rigidity of immersed submanifolds in a hyperbolic space
... Dung, Department of Mathematics, Mechanics and Informatics (MIM), Hanoi University of Sciences (HUS-VNU), No 334, Nguyen Trai Road, Thanh Xuan, Hanoi, Vietnam E-mail address: dungmath@gmail.com ... An estimate on the Ricci curvature of a submanifold and some applications, Proc Amer Math Soc., 114 (1992) 1051-1063 [11] P Li and L F Tam, Harmonic functions and the structure of complete manifolds, ... complete manifolds with weighted Poincar´e inequality and applications, Nagoya Math Jour, 206 (2012) 25-37 [8] D Hoffman and J Spruck, Sobolev and isoperimetric iequalities for Riemannian submanifolds, ...
- 10
- 88
- 0
Báo cáo khóa học: Disruption of the interaction between the Rieske iron–sulfur protein and cytochrome b in the yeast bc1 complex owing to a human disease-associated mutation within cytochrome b potx
... Dual Color standardsÕ (Bio-Rad) (10–250 kDa) were used for estimation of molecular mass Polyclonal antisera against cytochrome c oxidase subunits VI and VIa were kindly supplied by J W Taanman ... mitochondrial membrane preparations (data not shown) This could be a result of the instability of the mutant enzyme and an increased sensitivity to degradation during membrane preparation, as discussed ... lauryl maltoside, pH 7.5 The concentration of bc1 complex in the activity assay was 2.5 nM (A) Activity of the mutant enzyme as a function of the substrate QH2 concentration (B) The rate of cytochrome...
- 7
- 498
- 0
Đề tài " On the periods of motives with complex multiplication and a conjecture of GrossDeligne " pdf
... X; a subvariety of X has a cycle class in the dual of a rational homology space of X and the duals of these cycle classes span a subspace of homology, which might be large Up to normalisation, ... VINCENT MAILLOT AND DAMIAN ROESSLER Recall that an Artin character of Q is a character of a finite dimensional complex representation of the automorphism group of the normalisation Q of Q over ... Recall that a period of an algebraic variety defined by polynomial equations with algebraic coefficients is the integral of an algebraic differential against a rational homology cycle In his article...
- 29
- 512
- 0
Báo cáo khoa học: Ternary complex formation of pVHL, elongin B and elongin C visualized in living cells by a fluorescence resonance energy transfer–fluorescence lifetime imaging microscopy technique docx
... GCTTCTGTTCCTCCATGGTGGT-3¢, and 5¢-CTAGAC CACCATGGACTACAAAGACGATGACGATAAAGAT ATCCCGGGTTAACT-3¢ and 5¢-CTAGAGTTAACCCGG GATATCTTTATCGTCATCGTCTTTGTAGTCCATGG TGGT-3¢, respectively pBOS-HA-pVHL was constructed ... similarly by using the synthesized oligonucleotides 5¢-CTAGACCA CCATGGAGGAACAGAAGCTGATCAGTGAGGAAG ACCTGGATATCCCGGGTTAACT-3¢ and 5¢-CTAGAG TTAACCCGGGATATCCAGGTCTTCCTCACTGATCA GCTTCTGTTCCTCCATGGTGGT-3¢, ... 5¢-CTAGAC CACCATGTACCCCTACGACGTGCCCGACTACGCCG ATATCCCGGGTTAACT-3¢ and 5¢-CTAGAGTTAACC CGGGATATCGGCGTAGTCGGGCACGTCGTAGGGG TACATGGTGGT-3¢, into the XbaI site of pBOS Vector pBOS-Myc and pBOSFlag...
- 9
- 420
- 0
Báo cáo hóa học: " Uniqueness of positive solutions to a class of semilinear elliptic equations" potx
... modification to [8] Lemma 3.2 Assume a Î N and f(t,u) satisfies (F1), then (H1) j(t ,a) vanishes at least once and at most finitely many times in (a, b (a) ), (H2) if
- 9
- 343
- 0
Báo cáo hóa học: " On existence and uniqueness of positive solutions to a class of fractional boundary value problems" pot
... doi:10.1016/S0006-3495(95)80157-8 Mainardi, F: Fractional calculus: Some basic problems in continuum and statistical mechanics In: Carpinteri CA, Mainardi F (eds.) Fractal and Fractional Calculus in Continuum Mechanics pp ... Fractional Calculus and Fractional Differential Equations Wiley, New York (1993) 10 Podlubny, I: Fractional Differential Equations Academic Press, San Diego (1999) 11 Lakshmikantham, V, Vatsala, AS: ... AS: Basic theory of fractional differential equations Nonlinear Anal 69, 2677–2682 (2008) doi:10.1016/j.na.2007.08.042 12 Lakshmikantham, V: Theory of fractional functional differential equations...
- 9
- 418
- 0
báo cáo hóa học: " On existence and uniqueness of positive solutions to a class of fractional boundary value problems" ppt
... doi:10.1016/S0006-3495(95)80157-8 Mainardi, F: Fractional calculus: Some basic problems in continuum and statistical mechanics In: Carpinteri CA, Mainardi F (eds.) Fractal and Fractional Calculus in Continuum Mechanics pp ... Fractional Calculus and Fractional Differential Equations Wiley, New York (1993) 10 Podlubny, I: Fractional Differential Equations Academic Press, San Diego (1999) 11 Lakshmikantham, V, Vatsala, AS: ... AS: Basic theory of fractional differential equations Nonlinear Anal 69, 2677–2682 (2008) doi:10.1016/j.na.2007.08.042 12 Lakshmikantham, V: Theory of fractional functional differential equations...
- 9
- 415
- 0
báo cáo hóa học: " Existence and multiplicity of positive solutions for a nonlocal differential equation" docx
... that (i) {x Î P (a, a, b): a (x) >a} ≠ ∅ and a (Ax) >a for x Î P (a, a, b); (ii) ||Ax|| a for x Î P (a, a, c) with ||Ax|| >b Then, A has at least three fixed points ... http://www.boundaryvalueproblems.com/content/2011/1/5 Page 11 of 11 Author details College of Aeronautics and Astronautics, Nanjing University of Aeronautics and Astronautics, Nanjing 210016, ... Republic of China 2College of Science, Hohai University, Nanjing 210098, People’s Republic of China 3Department of Mathematics, Nanjing University of Aeronautics and Astronautics, Nanjing 210016,...
- 11
- 324
- 0
Báo cáo hóa học: " Research Article Existence of Positive Solutions to a Boundary Value Problem for a Delayed Nonlinear Fractional Differential System " ppt
... Lakshmikantham, S Leela, and J Vasundhara Devi, Theory of Fractional Dynamic Systems, Cambridge Scientific, Cambridge, UK, 2009 V Lakshmikantham and A S Vatsala, “Basic theory of fractional differential ... Debnath, “Recent applications of fractional calculus to science and engineering,” International Journal of Mathematics and Mathematical Sciences, no 54, pp 3413–3442, 2003 J Sabatier, O P Agrawal, ... problem of nonlinear fractional differential ¨ equation,” Journal of Mathematical Analysis and Applications, vol 311, no 2, pp 495–505, 2005 11 M Benchohra, S Hamani, and S K Ntouyas, “Boundary value...
- 17
- 361
- 0
Báo cáo hóa học: " Research Article The Existence of Positive Solution to a Nonlinear Fractional Differential Equation with Integral Boundary Conditions" potx
... Devi, Theory of Fractional Dynamic Systems, Cambridge Academic, Cambridge, UK, 2009 V Lakshmikantham and A S Vatsala, “Basic theory of fractional differential equations,” Nonlinear Analysis Theory, ... & Applications, vol 69, no 8, pp 2677–2682, 2008 V Daftardar-Gejji, Positive solutions of a system of non-autonomous fractional differential equations,” Journal of Mathematical Analysis and Applications, ... Applications, vol 302, no 1, pp 56–64, 2005 V Daftardar-Gejji and S Bhalekar, “Boundary value problems for multi-term fractional differential equations,” Journal of Mathematical Analysis and Applications,...
- 14
- 430
- 0
Báo cáo hóa học: " Research Article Eigenvalue Problem and Unbounded Connected Branch of Positive Solutions to a Class of Singular Elastic Beam Equations" docx
... Differential and Integral Equations, vol 2, no 1, pp 91–110, 1989 Z Bai, “The method of lower and upper solutions for a bending of an elastic beam equation,” Journal of Mathematical Analysis and Applications, ... fourth-order boundary value problems,” Journal of Mathematical Analysis and Applications, vol 116, no 2, pp 415–426, 1986 R P Agarwal, “On fourth order boundary value problems arising in beam analysis,” ... Mathematics for providing research facilities The author also thanks the anonymous referees for their careful reading of the first draft of the manuscript and making many valuable suggestions Research...
- 21
- 286
- 0
báo cáo hóa học:" Research Article Existence of Positive Solutions of a Singular Nonlinear Boundary Value Problem" potx
... UK, 2008 12 A Krist´ ly, V R˘ dulescu, and C Varga, Variational Principles in Mathematical Physics, Geometry, a a and Economics: Qualitative Analysis of Nonlinear Equations and Unilateral Problems, ... boundary value problems,” Journal of Mathematical Analysis and Applications, vol 293, no 1, pp 108–124, 2004 X Yang, Positive solutions for nonlinear singular boundary value problems,” Applied Mathematics ... “Upper and lower solutions for a generalized Emden-Fowler equation,” Journal of Mathematical Analysis and Applications, vol 181, no 3, pp 684–700, 1994 X Xu and J Ma, A note on singular nonlinear...
- 16
- 249
- 0
báo cáo hóa học:" Research Article Existence and Multiplicity of Positive Solutions of a Boundary-Value Problem for Sixth-Order ODE with Three Parameters" pdf
... fourth-order boundary value problems with two parameters,” Journal of Mathematical Analysis and Applications, vol 281, no 2, pp 477–484, 2003 S Fan, “The new root formula and criterion of cubic equation,” ... 2.1 Let A b2 − 3ac, B bc − 9ad, C c2 − 3bd, Δ B2 − 4AC, 2.2 one has the following: Equation 2.1 has a triple root if A B 0, Equation 2.1 has a real root and two mutually conjugate imaginary roots ... 2006 L A Peletier and W C Troy, Spatial Patterns, vol 45 of Progress in Nonlinear Differential Equations and their Applications, Birkh¨ user Boston, Boston, Mass, USA, 2001 a L A Peletier and V...
- 13
- 397
- 0
báo cáo hóa học:" Existence of positive solutions for fourth-order semipositone multi-point boundary value problems with a sign-changing nonlinear term" docx
... plan of the article is as follows Section contains a number of lemmas useful to the derivation of the main results The proof of the main results will be stated in Section A class of examples are ... the above mentioned works, the present work may be viewed as a direct attempt to extend the results of [3,13] to a broader class of nonlinear boundary value problems in a general Banach spaces ... Acknowledgments The author is very grateful to Editor of the Journal and the anonymous referees for their carefully reading of the first draft of the manuscript and making many valuable suggestions 22 and comments...
- 25
- 221
- 0
báo cáo hóa học:" Existence and multiplicity of positive solutions for a class of p(x)-Kirchho type equations" ppt
... −∆p(x) u is said to be the p(x)-Laplacian, and becomes p-Laplacian when p(x) ≡ p (a constant) The p(x)-Laplacian possesses more complicated nonlinearities than the p-Laplacian; for example, it is ... Zhao, D: On the Spaces Lp(x) and W m,p(x) J Math Anal Appl 263, 424–446 (2001) [15] Dai, G, Ma, R: Solutions for a p(x)-Kirchhoff type equation with Neumann boundary data Nonlinear Anal Real ... Nonlinear Anal 36, o 295–318 (1996) [45] Amann, H: Fixed point equations and nonlinear eigenvalue problems in ordered Banach spaces SIAM Rev 18, 620–709 (1976) [46] Chang, KC: A variant of mountain...
- 35
- 437
- 0
báo cáo hóa học:" Research Article Existence and Uniqueness of Positive Solutions for Discrete Fourth-Order Lidstone Problem with a Parameter" doc
... estimates on multiple solutions of Lidstone boundary value problems,” Acta Mathematica Hungarica, vol 86, no 1-2, pp 137–168, 2000 16 P J Y Wong and R P Agarwal, “Characterization of eigenvalues ... supported financially by the National Natural Science Foundation of China 10971046 , the Natural Science Foundation of Shandong Province ZR2009AM004 , and the Youth Science Foundation of Shanxi Province ... Equations, Kluwer Academic Publishers, Dordrecht, The Netherlands, 1999 R P Agarwal, K Perera, and D O’Regan, “Multiple positive solutions of singular and nonsingular discrete problems via variational...
- 18
- 282
- 0
báo cáo hóa học:" Research Article Existence and Uniqueness of Positive Solution for a Singular Nonlinear Second-Order m-Point Boundary Value Problem" potx
... H Wang, Positive solutions of nonlinear three-point boundary-value problems,” Journal of Mathematical Analysis and Applications, vol 279, no 1, pp 216–227, 2003 22 P K Palamides, Positive and ... first order derivative,” Journal of Mathematical Analysis and Applications, vol 290, no 1, pp 291–301, 2004 15 R A Khan and J R L Webb, “Existence of at least three solutions of a second-order ... for positive solutions of some semi-positone three-point boundary value problems,” Journal of Mathematical Analysis and Applications, vol 291, no 2, pp 673–689, 2004 30 R P Agarwal, M Meehan, and...
- 16
- 236
- 0
Báo cáo hóa học: " Research Article Existence and Uniqueness of Positive and Nondecreasing Solutions for a Class of Singular Fractional Boundary Value Problems" ppt
... metric spaces,” Journal of Mathematical Analysis and Applications, vol 341, no 2, pp 1241–1252, 2008 13 A A Kilbas and J J Trujillo, “Differential equations of fractional order: methods, results and ... for a nonlinear fractional differential equation,” Journal of Mathematical Analysis and Applications, vol 252, no 2, pp 804–812, 2000 T Qiu and Z Bai, “Existence of positive solutions for singular ... “Existence and uniqueness for a nonlinear fractional differential equation,” Journal of Mathematical Analysis and Applications, vol 204, no 2, pp 609–625, 1996 S Zhang, “The existence of a positive...
- 10
- 291
- 0
Báo cáo hóa học: " Research Article Nonexistence of Positive Solution for Quasilinear Elliptic Problems in the Half-Space" pot
... d’Analyse Math´matique, vol 84, pp 1–49, 2001 e ´ Sebasti´ n Lorca: Instituto de Alta Investigacion, Universidad de Tarapac´ , Casilla 7-D, a a Arica 1000007, Chile Email address: slorca@uta.cl ... 2 Journal of Inequalities and Applications nontrivial solution of the problem −Δm u ≥ u p , (1.2) in RN or in the half -space To avoid the case of the half -space, it is assumed in [3] that Ω is ... quasilinear elliptic equations and inequalities,” Acta Mathematica, vol 189, no 1, pp 79–142, 2002 [7] N S Trudinger, “On Harnack type inequalities and their application to quasilinear elliptic equations,”...
- 4
- 195
- 0
Báo cáo hóa học: "EXISTENCE AND NONEXISTENCE OF POSITIVE SOLUTIONS TO A RIGHT-FOCAL BOUNDARY VALUE PROBLEM ON TIME SCALES" pptx
... Equations and Applications (2000), no 2, 165–191 Ilkay Yaslan Karaca [9] [10] [11] [12] [13] [14] 13 , Positive solutions for a nonlinear differential equation on a measure chain, Mathematical and ... boundary conditions, Journal of Computational and Applied Mathematics 132 (2001), no 2, 341–356 Ilkay Yaslan Karaca: Department of Mathematics, Ege University, 35100 Bornova, Izmir, Turkey E-mail ... Erbe, A Peterson, and R Mathsen, Existence, multiplicity, and nonexistence of positive solutions to a differential equation on a measure chain, Journal of Computational and Applied Mathematics...
- 13
- 269
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25