common criteria evaluation and validation scheme 1 administrative and regulatory framework under which the cc is applied by an evaluation authority within a specific community 19 2 systematic organization of the functions of evalu
Báo cáo y học: "Tumor necrosis factor alpha-dependent aggrecan cleavage and release of glycosaminoglycans in the meniscus is mediated by nitrous oxide-independent aggrecanase activity in vitro" pptx
... the acquisition of data and part of the analysis of the data, and was also involved in drafting of the manuscript AKL carried out the analysis and interpretation of mRNA data RM made substantial ... S ATC AAG AAG GTG GTG AAG CAG G GAPDH AS TGA GTG TCG CTG TTG AAG TCG 18 sRNA S TCG AGG CCC TGT AAT TGG AA 18 sRNA AS GCT ATT GGA GCT GGA ATT ACC G Aggrecan S CCT GAA CGA CAA GAC CAT CGA Aggrecan ... presented as mean ± standard error of the mean, n represents the number of independent experiments Statistical analysis of data was made using a one-way analysis of variance (ANOVA) indicating significant...
- 9
- 426
- 0
MICROSOFT SQL SERVER 2008 DATABASE ENGINE COMMON CRITERIA EVALUATION pptx
... identity of the user is the basis for any decision of the TOE about an attempt of a user to access data In this way it is not possible for a user or process to masquerade as another entity and the ... fixed database role cannot add, modify, or delete any data in the user tables within a database db_denydatareader Members of the db_denydatareader fixed database role cannot read any data in the user ... the TSF data of the TOE and therewith managing the behavior of the TSF This comprises the following management functions (FMT_SMF .1) : Add and delete logins on an instance level Add and delete...
- 56
- 262
- 0
Tài liệu APICE: Common Mediterranean strategy and local practical Actions for the mitigation of Port, Industries and Cities Emissions pdf
... performing the local intensive campaign in five port cities, the APICE partners carried on an "inter-comparison campaign" in Marseille in the period 24 th January 2 011 - 7th March 2 011 The campaign was ... Experimental analysis and modellistic evaluation carried on within APICE project were preceded by a comparative evaluation of the air quality pollution in the port cities involved in APICE (Barcelona, ... (Barcelona, Marseille, Genoa, Venice and Thessaloniki) It this framework, the air quality status of the five port cities has been analyzed, with a focus on PM10, in a comparative analysis A summary report...
- 4
- 452
- 0
báo cáo khoa học: "A rare combination of an endocrine tumour of the common bile duct and a follicular lymphoma of the ampulla of Vater: a case report and review of the literature" ppt
... submission VSt participated in drafting and revising the manuscript AT participated in gathering the data and drafted the manuscript EK performed the appropriate histological analysis of the ... Received: 14 October 2 010 Accepted: 14 January 2 011 Published: 14 January 2 011 References Modlin IM, Lye KD, Kidd M: A 5-decade analysis of 13 , 715 carcinoid tumors Cancer 20 03, 97:934-959 Athanasopoulos ... University of Athens, Aretaieion Hospital, 76 Vas Sofias Ave., 11 528 , Athens, Greece 2Department of Anesthesiology, University of Athens, Aretaieion Hospital, 76 Vas Sofias Ave., 11 528 , Athens, Greece...
- 4
- 427
- 0
Distinct histone deacetylases repress expression of LH and FSH beta genes in the immature gonadotrope alphat3 1 cells and the repression is reversed by GNRH
... GATCCCCAGGAAGAGTGTTCCTGATTTTCAAGAGAAATCAGGAACACTCTTCCTTTTTTA AGCTTAAAAAAGGAAGAGTGTTCCTGATTTCTCTTGAAAATCAGGAACACTCTTCCTGGG SMRT -A GeneID 20 6 02 GATCCCCCCCATAGAATCAAAGCACCTTCAAGAGAGGTGCTTTGATTCTATGGGTTTTTA ... GATCCCCCCCATAGAATCAAAGCACCTTCAAGAGAGGTGCTTTGATTCTATGGGTTTTTA GGGGGGTATCTTAGTTTCGTGGAAGTTCTCTCCACGAAACTAAGATACCCAAAAATTCGA SMRT-B GeneID 20 6 02 GATCCCCTGACTACATCACCTCGCAGTTCAAGAGACTGCGAGGTGATGTAGTCATTTTTA AGCTTAAAAATGACTACATCACCTCGCAGTCTCTTGAACTGCGAGGTGATGTAGTCAGGG ... CAGGCCATTGGTTGAGTCCT AGCACTGACTGCACCGTGAG CCTCAGCCAGCTTCATCAGC GCCATGTACGTAGCCATCCA Primer size (bp) 20 20 20 20 20 20 Amplicon size (bp) 300 600 25 0 ACGCTCGGTCAGGATCTTCA Table 11 : Primers used to amplify LHβ,...
- 94
- 284
- 0
Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf
... mutagenesis reactions together with oligonucleotides ECF-Q69G d(5¢-AACAACGCAGCTGGGCTCTG GAACCAT), ECF -A1 41Q d(5¢-TCAACCTCTAACCAG GCTACTCCGCTG) ECM-G77Q d(5¢-AACAACGCTGG CCAGCACGCTAACCAC) and ECM-Q14 6A ... dismutase activity Lanes 1 8 as for A (8 lg per lane), lanes 9 12 are Fe [A1 41Q], Fe[Q69G /A1 41Q], Mn[G77Q] and Mn[G77Q/Q14 6A] (20 lg per lane) (C) Cleavage and purification of authentic SODs SDS/PAGE (15 %) ... (lanes 9 12 as for lanes 1 4, and 10 , lg each, 11 and 12 , lg each) Lane 13 contains FeSOD and MnSOD (from Sigma, lg each) (D) Native-PAGE (8%) of purified SOD samples stained for SOD activity Lane...
- 12
- 740
- 0
Báo cáo " Teaching efl writing in Vietnam: Problems and solutions - a discussion from the outlook of applied linguistics " doc
... and meaning is instantiated through language use Grabe and Kaplan [5] also emphasize that only teachers who understand theory and make a transition from theory to practice can make the most appropriate ... linguistic development in an insightful manner (Bardovi-Harlig, [1] ) In the examples, (1) Mary is talking to a man The man is Mary’s father, and (2) The man who Mary is talking to him is her father, ... first language Many EFL teachers in Vietnam also regard this as a vital reason when analyzing their learners’ errors Nonetheless, as Savignon [15 ] puts it, the analysis of learners’ errors by means...
- 6
- 704
- 1
Báo cáo hóa học: " Research Article A Simulation Study: The Impact of Random and Realistic Mobility Models on the Performance of Bypass-AODV in Ad Hoc Wireless Networks" pdf
... defined by the IEEE 8 02 .11 MAC and are used in our simulation: the transmission range and the sensing range The transmission range is the maximum distance between two nodes, such that a signal transmitted ... 8 02 .11 MAC standard [15 ] and the TCP NewReno are used at the MAC and TCP layers, respectively The transmission rate is assumed to be constant at Mbps In each simulation-iteration, we generate a ... Wireless LAN Medium Access Control (MAC) and Physical Layer (PHY) Specifications, IEEE standard 8 02 .11 , 19 97 [16 ] G Jayakumar and G Ganapathi, “Reference point group mobility and random way-point models...
- 10
- 604
- 0
Capital Markets and Portfolio TheoryRoland Portait From the class notes taken by Peng pptx
... formula on Ca exists and is unique Market is complete and AOA Q is a singleton is a singleton AoA Q 6= 6= Proof : 37 Chapter AoA, Attainability and Completeness e Assume AoA and consider any ... Markovian - The simple diusion case is a particular case of the state variable diusion case (where S and r are the state variables); the state variable diusion case is a particular case of the ... Hence C there is only one viable pricing of an attainable claim under AOA Under AOA, if the market is complete all claims are attainable, hence there is one and only one viable price for any contingent...
- 102
- 201
- 0
Báo cáo y học: " Viral replication is enhanced by an HIV-1 intersubtype recombination-derived Vpu protein" pot
... (5’-CCTCTAGATAATGCAACCTATAATAG-3’); VpuB rev (5’-CACGCGTCTACAGATCATCAATATCC-3’); VpuBF fw (5’-CCTCTAGATAATGCAATCTTTAG-3’) and VpuBF rev (5’-CACGCGTCTACAGAATATCAATATTC-3’) PCR amplification of b-actin, used as ... We thank Sergio Mazzini for his excellent work in manuscript editing and language revision, and to Andrea Rubio and Monica Saracco for their technical assistance on automated sequencing and flow ... transmembrane domain that promotes the enhanced release of virus-like particles from the plasma membrane of mammalian cells J Virol 19 98, 72 : 12 70 - 12 79 28 Iwabu Y, Fujita H, Kinomoto M, Kaneko K, Ishizaka...
- 9
- 343
- 0
a study of water and fire as metaphors in american and vietnamese short stories of the 20th century = nghiên cứu ẩn dụ nước và lửa trong truyện ngắn thế kỷ 20 của mỹ và việt nam
... development of genre and style Short fiction particularly focuses on the wars of resistance against the French colony (19 46 -19 54) and the US Army (19 65 -19 75), and the construction of Socialism in the ... Vietnamese literature Ideology, patriotism and socialism are noticeable features of the 19 45 -19 75 stage The literature of this stage is revolutionary with deep humanism and many achievements in the development ... life, their calculation and scrambling for money and fame, the corruption of the society and also their hopes and dreams of a better life The personalities and inner thoughts of the characters are...
- 77
- 601
- 2
a study of water and fire as metaphors in american and vietnamese short stories of the 20th century = nghiên cứu ẩn dụ nước và lửa trong truyện ngắn thế kỷ 20 của mỹ và việt nam tt
... metaphors in American and Vietnamese short stories of the 20 th century 12 2 .1 The popularity of water and fire as metaphors 12 2. 2 The formation of metaphors of water and fire ... VIETNAM NATIONAL UNIVERSITY, HA NOI UNIVERSITY OF LANGUAGES AND INTERNATIONAL STUDIES FACULTY OF POSTGRADUATE STUDIES PHÍ THỊ THU TRANG A STUDY OF WATER AND FIRE AS METAPHORS IN AMERICAN AND VIETNAMESE ... 14 2. 2 .1 Lexical items 14 2. 2 .2 Parts of speech 20 2. 3 The functions of metaphors of water and fire 23 2. 3 .1 The description of strong emotions 23 ...
- 4
- 315
- 1
using the common criteria for it security evaluation
... change in one standard may impact the overall CC/ CEM standards framework Two standards provide additional guidance on the interpretation and application of the CC/ CEM ISO/IEC PDTR 15 44 622 is an ... in a formal evaluation of a PP If the evaluation is successful, the PP is certified and becomes part of a National Evaluation Authority s PP registry Evaluation goals are established for the ... Resources Annex C: Common Criteria Recognition Agreement (CCRA) Participants Australia and New Zealand Canada Finland France Germany Greece Israel Italy The Netherlands Norway Spain Sweden United...
- 284
- 1,437
- 0
Common Eye Diseases and their Management - part 1 pot
... considered as equivalent to the television cameraman who moves the camera around to the relevant views and allows the camera (or macula) to make sense of the scene If the macula area is damaged by, ... conjunctival epithelium The watery (aqueous) layer is produced by the main lacrimal gland in the superotemporal part of the orbit and accessory lacrimal glands found in the conjunctival stroma This aqueous ... of temperature and bright light, and (2) maintenance of the normal precorneal tear film, which is important for maintenance of corneal health and clarity Normal eyelid closure requires an intact...
- 21
- 360
- 0
Báo cáo y học: "Characterization of N200 and P300: Selected Studies of the Event-Related Potential Salil H. Patel 1 and Pierre N. Azzam 2"
... Neuroreport 19 99; 10 :8 61- 865 79 Bekker EM, Kenemans JL, Verbaten MN Source analysis of the N2 in a cued Go/NoGo task Brain Research Cognitive Brain Research 20 05; 22 (2) :2 21 - 2 31 80 Barabasz A, Barabasz ... potentials and cognition: A critique of the context updating hypothesis and an alternative interpretation of P3 Behavioral and Brain Sciences 19 88; 11 :343- 427 61 Desmedt JE P300 in serial tasks: An ... 19 97; 2: 24 725 7 Treisman A, Sato S Conjunction search revisited Journal of Experimental Psychology and Human Perceptual Performance 19 90; 16 :459-478 Eimer M The N2pc component as an indicator of attentional...
- 8
- 563
- 0
50-common interview questions and answers
... what you can for this organization Anything else is a distraction Why you want to work for this organization? This may take some thought and certainly, should be based on the research you have done ... Questions and Answers Written by Administrator Thursday, 11 March 2 010 11 :39 This is a personal trait that only you can say, but good examples are: Challenge, Achievement, Recognition 34 Are you ... is not the same as layoff or reduction in force 15 What is your philosophy towards work? 2/ 6 50 Common Interview Questions and Answers Written by Administrator Thursday, 11 March 2 010 11 :39 The...
- 6
- 687
- 3
Safeguarding Public and Environmental Health: What are the Necessary Requirements of UV Reactor Validation Protocols?
... eliminated, and UV systems would be designed and operated safely based on their actual measured performance When the challenge organism is not the same as the target organism and does not have the ... different measured performance for organisms with different UV-resistance Showing accurate calculations of bioassay performance between-organisms similarly validates the accuracy of the dose distribution ... calculations RED Conserv Interp 24 RED (mJ/cm ) 20 16 12 0 12 16 20 24 UV Resistance (D10, mJ/cm2/log) Figure Use of a two-organism bioassay to interpolate a conservative estimate of the actual...
- 8
- 545
- 0
Multi-criteria Evaluation of Wastewater Treatment Scenarios for Small Towns in Developing Countries - Case Study of Toan Thang Town in Vietnam
... (Mills et al., 19 96; Fernandes et al., 19 99; Prato, 19 99; Ananda and Herath, 20 03; Hajkowicz, 20 07) Thus, even if decision makers disagree with this multi -criteria analysis’s output, it can still ... value, and lack of an alternative source of water Thus, it is necessary to have a clear understanding of the cultural aspects and sanitation practices; also the potential for utilization of treated ... land area of the community is 725 .8 ha, of which 440 is used for rice farming The average agricultural land area per capita is 429 m2, less than half the national level Most of the - 27 8 - Journal...
- 23
- 779
- 0
Teachers’ and teacher evaluators’ perceptions of the current teacher evaluations and teaching assessment criteria
... follow - the objectives are clear and achievable - there is an awareness of student problems - the teacher understands and can explain the plan - the lesson plan shows a good understanding of the ... Reasonable board presentation, clear handwriting and drawings, clear and standard speech; adequate lesson plan (2 points) Planning (4 points) Flexible organization of all stages and processes, reasonable ... Grade: Number of students: Aim: Before the lesson – preparation Clarity, usefulness and excellent very good average poor good understanding of the lesson plan - The plan is easy to understand and...
- 7
- 425
- 0
Tài liệu C# and .NET Framework Lassion 1 doc
... Quang Minh Đoà 12 Tài liệu tham khảo Professional C#, Second Edition http://www.asp.net http://www.microsoft.com/net/default.mspx http://www.codeproject.com Đ a download tài liệu http://www.thanglong.edu.vn/giang-day/tab.aspx ... http://www.thanglong.edu.vn/giang-day/tab.aspx Diễn đàn C# & NET http://www.thanglong.edu.vn/forum/cmd/0/categ ory/hoc-tap-nghien-cuu/dot-net/tab.aspx C# kiến trúc NET C# kiế trú NET bả Editor: Đoàn Quang Minh Đoà 13 ... metadata tự mô tả: – Type metadata: ch a mô tả kiểu liệu phương thức có assembly – Manifest: ch a assembly metadata thông tin assembly (version, copyright,…) Private Assemblies: gói thực thi phần...
- 13
- 403
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25