Distinct histone deacetylases repress expression of LH and FSH beta genes in the immature gonadotrope alphat3 1 cells and the repression is reversed by GNRH

DISTINCT HISTONE DEACETYLASES REPRESS EXPRESSION OF LH AND FSH β GENES IN THE IMMATURE GONADOTROPE αT3-1 CELLS AND THE REPRESSION IS REVERSED BY GNRH YANG MENG THE NATIONAL UNIVERSITY OF SINGAPORE 2007 DISTINCT HISTONE DEACETYLASES REPRESS EXPRESSION OF LH AND FSH β GENES IN THE IMMATURE GONADOTROPE αT3-1 CELLS AND THE REPRESSION IS REVERSED BY GNRH YANG MENG A THESIS SUBMITTED FOR THE DEGREE OF MASTERS OF SCIENCE DEPARTMENT OF BIOLOGICAL SCIENCES THE NATIONAL UNIVERSITY OF SINGAPORE 2007 ACKNOWLEDGEMENTS This is perhaps the easiest and hardest chapter that I have to write. It will be simple to name all the people that helped to get this done, but it will be tough to thank them enough. I will nonetheless try… First of all, I must send thanks to all the HDAC team members. Without their support and striving development the project would have never reached the great result it did. Dr Philippa Melamed, my supervisor, she always encourages me to bring forth my own ideas and to test them independently. Those warm discussions, just as warm as the weather in Singapore, are unforgettable. I am very happy that at the early stage of my research life, I could establish my faith on science and learn to figure out the problems, which is common in bio-research, with great enthusiasm. My wonderful lab mates, Luo Min, Stefan, Jia Jun, Siew Hoon, Fai, who’ve made our lab a lively and enjoyable place to work in. And those previous colleagues, their preliminary tests and hypothesis are the source of my inspiration. Dr Martin Lee, his suggestions really saved me for some of the protein tests. My lovely friends, church or campus which are too many to mention, always stood by my side asking over and over again “When will you get it done? Next week? Next Month? When?” My final words go to my family. In this type of work the relatives are always mistreated A great thanks to all. I ABSTRACT The gonadotropins, luteinizing hormone (LH) and follicle-stimulating hormone (FSH) are synthesized in and secreted by the pituitary gland, and play crucial roles in regulating reproduction. The synthesis of both LH and FSH is repressed soon after birth until puberty, when the repression is reversed by gonadotropin-releasing hormone (GnRH). Chromatin immunoprecipitation (ChIP) assays have shown that in the immature pituitary gonadotrope αT3-1 cells, distinct sets of histone deacetylases (HDACs), along with SMRT and Sin3A, associate with LH and/or FSH β-subunit gene promoters in a repressive complex. In order to understand the de-repression of LH and FSH β genes in αT3-1 cells, the effect of GnRH treatment on this repressive complex must be elucidated. ChIP assays have shown that GnRH is able to remove several HDACs and Sin3A from LH and/or FSH β gene promoters, which results in the disruption of the repressive complex. De-repression of the LH and FSH β genes after GnRH stimulation might be caused by class IIa HDAC modifications which lead to the nuclear export of those HDACs. SENP1, a nuclear protease that appears to deconjugate sumoylated proteins, reverses the repression of both the LH and FSH β genes in the αT3-1 cells. It is possible that GnRH stimulation recruits the de-sumoylation pathway to export the class IIa HDACs from the nucleus resulting in the disruption of the repressive complex. II TABLE OF CONTENTS LIST OF FIGURES ...................................................................................... 1 LIST OF TABLES ........................................................................................ 3 LIST OF ABBREVIATIONS ...................................................................... 4 CHAPTER 1 INTRODUCTION ............................................................... 6 1.1The gonadotropins: lutenizing hormone (LH) and follicle-stimulating hormone (FSH).............................................................................................. 6 1.2. Gonadotropin-releasing hormone (GnRH) regulates LH and FSH βsubunit synthesis ......................................................................................... 10 1.2.1 Basal expression of LH and FSH β-subunit genes ..............................................10 1.2.2 GnRH-mediated expression of LH and FSH β-subunit genes ...........................12 1.3. Regulation of LH and FSH β genes through their transcriptional repression..................................................................................................... 15 1.3.1 Histone deacetylases (HDACs) repress gene expression ....................................15 1.3.2 Transcription regulators: class IIa HDACs, N-CoR/SMRT and mSin3A........20 1.3.3 Modification of Class IIa HDACs by phosphorylation or SUMOylation affects their repressive functions. ..............................................................................................24 1.4. Mouse gonadotrope cell lines: αT3-1 and LβT2 ............................... 28 1.5. Hypothesis and aims ............................................................................ 30 III CHAPTER 2 MATERIALS AND METHODS ................................... 31 2.1. Tissue culture ....................................................................................... 31 2.1.1. Growth condition ..................................................................................................31 2.1.2. Transient transfection ..........................................................................................31 2.2. Preparation of plasmid DNA .............................................................. 32 2.2.1 Expression vectors .................................................................................................32 2.2.2 siRNA constructs to target N-CoR, SMRT and Sin3A.......................................32 2.2.2.1 Design of oligonucleotides ......................................................................................................... 32 2.2.2.2 Annealing of oligonucleotides ................................................................................................... 33 2.2.2.3. Restriction digestion of vectors................................................................................................ 34 2.2.2.4. DNA purification ...................................................................................................................... 34 2.2.2.5. Ligation of annealed oligos and linearized pSUPER vector.................................................. 34 2.2.3 Isolation, verification and large scale preparation .............................................35 2.2.3.1. Transformation of plasmids into Escherichia coli (E.coli) .................................................... 35 2.2.3.2. Plasmid isolation and verification ........................................................................................... 36 2.3. RT-PCR analysis.................................................................................. 37 2.3.1. RNA isolation ........................................................................................................37 2.3.2. First strand cDNA synthesis ................................................................................38 2.3.3. PCR and gel electrophoresis analysis..................................................................38 2.4. Western blotting................................................................................... 40 2.4.1. Whole cell extraction ............................................................................................40 2.4.2. Nuclear and cytoplasmic extraction ....................................................................40 2.4.3. SDS page and blotting ..........................................................................................40 2.5. Co-immunorecipitation (Co-IP) ......................................................... 43 2.6. Chromatin Immunoprecipitation (CHIP)......................................... 44 IV 2.6.1. Cross-linking of protein and DNA.......................................................................44 2.6.2. Immunoprecipitation of protein-DNA complex and DNA extraction .............45 2.6.3. PCR detection........................................................................................................46 CHAPTER 3 RESULTS........................................................................... 48 3.1. Gonadotropin β-subunit genes are repressed by HDACs in the immature gonadotrope αT3-1 cell line and GnRH is able to overcome this repression ............................................................................................. 48 3.2. Co-repressors are identified that repress the FSH β gene in both αT3-1 and LβT2 cells.................................................................................. 50 3.3. Distinct sets of HDACs and co-repressors are associated with the LH and FSH β gene promoters, and the association is affected by GnRH treatment...................................................................................................... 53 3.4. Co-immunoprecipitation indicates that the repressive factors associated with the LH and FSH β-subunit gene, are contained in more than one complex at each gene promoter ................................................. 60 3.5. GnRH-mediated modification of HDAC4 and HDAC5 facilitates their nuclear export .................................................................................... 63 CHAPTER 4 DISCUSSION .................................................................... 67 V LIST OF FIGURES Figure Titles Page Figure 1. Functional connection between the hypothalamus and pituitary gland. 7 Figure 2. Regulation of gonadotropin gene expression. 8 Figure 3. A model of basal gonadotropin subunit gene expression. 11 Figure 4. The gonadotropin-releasing hormone (GnRH) receptor-modulated signaling network. 13 Figure 5. Histone acetylation-deacetylation cycle. 16 Figure 6. Schematic depiction of the different isoforms of various HDACs. 18 Figure 7. Repressive complexes are associated with the promoter to repress gene expression. 19 Figure 8. Translocation of HDAC7 causes de-repression of Nur77 gene in developing thymic T cells. 21 Figure 9. Domains of the N-CoR and SMRT co-repressors. 23 Figure 10. Model for SUMOylation function in regulating transcription. 27 Figure 11. The gonadotrope cell lines along the developmental cell lineages of the anterior pituitary. 29 Figure 12. LH and FSH β-subunit gene expression is repressed in immature αT3-1 cells and this is overcome by GnRH. 49 Figure 13. SMRT represses expression of the FSHβ gene in both cell types. 50 Figure 14. In αT3-1 cells, both transcript and protein levels of N-CoR and SMRT are decreased following the respective siRNA-mediated knock down. 52 Figure 15. In αT3-1 cells, several HDACs are associated with the LH β promoter and the association is differentially affected by GnRH treatment. 54 Figure 16. In αT3-1 cells, several HDACs are associated with the FSH β promoter and this is differentially affected by GnRH treatment. 55 Figure 17. In αT3-1 cells, neither N-CoR nor SMRT is associated with the LH β promoter but SMRT is recruited following GnRH treatment. 57 Figure 18. In αT3-1 cells, SMRT is associated with the FSH β promoter and this is not affected by GnRH treatment. 58 Figure 19. In LβT2 cells, several HDACs along with co-repressors are associated with the FSH β promoter and the association is differentially affected by GnRH treatment. 59 1 Figure 20. In αT3-1 cells, class I HDACs co-precipitate with class IIa HDACs and corepressors. 61 Figure 21. In αT3-1 cells, HDAC4 co-precipitated with the co-repressor Sin3A but not with either SMRT or HDAC5. 62 Figure 22. In αT3-1 cells, the repression of LH and FSH β-subunit genes is overcome by over-expression of SENP1. 64 Figure 23. In αT3-1 cells, HDAC5 is present in two forms in both cytoplasmic and nuclear extraction, one appears 20 kD bigger, and this is not affected by NEM treatment. 64 Figure 24. In αT3-1 cells, localization of wild-type HDAC5 in both nucleus and cytoplasm is SUMO-dependant, and this is affected by GnRH treatment. 66 Figure 25. SUMOylation and nuclear import. 74 Figure 26. Repressive complexes containing distinct HDACs repress expression of the gonadotropin β-subunit genes in αT3-1 cells, and this is overcome by GnRH treatment. 78 2 LIST OF TABLES Table Titles Page Table 1. Optimized amount of plasmids transfected into the cell lines 32 Table 2. Oligonucleotides designed for synthesis of siRNA 33 Table 3. Conditions for annealing of oligonucleotides 33 Table 4. Components of reaction for T4 ligatio 34 Table 5. Mix preparation for the restriction digestion 36 Table 6. Mix for the sequencing reaction 37 Table 7. Cycling parameters for sequencing reaction 37 Table 8. Mix for the first strand cDNA synthesis 38 Table 9. Mix of PCR to test expression level of the LHβ, FSHβ and β-actin 39 Table 10. PCR cycling parameters to analyze LHβ, FSHβ and β-actin gene expression 39 Table 11. Primers used to amplify LHβ, FSHβ and β-actin 39 Table 12. Composition of buffers used in western blot 42 Table 13. Antibodies used in western blotting; Regarding anti-SMRT, one is particularly used for western blotting following co-precipitation 42 Table 14. Antibodies used in immuno-precipitation 43 Table 15. Composition of buffers used in ChIP experiments. 46 Table 16. Antibodies used in ChIP 47 Table 17. PCR cycling parameters to amply specific regions of the FSHβ and LHβ gene promoters. 47 Table 18. Primers used to amply LH and FSH β promoter region . 47 3 LIST OF ABBREVIATIONS CaM Ca2+ sensor calmodulin CaMKs Ca2+/CaM-dependent protein kinases ChIP Chromatin immunoprecipitation DAD Deacetylase activating domain DAG Diacylglycerol EGF Epidermal growth factor ERK Extracellular-signal-regulated kinase FSH Follicle-stimulating hormone FSHβ Follicle-stimulating hormone β-subunit GnRH Gonadotropin-releasing hormone GnRHR Gonadotropin-releasing hormone receptor HAT Histone acetyltransferase Hda1 Histone deacetylase 1 HDAC Histone deacetylase HDACi Histone deacetylase inhibitors IP3 Inositol 1,4,5 triphosphate JNK Jun N-terminal kinase LH Luteinizing hormone LHR Luteinizing hormone receptor LHβ Luteinizing hormone β-subunit MAPK Mitogen-activated protein kinase MEK Mitogen-activated protein kinase kinase N-CoR Nuclear receptor corepressor NES Nuclear export signal NLS Nuclear localization signal NPC Nuclear pore complex NURD Nucleosome remodeling and histone deacetylation PIP Plasmid immunoprecipitation 4 Pitx1 Pituitary homeobox 1 PKA Protein kinase A PKC Protein kinase C PLC Phospholipase C SENP Sentrin/SUMO-specific protease Sf-1 Steroidogenic factor 1 Sir2 Silent information regulator 2 siRNA Short interfering ribonucleic acids SMRT Silencing mediator of retinoic and thyroid hormone receptors SUMO Small ubiquitin-related modifier TSA Trichostatin A Ubc Ubiquitin conjugating 5 CHAPTER 1 1.1 INTRODUCTION The gonadotropins: lutenizing hormone (LH) and follicle-stimulating hormone (FSH) The pituitary gland is a small gland located at the base of the brain, functionally linked to the hypothalamus. It is divided into two lobes: the anterior or front lobe and the posterior or rear lobe (Figure 1). The anterior pituitary is composed of a number of different cell types, including five endocrine cells (Jacobson et al. 1979). One of these are gonadotrope cells which secrets two gonadotropins: luteinizing hormone (LH) and follicle-stimulating hormone (FSH). The synthesis and secretion of gonadotropins are subject to the complex control of many factors (Figure 2) including GnRH (Papavasiliou et al. 1986; Kato et al. 1989; Ruf and Sealfon 2004), steroid hormones (testosterone, estrogen and progesterone) and gonadal peptides (activin, inhibin and follistatin) (Gharib et al. 1990; Joshi et al. 1993). 6 Anterior pituitary Posterior pituitary Figure 1. Functional connection between the hypothalamus and pituitary gland. The anterior pituitary gland is functioning connected with the hypothalamus; nerve cells in the hypothalamus secrete neurohormones that act on the endocrine cells of the anterior lobe to stimulate or inhibit their synthesis and secretion. Abbreviations: AL, anterior lobe; PL, posterior lobe; MB, mammillary body (Nussey and Whitehead 1999). 7 Hypothalamus GnRH Pituitary FSH and LH Gonadal Peptides Inhibin (-ve), Activin (+ve), Follistatin (-ve) Gonads Steroids Testosterone, Estrogen, Progesterone Figure 2. Regulation of gonadotropin gene expression. GnRH, synthesized in and released from the hypothalamus, binds to GnRH receptors on the surface of the gonadotrope. This leads to the synthesis and secretion of LH and FSH, which stimulate the production of steroid hormones. Testosterone, estrogen and progesterone negatively or positively regulate the synthesis of the gonadotropins directly at the pituitary or indirectly by modulating GnRH secretion from the hypothalamus. The gonadal peptides, inhibin, activin and follistatin, also have roles in the regulation of gonadotropin gene expression by exerting positive or negative feedback (Brown and Mcneilly 1999). 8 Both LH and FSH are glycoproteins and are composed of one α-subunit which is identical, and one β-subunit which is unique and endows each hormone with the ability to bind to its own receptor. These hormones stimulate the activation of the gonads: in females, the ovaries; and in males, the testes. FSH in females initiates follicular growth, specifically through the actions on granulosa cells, whereas in males, FSH stimulates the maturation of germ cells. The name LH is derived from its effect of inducing luteinization of ovarian follicles. LH receptors are expressed on the maturing follicle that produces an increasing amount of estradiol with the rise in estrogens. With maturation of the follicle, the estrogen rise leads a surge in LH levels over a 24-48 hour period. This LH surge triggers ovulation and initiates the conversion of the residual follicle into a corpus luteum that, in turn, produces progesterone to prepare the endometrium for a possible implantation. Progesterone is necessary for maintenance of pregnancy, and in humans, LH is required for continued development and function of corpora lutea. In males, LH acts upon the Leydig cell of the testis and stimulates testosterone production that promotes spermatogenesis and is responsible for the male secondary sexual characteristics. 9 1.2 Gonadotropin-releasing hormone (GnRH) regulates LH and FSH β-subunit synthesis 1.2.1 Basal expression of LH and FSH β-subunit genes During embryogenesis, a controlled cascade involving multiple signaling pathways determines the transcription factor expression which initiates the basal expression of gonadotropin genes (Treier et al. 1998). The initiation of the gonadotrope cell lineage is characterized by expression of the α-subunit followed by the expression of LH and FSH β subunit transcripts after a further 5 - 6 days. Transcription factors such as pituitary homeobox 1 (Ptx1) and steroidogenic factor 1 (SF-1) have been reported to activate gonadotropin α and β subunit gene transcription at the basal level (Figure 3). Although both LH and FSH are produced during fetal development, their synthesis is repressed after birth until re-activation at puberty, when the GnRH pulse generator is activated, resulting in increased GnRH release (Grumbach 2003). As such, the appropriate GnRH delivery to the gonadotrope is the only endogenous block to the reawakening of the GnRH-gonadoptropin axis at puberty which has been shown by the experiment that precocious puberty leading to ovulation can be stimulated in monkeys merely by the appropriate administration of GnRH (Wildt et al. 1980; Plant et al. 1989). 10 Figure 3. A model of basal gonadotropin subunit gene expression. Transcription factors involved in basal gonadotropin subunit gene expression are activated during anterior pituitary development and are shown bound to their cognate DNA elements at the gonadotropin subunit gene promoters (Brown and Mcneilly 1999). 11 1.2.2 GnRH-mediated expression of LH and FSH β-subunit genes The decapeptide GnRH (pGlu-His-Trp-Ser-Tyr-Gly-Leu-Arg-Pro-Gly-NH2), released in a pulsatile pattern by GnRH-producing neurons of the hypothalamus, is the chief regulator of the reproductive system in mammals. The GnRH receptor, a heptahelical membrane protein on the surface of the anterior pituitary gonadotrope is activated following GnRH binding, resulting in a signal transduction network. After receptor activation, the signal transduction network of the gonadotrope reliably decodes the instructions received to generate the appropriate rates of gonadotropin bio-systhesis and secretion (Figure 4). When GnRH interacts with its receptor, it stabilizes a conformational change in the receptor that promotes the activation of heterotrimeric G proteins. The principle G protein activated by GnRH belongs to the Gq/11 subclass, while G proteins of the Gi/o and Gs subclasses have also been reported to be activated by GnRH (Ruf et al. 2003). In αT3-1 cells, the endogenous mouse receptor was found to be consistent with activation solely of Gq/11 subtype G-proteins, while, in the related LβT2 gonadotrope cell line, the endogenous mouse receptor was found to activate both Gq/11 and Gs sub-type Gproteins (Grosse et al. 2000; Liu et al. 2002b). 12 Figure 4. The gonadotropin-releasing hormone (GnRH) receptor-modulated signaling network. Activation of the GnRH receptor leads to the activation of at least two G-protein subtypes, Gs and Gq. Signaling downstream of protein kinase C (PKC) leads to transactivation of the epidermal growth factor (EGF) receptor and activation of mitogen-activated protein kinases (MAPKs), including extracellular-signal-regulated kinase (ERK), Jun N-terminal kinase (JNK) and p38 MAPK. Active MAPKs translocate to the nucleus, resulting in activation of transcription factors and rapid induction of early genes. This figure illustrates the distributed and interconnected movement of information from the receptor to the genome (Ruf and Sealfon 2004). 13 Phospholipase Cβ is activated by Gq/11 proteins (Hsieh and Martin 1992), leading to the hydrolysis of phosphatidylinositol 4, 5-bisphosphate to 1,4,5 - inositol trisphosphate (IP3) and diacylglycerol (DAG). IP3 mobilizes intracellular calcium which activates conventional protein kinase C (PKC) isoforms such as β and βII, which have been identified in gonadotrope cell lines (Junoy et al. 2002; Liu et al. 2002a). Phospholipase D is also activated by GnRH-receptor signaling (Shacham et al. 2001), and subsequently releases DAG (Zheng et al. 1994), which might cause the activation of Ca2+-independent PKC isoforms such as PKCδ or PKCε (Shacham et al. 1999). Signaling downstream of PKC leads to transactivation of the epidermal growth factor (EGF) receptor and activation of mitogen-activated protein kinases (MAPK), including extracellular-signalregulated kinase (ERK), Jun N-terminal kinase (JNK) and p38 MAPK. Active MAPKs translocate to the nucleus, resulting in activation of transcription factors and rapid induction of early genes. GnRH has also been reported to stimulate an increase in cAMP (Bourne 1988; Garrel et al. 1997). Burger and coworkers performed in vitro studies in rat pituitary cells to detect the stimulatory effect of cAMP on gonadotropin subunit mRNA and found that a diffusible cAMP analog stimulated a rise in α, but not LH or FSH β mRNA. Interestingly, more recent studies suggest that the cAMP/PKA patyway plays a role in cross-talk between specific intracellular messenger systems like PKC and ERK in response to GnRH stimulation (Burger et al. 2004). 14 1.3 Regulation of LH and FSH β genes through their transcriptional repression 1.3.1 Histone deacetylases (HDACs) repress gene expression Distinct sets of HDACs have been found to be associated with the LH or FSH β gene promoter, repressing the expression of both gonadotropin β-subunit genes, and GnRH was shown to overcome this repression (Lim et al. 2007). Reversible suppression of gene expression is achieved through the actions of DNA-associated repressors, which block the binding sites of activators and/or compact the chromatin making it less accessible to the activator, through recruitment of co-repressors and chromatin modifying enzymes. Those repressors One of these well-studied chromatin modifications is histone deacetylation (Figure 5a). Histone deacetylation is caused by HDACs, which act to deacetylate histone tails in the nucleosomes that bind to the TATA box and other regulatory regions of the genes they repress. In vitro studies have shown that when promoter DNA is assembled onto a nucleosome with deacetylated histones, the general transcription complex is not able to bind to the TATA box and initiation region, because the deacetylated N-terminal lysines of the hitones are positively charged and interact strongly with DNA phosphates (Figure 5b). The deacetylated histone tails also interact with neighboring histone octamers, favoring the folding of chromatin into condensed, higher-ordered structure, although its precise conformation is not well understood (Lodish et al. 2004). 15 a b Figure 5. Histone acetylation-deacetylation cycle. a. Equilibrium of steady-state histone acetylation is maintained by opposing activities of histone acetyltransferases and deacetylases. Acetyl coenzyme A is the high-energy acetyl moiety donor for histone acetylation. Histone acetyltransferases (HATs) transfer the acetyl moiety to the ε-NH3 group of internal lysine residues of histone N-terminal domains. Reversal of this reaction is catalyzed by histone deacetylases (HDACs) (Kuo and Allis 1998). b. Histone tails are modified to alter transcriptional competence, change interactions with the DNA and to serve as a code for interacting proteins which has been entitled as the “histone code”. 16 Mammalian HDACs are usually classified into two classes based on their sequence similarity to yeast HDACs. Class I includes HDAC 1, 2, 3, 8 and 11; class II includes HDAC 4, 5, 6, 7, 9 and 10 (Figure 6). Members of class I contain a well-conserved catalytic domain that in HDAC1, 2 and 3 encompasses almost two thirds of the protein (Khochbin and Wolffe 1997). HDAC1 and HDAC2 were identified as components of two multi-protein complexes known as Sin3/HDAC and NuRD/Mi2/NRD (Knoepfler and Eisenman 1999) (Figure 7). HDAC3, which was not found in either Sin3/HDAC or NURD/Mi2/NRD core complexes, appears to be a nuclear receptor co-repressor (Ahringer 2000). Increasing evidence points to HDAC3 being a member of the stable core of the Silencing Mediator for Retinoid and Thyroid receptors (SMRT) and/or Nuclear Receptor Co-Repressor (N-CoR) complexes (Huang et al. 2000; Li et al. 2000; Urnov et al. 2000; Wen et al. 2000). 17 Figure 6. Schematic depiction of the different isoforms of various HDACs. Bars depict the length of the protein. The catalytic domain is shown in blue; black depicts a NLS. N, N-terminus, C, C-terminus (De Ruijter et al. 2003). 18 Figure 7. Repressive complexes are associated with the promoter to repress gene expression. Corepressor complexes include the Sin3/HDAC complex, which has been proposed to be recruited via the NR co-repressors N-CoR or SMRT. This complex possesses histone deacetylase activity and is thought to reverse actions of histone acetyltransferase-containing complexes. Adapted and modified from Glass and Rosenfeld, 2000. 19 1.3.2 Transcription regulators: class IIa HDACs, N-CoR/SMRT and mSin3A Class II HDACs, which are almost twice the size of class I HDACs, are subdivided into two subclasses: IIa includes HDAC4, 5, 7 and 9 and its splice variant MITR, and IIb includes HDAC6 and HDAC10. Besides the catalytic domain which is located in the carboxy-terminal, class IIa HDACs contain several other domains for interacting with diverse proteins. HDAC4, 5 and 7 have been reported to function in a matrix-associated deacetylase body (MADB) which contains certain members of NuRD and Sin3 complexes, as well as the class I HDACs, HDAC1, 2 and 3. The nuclear receptor co-repressors, SMRT and N-CoR have also been found in these bodies (Downes et al. 2000; Kao et al. 2000). Although the combination of the class I and II HDACs are found in nuclear complexes, the involvement of each member is dependent on an additional level of regulation controlling their intracellular localization (Khochbin et al. 2001). HDAC4, 5 and 7 shuttle between nucleus and the cytoplasm after binding to 14-3-3 proteins, a family of highly conserved acidic proteins (Muslin and Xing 2000). This binding is believed to be dependant on the phosphorylation of two or three conserved N-terminal serine residues in class II HDACs and mediates their cytoplasmic sequestration (Figure 8). 20 Figure 8. Translocation of HDAC7 causes de-repression of Nur77 gene in developing thymic T cells. HDAC7 represses Nur77 gene through either preventing the binding of co-activators or direct associated enzymatic activities. Activation of the T-cell receptor causes activation of Ca2+/CaM-dependent protein kinases (CaMKs), and elevation of intracellular Ca2+ levels, which in turn activates the Ca2+ sensor calmodulin (CaM). Phosphorylation of HDAC7 by CaMKs facilitates its binding to 14-3-3 protein, mediating its CRM1-dependent nuclear export. Activated CaM binds to Cabin1 and removes it from repression complex. Either one of the two pathways is able to restore the expression of Nur77 gene (Verdin et al. 2003). 21 SMRT and N-CoR are encoded by two distinct loci but share a common molecular architecture and approximately 45% amino acid identity, while additional forms of SMRT and N-CoR are generated by alternative mRNA splicing (Privalsky 2004). Both SMRT and N-CoR can be conceptually divided into an N-terminal portion having three or four distinct transcriptional repression domains (RDs), and a C-terminal portion composed of two or three nuclear receptor interaction domains (NDs) (Figure 9). Therefore, SMRT and N-CoR can be viewed as protein platforms, which recruit other corepressors like HDACs, TBL-1, mSin3 and associated proteins through their RDs, while also tethering to the nuclear receptors through their NDs (Privalsky 2004). SMRT and N-CoR interact with both HDAC3 and class IIa HDACs, which explains why HDAC3 co-immunoprecipitates with class IIa HDACs. Class IIa HDACs are enzymatically inactive unless they bind to the SMRT/N-CoR-HDAC3 complex. HDAC3 is also catalytically inactive alone as purified protein but becomes enzymatically active when bound to SMRT/N-CoR, even in the absence of class IIa HDACs. In contrast, class IIa HDACs alone are still enzymatically inactive after binding to the SMRT/N-CoR proteins in vitro (Verdin et al. 2003). Another co-repressor, Sin3 is also a large multi-domain protein, with four imperfect repeats of a paired amphipathic helix (PAH) motif that facilitates its interaction with other proteins (Shiio et al. 2006). Sin3A has been reported to interact directly with HDAC1 and HDAC2, and is recruited by many DNA-binding transcriptional repressors. SMRT and N-CoR are also found to interact directly with mSin3A, and SMRT is 22 Figure 9. Domains of the N-CoR and SMRT co-repressors. The primary structure of the human N-CoR and murine SMRT α. Codon numbering is indicated on top. The locations of the repression domains (RD1 to RD4), the deacetylase activating domain (DAD), the conserved SANT motifs that include sites of histone interaction, and of the CoRNR box/nuclear receptor interaction sites (N1, N2, and N3 in N-CoR verses S1 and S2 in SMRT) are indicated for each co-repressor. Interaction sites for transcription factors that utilize SMRT and/or N-CoR for repression are indicated in yellow, whereas interaction sites for additional components of the co-repressor complex or the general transcriptional machinery are shown in red. Not all interacting proteins have been proven to interact with both N-CoR and SMRT. Adapted and modified from Privalsky et al., 2005. 23 reported to form a repressor complex together with mSin3A and HDAC1 (Nagy et al. 1997). mSin3A is also reported to be involved, possibly through a mSin3-binding protein-SAP 30, in N-CoR-mediated repression (Laherty et al. 1998). 1.3.3 Modification of Class IIa HDACs by phosphorylation or SUMOylation affects their repressive functions. The class IIa HDAC phosphorylation sites recognized by the 14-3-3 proteins are closely related to consensus phosphorylation sites for Ca2+/CaM-dependent protein kinases (CaMKs) (Mckinsey et al. 2000a). Overexpression of constitutively active CaMKs or signal-dependent activation of CaMKs induces the localization of class IIa HDACs to the cytoplasm and suppresses their repressive activity (Kerckaert et al. 1993). Conversely, mutation of the serine phosphorylation sites abolishes the HDAC nuclear export and enhances their repressive effects during muscle differentiation and T-cell apoptosis (Mckinsey et al. 2000a; Miska et al. 2001). Cytoplasmic localization of class II HDACs removes these enzymes from the chromatin and dissociates them from the SMRT/NCoR–HDAC3 complex, leading to the disruption of the repression complex (Fischle et al. 2001; Fischle et al. 2002). Several HDACs have been reported to be targeted by SUMO, a small ubiquitin-like modifier, which is able to enhance their repressive abilities (Gill 2005). Unlike 24 ubiquitylation, which generally but not always, causes protein degradation through the proteasomal pathway, SUMOylation affects the function of the target protein by either altering its sub-cellular localization or by antagonizing other modifications. The covalent attachment of SUMO to its target involves four enzymatic reactions, which are mediated by SUMO protease, E1, E2 and E3 enzymes, to form an isopeptide bond between the carboxy-terminal glycine of SUMO and the ε-amino group of a lysine residue in the target protein (Seeler and Dejean 2003). Modification of HDAC1 by SUMO contributes to the repression of AR - mediated transcription. It has been reported that over-expression of SENP1, one of the Sentrin/SUMO-specific protease, enhances AR-dependent transcription, which is not mediated though de-sumoylation of AR, but rather through de-SUMOylation of HDAC1, causing its de-conjugation and reducing its deacetylase ability (Cheng et al. 2004). HDAC4 is also modified by SUMO. Mutation of the SUMO-acceptor lysine in HDAC4 correlated with a reduction in both deacetylase activity and transcriptional repressor activity (Kirsh et al. 2002). Thus, the functions of HDACs as either enzymatic histone deacetylases or transcription co-repressors can be regulated by SUMO modification. HDACs have also been found to regulate the efficiency of SUMOylation of some substrates. Because SUMOylation competes for the same lysines with other posttranslational modifications like ubiquitination and acetylation, deacetylation of those lysine residues by HDACs could increase accessibility of substrate lysines to SUMO. 25 HDAC4 has been shown to stimulate SUMOylation of the transcription factors MEF2C and MEF2D (Gregoire and Yang 2005). An increasing amount of work also supports a role for SUMOylation in the control of chromosome dynamics. In fact, all SUMO-pathway components, E1, 2, 3, and SUMO proteases, have shown to be associated with the regulation of chromosome condensation, cohesion or mitotic chromosome separation (Seeler and Dejean 2003). One important consideration regarding SUMOylation of histones is that its target lysine residue is a putative substrate for multiple modifications, not only for SUMO, but also for acetylation and methylation (Shiio and Eisenman 2003) (Figure 10). Histone acetylation by histone acetyltransferases recruited through co-activator complexees, correlates with gene activation. Once the gene has been transcribed, its activity must be attenuated and then finally repressed. The signal for recruitment of SUMOylating enzymes may be acetylation itself, as suggested by the observation that H4 SUMOylation increases with increasing H4 acetylation (Shiio and Eisenman 2003). The HDAC-mediated removal of acetyl groups occurs as a result of their recruitment by DNA-bound repressors. Repression is then caused by histone methyltransferase (HMT) - mediated methylation, which is required for binding of HP1, in turn providing the structural element for chromatin condensation (Nathan et al. 2003). 26 Figure 10. Model for SUMOylation function in regulating transcription. A gene with TATA box-containing promoter and ORF is shown together with histone octamers/nucleosomes represented by ovals. An activator, through the help of coactivators, can recruit a histone acetyltransferase (HAT) which acetylates histones and promotes chromatin structure amenable to transcription. This acetylation can potentially recruit SUMO-conjugating enzyems (E2/E3) capable of modifying either histone or activators to achieve attenuation. The repressors are able to bind DNA, probably facilitated by SUMO modification, and recruit co-repressors and histone deacetylase (HDAC) to deacetylate histones, making way for the addition of repression-specific methylation marks, like H3 K9-methyl, by an HMT. Finally, methylated histones (and possibly SUMO) would recruit HP1, contributing to chromatin structure in a static repressed state. Adapted from Nathan et al., 2003. 27 1.4 Mouse gonadotrope cell lines: αT3-1 and LβT2 αT3-1 and LβT2 gonadotrope cell lines were generated by targeted oncogenesis in transgenic mice. The αT3-1 cell line was isolated from the carcinoma developed in the embryos following expression of the oncogene driven by the gonadotropin α subunit gene promoter (Windle et al. 1990), and the LβT2 cell line was derived by a similar method, using the LH β subunit gene promoter (Alarid et al. 1996). The αT3-1 cell line, which represents an immature gonadotrope, expresses the α-subunit, GnRHr and Sf-1, but neither LH nor FSH β genes (Windle et al. 1990). The LβT2 cell line represents a fully differentiated gonadotrope, expressing GnRH receptor, both α- and LH β-subunits; it can also be induced to express the FSHβ gene with exposure to activin (Graham et al. 1999) (Figure 11). 28 Gonadotropes Stages of differentiation α αT1-1 + Activin α, GnRHr α, LHβ, FSHβ GnRHr FSHβ α, LHβ GnRHr LβT αT3-1 Early gonadotrope Embryonic Day e11.5 LβT2 Fully differentiated gonadotrope e16.5 e17.5 Figure 11. The gonadotrope cell lines along the developmental cell lineages of the anterior pituitary. The distinct stages of differentiation are represented by the immortalized pituitary cell lines created by target oncogenesis in transgenic mice. In this study, the αT3-1 (immature gonadotrope) and LβT2 (fully differentiated gonadotrope) cell lines were used as comparative model systems. Adapted from Alarid et al., 1996. 29 1.5 Hypothesis and aims The hypothesis of this study was that HDACs along with co-repressors N-CoR, SMRT and/or Sin3A comprise distinct repressive complexes at the LH and FSH β gene promoters, and that GnRH is able to disrupt the complex(es) through the removal of some of these proteins, resulting in the de-repression of both genes. This removal might be regulated by GnRH-mediated modifications of the HDACs, possibly including SUMOylation. The aims of this study were to: 1. determine whether the presence of distinct HDACs at both LH and FSH β-subunit gene promoters is affected following GnRH treatment; 2. investigate the roles of the co-repressors N-CoR and SMRT in regulating the gonadotropin β-subunit genes; 3. characterize the repressive complex(es) associated with each gene promoter; 4. investigate a possible role for SUMOylation in GnRH-mediated de-repression of these genes. 30 CHAPTER 2 MATERIALS AND METHODS 2.1. Tissue culture 2.1.1. Growth condition αT3-1 cells (a gift from Dr P. Mellon) were cultured in minimal essential medium (MEM), containing 10% qualified fetal bovine serum (FBS), non essential amino acid solution, sodium pyruvate solution (all from GIBCO™), 100 µg/ml antimycotic solution and 10 mM HEPES (pH 7.4, Sigma Aldrich). The mature pituitary gonadotrope cell line LβT2 cells (from Dr P.Mellon, San Diego) were cultured in Dulbecco’s modified eagle medium (DMEM), certified FBS (all from Gibco™), 100 µg/ml antimycotic solution and 10 mM HEPES (pH 7.4, Sigma Aldrich). These cells were maintained under 5 % CO2 at 37 ºC. 2.1.2. Transient transfection LβT2 and αT3-1 cells were cultivated in 100 mm plates. Transfection was carried out when the cells were at 70% confluence (roughly 5×105 cells) using GenePORTER™ transfection reagent (Gene Therapy Systems Inc.). The amount of the plasmid DNA transfected into the cells was optimized as shown in Table 1; 0.2 µg of LacZ expression vector was also transfected as control. The plate was swirled to ensure even dispersal of GenePORTER 2/DNA mix. The cells were incubated for 60 h before harvest. 31 Cell Type The amount of the plasmid for transfection (µg) pSUPER-N-CoR αT3 LβT2 pSUPER-SMRT (A+B) 8 6 8 6 pSUPER-mSin3A 8 NA Table 1: Optimized amount of plasmids transfected into the cell lines 2.2. Preparation of plasmid DNA 2.2.1 Expression vectors The expression vectors for SUMO1 and SENP1 were kindly donated by Dr. Martin Lee (Department of Physiology, National University of Singapore). 2.2.2 siRNA constructs to target N-CoR, SMRT and Sin3A. 2.2.2.1 Design of oligonucleotides Oligonucleotides were designed based on the mRNA transcript of the target gene, using the design tools from Oligoengine (http://www.oligoengine.com). A pair of oligonucleotides was synthesized to target N-CoR and two pairs of oligos were synthesized targeting two sites of SMRT. Sequencing BLAST was carried out to confirm that the siRNA targeting N-CoR and SMRT mRNA would be completely specific and would not cross-react. All the sequences are shown in Table 2. The siRNA vector targeting mSin3A was already available (Ye, 2004). 32 Target Accession Gene NO. Sequence (5’-3’) Forward Sequence (5’-3’) Reverse N-CoR GeneID 20185 GATCCCCAGGAAGAGTGTTCCTGATTTTCAAGAGAAATCAGGAACACTCTTCCTTTTTTA AGCTTAAAAAAGGAAGAGTGTTCCTGATTTCTCTTGAAAATCAGGAACACTCTTCCTGGG SMRT-A GeneID 20602 GATCCCCCCCATAGAATCAAAGCACCTTCAAGAGAGGTGCTTTGATTCTATGGGTTTTTA GGGGGGTATCTTAGTTTCGTGGAAGTTCTCTCCACGAAACTAAGATACCCAAAAATTCGA SMRT-B GeneID 20602 GATCCCCTGACTACATCACCTCGCAGTTCAAGAGACTGCGAGGTGATGTAGTCATTTTTA AGCTTAAAAATGACTACATCACCTCGCAGTCTCTTGAACTGCGAGGTGATGTAGTCAGGG Table 2: Oligonucleotides designed for synthesis of siRNA 2.2.2.2 Annealing of oligonucleotides The oligonucleotides were dissolved in sterile, nuclease-free H2O to a concentration of 3 µg/µl and each set (forward and reverse) was assembled in a 50 µl reaction by mixing 1 µl of each oligo with 48 µl annealing buffer (100 mM NaCl and 50 mM HEPES pH 7.4). Annealing was carried out under the conditions shown in Table 3. Conditions 90 °C 70 °C Step wise cooling to 4 °C Time (min) 4 10 20 Table 3: Conditions for annealing of oligonucleotides 33 2.2.2.3. Restriction digestion of vectors The modified pSUPER vector (0.5 µg, Oligoengine) was linearized with Hind III (1 µl; 10 U/µl; Promega) for 1 h, followed by Bgl II (1 µl; 10 U/ µl; Promega) for another 2 h in a total reaction volume of 20 µl. Both digestions were carried out at 37 °C. Enzymes were then denatured by heating at 65 °C for 0.5 h. 2.2.2.4. DNA purification The digested DNA was separated on a 1 % agarose gel and the linearized vector was excised and purified from the gel using QIAEX II Agarose Gel Extraction (QIAGEN) according to the manufacturer’s instructions. 2.2.2.5. Ligation of annealed oligos and linearized pSUPER vector The ligation reaction mix was assembled for N-CoR and SMRT oligos as shown in Table 4. Ligation with the vector was carried out overnight at room temperature. A negative control without insert was used in parallel. Subsequently, the ligation mix was treated with Bgl II (10 U/µl) for 30 minutes at 37 oC to decrease the number of false positives, as the BglII site is destroyed upon successful cloning of the annealed oligos. Components Annealed oligos Linearized pSUPER vector (0.3 µg/uL) T4 DNA ligase buffer 10X (Promega) T4 DNA ligase (3 U/µL, Promega) Sterile distilled water Total volume Volume (µl) 2 1 1 1 5 10 Table 4: Components of reaction for T4 ligatio 34 2.2.3 Isolation, verification and large scale preparation 2.2.3.1. Transformation of plasmids into Escherichia coli (E.coli) Chemically competent E.coli DH5-α cells were first prepared. A colony of E.coli DH5-α was used to innoculate 5 ml of Luria-Bertani (LB) medium. This was incubated for 16 h at 37 ºC, 250 rpm before transferring to 200 ml of LB medium and incubation under the same conditions until the OD600 reached a value of 0.3 to 0.6. The bacterial culture was then centrifuged at 4000 rpm for 15 minutes at 4 ºC. The pellet was resuspended on ice in 1/20 volume filtered TSS [LB broth (pH 6.1), 10% polyethylglycol, 5% dimethylsulfoxide (both from Sigma), 10 mM MgCl2 and 10 mM MgSO4 at final pH 6.5-6.8]. Competent cells were stored in aliquots of 200 µl at -80 ºC. The pSuper-mSin3A, pSuper-N-CoR, pSuper-SMRT-A and B were transformed into competent E. coli strain – DH5-α by heat-shock. In brief, 300-400 ng of plasmids were added to 30 µl of DH5-α cells and thawed on ice for 30 minutes before incubation in 42 ºC for 90 sec and immediately transferred onto ice for another 2 minutes. LB medium (800 µl) was added and incubated in 37 ºC shaking incubator for 1 hr. Cells were pelleted down and 100 µl of supernatant was retained for pellet resuspension. Subsequently, the cells were plated onto LB agar plates pretreated with 100 µg/µl ampicillin. The plates were incubated overnight at 37 °C. 35 2.2.3.2. Plasmid isolation and verification Plasmid DNA of selected colonies was obtained using Wizard Plus SV Miniprep Kit (Promega) according to instructions. Subsequently, the siRNA constructs were verified using restriction digestion as shown in Table 5 which was carried out at 37 oC for 2 h, and resulting DNA fragments were visualized on a 1.5 % agarose gel. Components DNA Hind III (10 U/µL, Promega) Eco RI (12 U/µL, Promega) Buffer 10X Sterile distilled water Total volume Volume (µl) 2 0.5 0.5 2 15 20 Table 5: Mix preparation for the restriction digestion The presence of correct insert in the recombinant pSUPER vector was confirmed by sequencing using ABI PRISMTM BigDyeTM Terminator Cycle Sequencing Ready Reaction kit (PE Applied Biosystems, Perkin Elmer). The sequencing reaction mix was prepared as in Table 6. The sequencing reactions were performed in a thermal temperature cycler (i-Cycler™, BIO-RAD) as in Table 7. The sequencing products were precipitated by isopropanol/sodium acetate precipitation. To each tube, 20 µl sodium acetate (pH 4.8) and 50 µl 95% ethanol were added, followed by incubation on ice for 20 min. DNA pellet was spun down at 14,000 rpm for 30 minutes and washed twice in 500 µl of 70 % ethanol. Sequencing loading buffer (2 µl of 5x deionized formamide, 1x 20 36 mM EDTA, pH 8.0 with blue dextran 50 mg/ml) was then added to the PCR pellet. Automated sequencing was then performed using the ABI Prism 377 DNA Automated Sequencer (Perkin Elmer).The DNAMAN (Lynnon BioSoft, version 4.15) was used for analysis of the sequencing results obtained. Components BigDye Terminator Reaction Mix BigDye Terminator Buffer (5x) Double-stranded DNA template (200 ng) T7 Primer (5 pmol) Deionised water Total Quantity (µl) 2 2 1 1 4 10 Table 6: Mix for the sequencing reaction Step 1 2 Hold Temperature (oC) 96 96 50 60 4 Time 60s 10 s 5s 4 min Indefinite No. of Cycles 1 25 1 Table 7: Cycling parameters for sequencing reaction 2.3. RT-PCR analysis 2.3.1. RNA isolation At 60 hours post-transfection, RNA was isolated from the cells using Trizol® reagent (Invitrogen) according to the manufacturer’s instructions. 37 2.3.2. First strand cDNA synthesis The first strand cDNA was synthesized using RNA as the template. Oligo dT was annealed to the poly A-tails of the mRNA, in the reaction mix shown in Table 8, by heating it to 65 oC for 5 minutes and chilling quickly on ice. Components Oligo (dT) 12-18 (500 µg/mL, New England Biolabs) 40 mM dNTP mix RNA (5 µg) and sterile distilled nuclease free water Total volume Volume (µl) 1 1 up to 13 15 Table 8: Mix for the first strand cDNA synthesis Subsequently, the mix was added with 4 µl M-MLV RT 5× Reaction Buffer (Promega) and incubated at 42 oC for 2 min followed by addition of 1 µl M-MLV Reverse Transcriptase (Promega). The mix was then incubated at 42 oC for 80 minutes before heat inactivation at 70 oC for 20 min. 2.3.3. PCR and gel electrophoresis analysis PCR amplification of the mouse LHβ and FSHβ cDNA and β-actin gene as a positive control, was performed following the reaction shown in Table 9. The cycling parameters are outlined in Table 10, and gene specific primers were designed by DNAMAN and were listed in Table 11. Amplicons were analyzed by separating on a 1.0% agarose gel. 38 Components Dynazyme Buffer 10X (Finnzyme) Forward primer (30 µM) Reverse primer (30 µM) cDNA template dNTPs 10 mM Sterile distilled water Dynazyme (2 U/µL, Finnzyme) Total volume Volume (µl) 2.5 1 1 2 0.5 17.5 0.5 25 Table 9: Mix of PCR to test expression level of the LHβ, FSHβ and β-actin Segment 1 2 Cycle 1 30 3 4 1 1 Temperature (oC) 95 95 58 72 72 16 Time 5 min 15 s 30 s 30 s 7 min ∞ Table 10: PCR cycling parameters to analyze LHβ, FSHβ and β-actin gene expression Primers mLH gene F mLH gene R mFSH gene F mFSH gene R β-actin gene I β-actin gene II Sequence (5’-3’) GCCTGTCAACGCAACTCTGG CAGGCCATTGGTTGAGTCCT AGCACTGACTGCACCGTGAG CCTCAGCCAGCTTCATCAGC GCCATGTACGTAGCCATCCA Primer size (bp) 20 20 20 20 20 20 Amplicon size (bp) 300 600 250 ACGCTCGGTCAGGATCTTCA Table 11: Primers used to amplify LHβ, FSHβ and β-actin 39 2.4. Western blotting 2.4.1. Whole cell extraction Cells were rinsed once with PBS buffer and collected in 2 ml lysis buffer with protease inhibitors (Table 12). For SUMOylation test, N-Ethylmaleimide (NEM) was added at a final concentration of 20 mM. Samples were lysed with gentle rocking at 4oC for 30 minutes then centrifuged at 14,000 rpm for 30 minutes at 4oC. Supernatants were removed and saved, followed by measurement of protein concentration using the Bradford method (Bradford 1976) (Biorad Bradford protein assay reagent). 2.4.2. Nuclear and cytoplasmic extraction Cells were pretreated and collected as for the whole cell extraction followed by extraction, using NE-PER Extraction Reagents (PierceTM) according to the manufacturer’s instructions. Protein concentration was measured using the Bradford method. 2.4.3. SDS page and blotting An aliquot of 20 µg of protein was taken out and added with 2× loading dye (all the buffers used during Western blotting are shown in Table 12). The mix was heated to 95 o C for 10 minutes before resolving on a SDS-polyacrylamide gel (6% or 8 %) in SDS running buffer at 80 V voltage for 10 minutes, then 100 V for 1.5 to 2 hours at RT. The proteins were then transferred from the gel to an Immuno-Blot PVDF (Bio-rad) membrane in transferring buffer at constant 235 A current for 4 hours at 4 oC. Membrane 40 blocking was performed at RT on a rotating platform for at least 4 hours. Subsequently, membrane washing was carried out three times for 10 minutes each by washing buffer, on a rotating platform at RT. Incubation with primary antibodies was carried out with various antibody dilutions as in Table 13, overnight at 4 oC. Following primary antibody incubation, washing was carried out as described above. The membrane was then incubated with the appropriate HRP conjugated secondary antibodies for 1 hour at RT on a rotating platform. Subsequently, the membrane was washed as described above and the immuno-reactive protein was detected using the SuperSignal® WestPico Chemiluminescent substrate (Pierce) for 5 minutes on a rotating platform. Excess solution was rinsed off with distilled water and the membrane was placed between two pieces of X-ray film (Kodak Scientific Imaging Film X-OMATTM) in an autoradiograph cassette. Exposure was carried out for 0.5 – 30 min before the film was developed using a Kodak M35 X-OMAT Processor. 41 Buffer Component 50 mM Tris-HCl pH 7.6, 150 mM NaCl, 1 mM EDTA, 0.1% NP40, 0.5 mM PMSF, 0.5 mM DTT 100 mM Tris HCl pH 6.8, 200 mM BME, 4 % SDS, 0.2 % bromophenol blue, 20 % glycerol 12.5 mM Tris-HCl pH 7.4, 96 mM glycine, 1.7 mM SDS 20 mM Tris-HCl pH 7.4, 137 mM NaCl, with 0.1% Tween-20 (add fresh) 40 mM glycine, 58 mM Tris, 1.6 mM SDS and 20 % methanol TBST with 5% non-fat milk TBST with 5% BSA 1 mM phenylmethylsulfonyl fluoride (PMSF) 1 µg/ml leupeptin 1 µg/ml pepstatinA 50 mM Tris-HCl pH 7.6, 300 mM KCl, 0.2 mM EDTA, 0.05% NP40, 0.5 mM DTT Lysis buffer 2x loading dye SDS running buffer Washing Buffer (TBST) Transfering Buffer Blocking Buffer Dilution Buffer Protease inhibitors Washing Buffer (Co-IP) Table 12: Composition of buffers used in western blot Antibody Source Dilution HDAC1 Cell signaling Technology® 1:1400 HDAC3 Cell signaling Technology® 1:1400 HDAC 4 Cell signaling Technology® 1:1400 HDAC 5 Cell signaling Technology® 1:1400 Sin3A Santa Cruz Biotechnology® 1:1400 N-CoR Santa Cruz Biotechnology® 1:250 SMRT (co-IP) Upstate Biotechnology® 1: 500 SMRT Santa Cruz Biotechnology® 1:250 Table 13: Antibodies used in western blotting; Regarding anti-SMRT, one is particularly used for western blotting following co-precipitation 42 2.5. Co-immunorecipitation (Co-IP) Cells were rinsed once with PBS buffer and collected in 2 ml lysis buffer with protease inhibitors, as for western blotting (see section 2.4.1 and 2.4.2). The antigen-antibody complex was formed by incubating the specific antibody (Table 14) with the cell lysates for 0.5 to 1 h at 4 oC. The immune complex was captured by adding 50% (v/v) Protein A-sepharose beads (Amersham, stored in10 mM Tris HCl, 1 mM EDTA, 0.0 5% sodium azide), followed by incubation for 0.5 h at 4 oC. The complex was collected by centrifugation at 14,000 rpm for 30 min at 4 oC, then removing the supernatant and washing twice by washing buffer (Table 12). The complex was centrifuged and the supernatant removed after each round of washing, and subsequently 15 µl of 2x loading dye was added to the complexed pellet, followed by heating for 5 min at 95 oC, and centrifuging at 14,000 rpm for 5 min. The supernatants were collected for western blotting as described in section 2.4.3. Antibody Source Dilution HDAC1 Cell signaling Technology® 1:200 HDAC2 Abcam® 1:1000 HDAC3 Cell signaling Technology® 1:200 HDAC 4 Cell signaling Technology® 1:200 HDAC 5 Cell signaling Technology® 1:200 mSin3A Santa Cruz Biotechnology® 1:50 SMRT Upstate Biotechnology® 1:200 Table 14: Antibodies used in immuno-precipitation 43 2.6. Chromatin Immunoprecipitation (ChIP) 2.6.1. Cross-linking of protein and DNA αT3-1 cells were grown in 100 mm plates to approximately 80% confluence before treatment with GnRH at the final concentration of 10-100 nM for 6-12 hours. Cells were ready for harvesting with the number of roughly 8-10×106. Formaldehyde was added at a final concentration of 1% to each 100 mm plate and incubated at RT on a shaking platform for 10 minutes for cross-linking of proteins to the DNA. Cross-linking was arrested by incubation with 0.125 M glycine for 5 minutes at RT. Cells were washed twice with 5 ml ice-cold PBS and collected in 2 ml PBS containing protease inhibitors (Table 12). Cells were than pelleted at 8000 rpm for 10 minutes at 4o C and resuspended in 1.35 ml of SDS lysis buffer (Table 15), and incubated for 10 minutes on ice. Samples were sonicated with SONOPULS Ultrasonic Homogenizer HD 2070 (BANDELINTM). Cell debris was then pelleted at 13,000 rpm for 10 minutes at 4o C. The supernatant was split and transferred into three fresh tubes with 450 µl in each. An aliquot of 50 µl was taken out and diluted to 500 µl with ChIP dilution buffer (Table 15) containing protease inhibitors, and saved as the input sample for DNA quantitation. The remainder was diluted to 1 ml with the same ChIP dilution buffer. 44 2.6.2. Immunoprecipitation of protein-DNA complex and DNA extraction The 1 ml diluted samples were pre-cleared with 40 µl of 50% (v/v) Protein A-sepharose beads (Amersham, stored in10 mM Tris HCl, 1 mM EDTA, 0.0 5% sodium azide), 10 µl of bovine serum albumin (BSA, with final concentration of 1mg/ml) and salmon sperm DNA (with final concentration of 0.1mg/ml) for 4 hours at 4 ºC with rotation, followed by centrifugation. The supernatant was transferred into a fresh tube before addition of antibodies (Table 16) followed by incubation at 4 ºC for overnight. Subsequently, each sample was incubated with 40 µl of 50 % v/v Protein A- sepharose beads for 2.5 h at 4 ºC with rotation, followed by centrifugation at 800 rpm for 2 minutes at 4 ºC to collect the complexes. Precipitates were serially washed twice, sequentially by low salt wash buffer, high salt wash buffer, LiCl wash buffer and TE wash buffer (Table 15) on a rotator at 4 ºC for 4 minutes each. Freshly prepared elution buffer (Table 15) eluted the protein-DNA complex from the beads with vigorous shaking at room temperature for at least 15 min. The beads were spun down at 800 rpm for 2 min. Approximately 500 µl of eluant per sample was obtained. Cross-linking was reversed with 20 µl of 5 M NaCl and 2 µl of Rnase A (10 µg/ul), and incubating at 65 ºC for overnight. Proteins dissociated from the complex were digested with 2 µl of 10 mg/ml proteinase K, 10 µl of 0.5 M EDTA, and 20 µl of 1 M Tris-HCl pH 6.5, for 1 hour at 45 ºC. The precipitated DNA was then extracted by phenol/chloroform and precipitated with isopropanol/sodium acetate. Reverse crosslinking and extraction were also carried out for the input DNA. 45 2.6.3. PCR detection The presence of FSHβ and LHβ gene proximal promoters was detected by PCR with cycling parameters shown in Table 17. The set of primers for the FSHβ promoter is from – 595 to –70 bp, and for the LHβ promoter from – 276 to –17 bp; the sequences of the primers are shown in Table 18. Buffer Component SDS lysis 1 % SDS; 10 mM EDTA; 50 mM Tris-HCl pH 8.1 0.01 % SDS; 1.1 % TritonX-100; 1.2 mM EDTA; 16.7 mM ChIP dilution Tris-HCl pH 8.1; 167 mM NaCl Low salt washing 0.1 % SDS; 1 % Triton X-100; 2 mM EDTA, 20 mM Tris-HCl buffer pH 8.1; 150 mM NaCl High salt washing 0.1 % SDS; 1 % Triton X-100; 2 mM EDTA, 20 mM Tris-HCl buffer pH 8.1; 500 mM NaCl LiCl washing buffer 0.25 M LiCl; 1 % NP40; 1 % deoxycholate; 1 mM EDTA; 10 mM Tris-HCl pH 8.1 TE washing buffer 10 mM Tris HCl, 1 mM EDTA Elution buffer 1 % SDS, 0.1 M NaHCO3 Table 15: Composition of buffers used in ChIP experiments. 46 Source Amount used (µl ) HDAC1 Cell signaling Technology® 2.5 HDAC2 Abcam® 2.5 HDAC3 Cell signaling Technology® 2.5 HDAC4 Cell signaling Technology® 2.5 HDAC5 Cell signaling Technology® 2.5 N-CoR Santa Cruz Biotechnology® 20 SMRT Upstate Biotechnology® 20 Antibody Table 16: Antibodies used in ChIP Cycle 1 (x1) 2 (x35) 3 (x1) Steps Step 1: 95 C for 5 min Step 1: 95 oC for 20 s Step 2: 60 oC for 15 s Step 3: 72 oC for 30 s Step 1: 72 oC for 5 min o Table 17: PCR cycling parameters to amply specific regions of the FSHβ and LHβ gene promoters. Primer Primers Sequence (5’-3’) mLH promoter (2701) F CAATCTGGGG GTTCAGCGAG 20 mLH promoter (2941)R CCTTGGGCACCTGGCTTTAT 20 mFSH promoter(6250)F ATTGGTGACAGAGAGGACATC 21 Amplicon size (bp) size (bp) mFSH promoter(5791)R CCAATACCAACATAAAGCCTGCTG 24 241 525 Table 18: Primers used to amply LH and FSH β promoter region 47 CHAPTER 3 RESULTS _________________________________________________ 3.1. Gonadotropin β-subunit genes are repressed by HDACs in the immature gonadotrope αT3-1 cell line and GnRH is able to overcome this repression Immature gonadotrope αT3-1 cells, which normally do not express either LH or FSH βsubunit genes, were treated with GnRH for 8 hours at 20, 50 or 100 nM, or with same concentration (100 nM) for 8 or 12 hours. RT-PCR over 30 cycles failed to detect either LH or FSH β transcript in untreated cells. However, exposure to 100 nM GnRH for 8 hours was sufficient to facilitate expression of the LHβ gene, with the longer stimulation time of 12 hours increasing its level further (Figure 12a). For FSHβ, 8 hours treatment of 20 nM GnRH was sufficient to overcome the repression, and an increase of concentration to 50 and 100 nM enhanced further the increase in the FSH β transcript level (Figure 12b). These results, together with previous findings that treatment with trichostatin A (TSA), a non-specific inhibitor of class I and II HDACs, was sufficient to induce expression of both LH and FSH β-subunit genes in the αT3-1 cells (Lim et al. 2007), indicate that both LH and FSH β-subunit genes are repressed by HDACs in immature gonadotrope cells and that GnRH treatment is able to overcome this HDAC-mediated repression. 48 8 hrs GnRH (100 nM) -- -- + 12 hrs + + + LH actin (a) 8 hrs GnRH -- 20 50 100 (nM) FSH actin (b) Figure 12: LH and FSH β-subunit gene expression is repressed in immature αT3-1 cells and this is overcome by GnRH. RT-PCR analysis of LH (a) and FSH (b) β mRNA levels was carried out following exposure to GnRH (100 nM) for either 8 or 12 hours (a), or GnRH (20, 50, 100 nM) for 8 hours (b). Total RNA was isolated from the cells and cDNA was synthesized and used as template for PCR. The primers were designed to amplify fragments of the coding regions of the LH and FSH β cDNAs, while amplification of a fragment of the mouse β-actin cDNA is shown as control. 49 3.2. Co-repressors are identified that repress the FSH β gene in both αT3-1 and LβT2 cells Co-repressors N-CoR and SMRT have been reported widely to repress gene expression associating with certain HDACs. In order to characterize co-repressors which might be involved in the repression of the gonadotropin β-subunit genes, the effect of siRNAmediated knockdown of N-CoR or SMRT was evaluated. Transfection of the siRNA constructs to knockdown SMRT had a clear stimulatory effect on the FSHβ transcript levels in both the αT3-1 and LβT2 cells, but did not affect the level of the LHβ transcript. The siRNA construct targeting N-CoR appeared to have no effect on either transcript in both cell lines (Figure 13). Figure 13: SMRT represses expression of the FSHβ gene in both cell types. siRNA constructs targeting the co-repressors N-CoR or SMRT were transfected into αT3-1 and LβT2 cells after which RT-PCR was carried out to assess the effects on LH and FSH β mRNA levels as shown in Figure12. 50 RT-PCR was performed to detect transcript levels of both N-CoR and SMRT following siRNA construct transfection. The mRNA levels of N-CoR or SMRT were dramatically reduced after the respective siRNA transfections (Figure 14a). Western blotting was also carried out following siRNA mediated knockdown of N-CoR, and this showed a decline in the protein level of N-CoR (Figure 14b). The effect of knockdown of SMRT was tested by western blotting by other lab members (Figure 14b). 51 (a) control siN-CoR siSMRT N-CoR SMRT β-actin (b) siN-CoR Control N-CoR Pol II siSMRT Control SMRT GAPDH Figure 14: In αT3-1 cells, both transcript and protein levels of N-CoR and SMRT are decreased following the respective siRNA-mediated knock down. The siRNA constructs targeting the co-repressors N-CoR or SMRT were transfected into αT3-1 cells, after which, (a) RT-PCR was carried out to assess the transcript levels of N-CoR and SMRT, (b) Western blotting analysis was carried out to detect protein levels of N-CoR or SMRT. Polymerase II or GAPDH was also detected as an internal loading control. 52 3.3. Distinct sets of HDACs and co-repressors are associated with the LH and FSH β gene promoters, and the association is affected by GnRH treatment To demonstrate the role of HDACs in repressing the expression of the gonadotropin βsubunit genes, ChIP assays were previously carried out in the αT3-1 cells and identified distinct HDACs that are associated with either the LH or FSH β promoters (Lim et al. 2007). In order to investigate the mechanism of the GnRH-mediated de-repression of these two genes, the association of LH or FSH β promoter with several of these HDACs was tested by ChIP following GnRH treatment. Considering the abundance of information from the literature, HDAC1 to HDAC5 were selected. At basal level, HDAC1, HDAC4, and HDAC5 were found associated with the LHβ promoter (Figure 15), and HDAC2, HDAC3, and HDAC4 were found at the FSHβ promoter (Figure 16). After GnRH treatment, ChIP assay showed the absence of HDAC4 and HDAC5 from the LHβ promoter, but HDAC1 was still associated (Figure 15). At the FSHβ promoter, GnRH treatment caused dissociation of HDAC3 and HDAC4, but not HDAC2 (Figure 16). 53 100 nM, 8 hrs GnRH HDAC1 Ab -+ -+ --- + + + + + -- LHβ promoter Input 20 nM,12 hrs GnRH HDAC4 Ab -+ -+ --- --- + + + + + -- + -- LHβ promoter Input 20 nM,12 hrs GnRH HDAC5 Ab -+ -+ --- + + + + + -- LHβ promoter Input Figure 15: In αT3-1 cells, several HDACs are associated with the LH β promoter and the association is differentially affected by GnRH treatment. ChIP was carried out in either duplicate or triplicate to investigate the effect of GnRH treatment on association of HDAC1, 4, 5 with the LH β promoter; an aliquot from the same cells before precipitation was designated as the input. PCR amplified a 300 bp region of the LHβ proximal promoter. 54 20 nM,12 hrs GnRH HDAC2 Ab -+ -+ -+ --- + + + + + + + -- FSHβ promoter Input 20 nM,12 hrs GnRH HDAC3 Ab -+ -+ --- --- + + + + + -- + -- FSHβ promoter Input 100 nM, 8 hrs GnRH HDAC4 Ab -+ -+ --- + + + + + -- FSHβ promoter Input Figure 16: In αT3-1 cells, several HDACs are associated with the FSH β promoter and this is differentially affected by GnRH treatment. ChIP was carried out in duplicate or triplicate to investigate the effect of GnRH treatment on association of HDAC2, 3 and 4 with the FSH β promoter; an aliquot from the same cells before precipitation was designated as the input. PCR amplified a 576 bp region of the FSHβ proximal promoter. 55 ChIP analysis was carried out to determine whether the co-repressors are associated directly with the LH and FSH β promoters in αT3-1 cells. Neither N-CoR nor SMRT was found to be associated with the LH β promoter at basal level, however, the association of SMRT was apparent following GnRH treatment (Figure 17). For the FSH β promoter, SMRT was detected at basal level, and the association was not affected by GnRH exposure (Figure 18). The association of certain HDACs and co-repressors with the FSH β promoter was also investigated in LβT2 cells. ChIP analysis showed the presence of two class I HDACs, HDAC1 and HDAC3, at the FSH β promoter, and this association was lost following GnRH treatment. At basal level, SMRT was found at the FSH β promoter, but N-CoR was not; after treatment with GnRH, SMRT dissociated while N-CoR was found to be associated (Figure 19). This indicates the possible replacement of SMRT by N-CoR at the FSH β promoter following GnRH treatment. 56 10 nM, 6 hrs GnRH N-CoR Ab -+ -+ --- --- + + + + + -- + -- LHβ promoter Input GnRH SMRT Ab -+ -+ --- 10 nM, 6 hrs + + + + + -- 20 nM, 12 hrs + + + + + -- LHβ promoter Input Figure 17: In αT3-1 cells, neither N-CoR nor SMRT is associated with the LH β promoter but SMRT is recruited following GnRH treatment. ChIP was carried out in duplicate to investigate whether N-CoR or SMRT is associated with the LH β promoter with or without GnRH treatment; an aliquot from the same cells before precipitation was designated as the input. PCR amplified a 300 bp region of the LHβ proximal promoter. 57 20 nM, 12 hrs GnRH SMRT Ab -+ -+ --- + + + + + -- FSHβ promoter Input Figure 18: In αT3-1 cells, SMRT is associated with the FSH β promoter and this is not affected by GnRH treatment. ChIP was carried out in duplicate to investigate whether SMRT is associated with the FSH β promoter with or without GnRH treatment; an aliquot from the same cells before precipitation was designated as the input. PCR amplified a 576 bp region of the FSHβ proximal promoter. 58 GnRH (10 nM) 7 hrs HDAC1 Ab -+ -+ + + + + FSHβ promoter HDAC3 Ab -+ -+ + + + + FSHβ promoter Input Input --- GnRH (10 nM) 6 hrs NCoR Ab GnRH (10 nM) 7 hrs -+ + -- + + GnRH (10 nM) 6 hrs SMRT Ab --- -+ + -- + + FSHβ promoter FSHβ promoter Input Input Figure 19: In LβT2 cells, several HDACs along with co-repressors are associated with the FSH β promoter and the association is differentially affected by GnRH treatment. ChIP was carried out to investigate the association of HDAC1, HDAC3, N-CoR or SMRT with the FSH β promoter with or without GnRH treatment; an aliquot from the same cells before precipitation was designated as the input. PCR amplified a 576 bp region of the FSHβ proximal promoter. 59 3.4. Co-immunoprecipitation indicates that the repressive factors associated with the LH and FSH β-subunit gene, are contained in more than one complex at each gene promoter Co-immunoprecipitation was carried out in αT3-1 cells to investigate whether those repressive factors, found associated with LH or FSH β promoter, comprise a single or several complexes at each promoter. HDAC1 and HDAC2 co-precipitated with mSin3A, but not with either HDAC4, HDAC5 or SMRT, whereas HDAC3 co-precipitated with both mSin3A and SMRT, but not HDAC4 (Figure 20). Interaction between HDAC4 and HDAC5 was not found, neither was HDAC4 and SMRT, however, HDAC4 did coprecipitate with mSin3A (Figure 21). The two putative co-repressors, SMRT and mSin3A did not co-precipitate (Figure21). These co-IP results, taken with our previous findings, indicate that in αT3-1 cells both LH and FSH β genes are likely repressed by several complexes. 60 IP:HDAC1 HDAC4 -- + IB: IP:HDAC2 HDAC5 + mSin3A -- + mSin3A + + IB: HDAC4 IP:HDAC3 + -- -- + -- SMRT -- -- + + mSin3A + + -- -- SMRT -- -- + -- Figure 20: In αT3-1 cells, class I HDACs co-precipitate with class IIa HDACs and co-repressors. Proteins in whole cell lysate from αT3-1 cells were co-precipitated with HDAC1, HDAC2 or HDAC3 antibody, followed by immnoblotting with HDAC, SMRT or mSin3A antibody. An aliquot from the same cells lysate before precipitation was designated as the input. 61 IB: IP:HDAC4 HDAC5 + IB: IP:SMRT -- -- + HDAC4 IB: IP:mSin3A + SMRT + + HDAC4 + -- -- + -- mSin3A -- -- + mSin3A + -- -- + SMRT -- + + -- -- SMRT + -- Figure 21: In αT3-1 cells, HDAC4 co-precipitated with the co-repressor Sin3A but not with either SMRT or HDAC5. Proteins in whole cell lysate from αT3-1 cells were co-precipitated with antiserum against HDAC4, Sin3A or SMRT, followed by immnoblotting with HDAC, SMRT or mSin3A antibody. An aliquot from the same cells lysate before precipitation was designated as the input. 62 3.5. GnRH-mediated modification of HDAC4 and HDAC5 facilitates their nuclear export In order to investigate whether a SUMOylation-related pathway is involved in repression of the gonadotropin β-subunit genes, αT3-1 cells were transfected with a vector encoding wild type SENP1, one of the SUMO-specific proteases. RT-PCR results show that overexpression of SENP1 increased both LH and FSH β transcript levels in a dose-related manner (Figure 22). Interestingly, when the amount of transfected vectors reached 1 µg in 2.5 ml media, the increase in the LH β transcript level was abolished, while the FSH β gene expression was still greatly stimulated. This finding indicates the likely involvement of SUMOylation in the repression of the gonadotropin β-subunit genes in αT3-1 cells. Western blotting assay detected that HDAC5 is present in two forms, one appearing 20 kD bigger than that of the expected size. (Figure 23, Lane 1 and 3). To identify whether this putative modification could be SUMOylation, N-ethylmaleimide (NEM), an inhibitor of SUMO isopeptidase which is believed to be necessary for detecting SUMO-modified proteins, was added into cell lysate for comparison. Subsequent western blotting assay showed that NEM treatment did not affect the presence of the two forms of HDAC5 (Figure 23, comparing Lane 1, 3 with Lane 2, 4). This suggests that the putative modification may not be SUMOylation. 63 SENP1 -- 0.2 0.5 1.0 (μg/2.5 ml) LH FSH Actin Figure 22: In αT3-1 cells, the repression of LH and FSH β-subunit genes is overcome by over-expression of SENP1. RT-PCR analysis of FSH and LH β mRNA levels was carried out following over-expression of SENP1, which is one of the SUMO-specific proteases (SENPs) responsible for de-SUMOylation. The effects on LH and FSH β mRNA levels were assessed as shown in Figure12. Cytoplasmic NEM (20 mM) -- + Nuclear -- + HDAC5 modified HDAC5 wild-type GAPDH 1 2 1 2 4 5 3 4 Figure 23: In αT3-1 cells, HDAC5 is present in two forms in both cytoplasmic and nuclear extraction, one appears 20 kD bigger, and this is not affected by NEM treatment. Cytoplasmic and nuclear extractions were acquired from αT3-1 cells, then immuno-blotted by HDAC5 antibody. A aliquot of cells was treated by NEM (20 mM) (Lane 2,4,). GAPDH from the same lysate was also detected as internal loading control. 64 At basal level, wild-type HDAC5, which is represented by the smaller-sized form, was detected localized mostly in the nucleus, and a low level was found in the cytoplasm (Figure 24, Lane 1, 2); however, GnRH treatment decreased the amount of the wild-type HDAC5 in the (Figure 24, comparing Lane 1, 2 with Lane 3, 4). SENP1 over-expression also decreased protein level of wild-type HDAC5 in the nucleus to a similar extent to GnRH treatment, but over-expressing SENP1 dramatically reduced the protein level of both forms of HDAC5 in the cytoplasm, to the extent that nearly no cytoplasmic HDAC5 could be detected (Figure 24, comparing Lane 1, 2, 3, 4 with Lane 5, 6). The combination of SENP1 over-expression and GnRH treatment decreased the protein level of the wild-type HDAC5 in the nucleus beyond that by either treatment alone, and in the cytoplasm, decreased both forms to an undetectable level (Figure 24, Lane 7 and 8). All of these findings indicate the involvement of SUMO-mediated pathways in the subcellular localization of HDAC5, which could also be regulated by GnRH. 65 SUMO1 SENP1 GnRH(10 nM,6 hrs) ---- ---- --+ --+ -+ -- -+ -- -+ + -+ + 150 KD Putative HDAC5 isoform HDAC5 wt cytoplasm GAPDH 150 KD Putative HDAC5 isoform HDAC5 wt nucleus Pol II 1 2 3 4 5 6 7 8 Figure 24: In αT3-1 cells, localization of wild-type HDAC5 in both nucleus and cytoplasm is SUMO-dependant, and this is affected by GnRH treatment. Cytoplasmic and nuclear extractions were acquired from αT3-1 cells, then immuno-blotted by HDAC5. A aliquot of cells was treated solely by GnRH(10 nM, 6 hrs) (Lane 3,4), or over-expressing SENP1 (Lane 5,6) and also treated by the combination (Lane 7, 8). GAPDH from the same cytoplasmic extraction, and Polymerase II from nuclear extraction were also detected as internal loading controls. 66 CHAPTER 4 DISCUSSION The LH and FSH β genes are expressed differentially, though both are expressed in the same cell type and are both regulated by GnRH (Kaiser et al. 1995). It has been suggested that they might be regulated differentially by changes in the GnRH pulse frequency and different secondary messengers activated by the GnRH receptor in a combinatorial manner (Dobkin-Bekman et al. 2006). According to our findings, distinct HDACs are associated with the LH or FSH β promoters together with other co-repressors, probably within different repressive complexes. The association of these distinct HDAC complexes with the LH or FSH β promoters may explain why different conditions of GnRH stimulation are required to regulate the expression of the LH or FSH β genes. The association of the co-repressors N-CoR and SMRT with the LH or FSHβ promoter was tested by ChIP assay, firstly in the αT3-1 cells. It is not totally surprising to find that SMRT but not N-CoR was present at the FSHβ promoter, since there have been many reports that these two proteins are involved in the repression of different genes, although they share a common molecular architecture (Privalsky 2004). Interestingly however, neither N-CoR nor SMRT were found at the LHβ promoter. According to the findings from other lab members, another multi-domain protein Sin3A, a co-repressor which helps in the assembly of other repressive factors, is also found only at the FSHβ promoter in both cell lines (Lim et al. 2007). All of these indicate that there may be an additional 67 unidentified protein, which plays the role of a scaffold to recruit several HDACs to repress the expression of LHβ gene in the αT3-1 cells. As comparison, the association of the FSHβ promoter with either N-CoR or SMRT was also tested in LβT2 cells, and gave similar results. The repressive role of SMRT on the FSHβ gene was further investigated by siRNA mediated knocking down of SMRT, which showed an obvious increase in the level of the FSHβ transcripts in both cell lines, but knocking down SMRT has no effect on the LHβ expression. The knocking down of N-CoR, which was not found at either the LH or FSHβ promoter in either cell line, did not affect the expression of either β-subunit gene in either αT3-1 or LβT2 cell line. The results from these ChIP and siRNA assays indicate that SMRT together with Sin3A, and HDAC2, 3, and 4, act to repress the FSHβ gene in immature αT3-1 cells. Sin3A was shown previously to interact with HDAC1/2 and SMRT (Grozinger and Schreiber 2002; Jepsen and Rosenfeld 2002), which is confirmed in the αT3-1 cells, in which Sin3A co-precipitated with HDAC2. SMRT is reported to associate with Sin3HDAC1/2 complex or with HDAC3 in Sin3-independent complexes without HDAC1/2 (Huang et al. 2000; Jepsen and Rosenfeld 2002; Kakar et al. 2003). The current results indicate that HDAC3 is indeed associated with SMRT, but SMRT and Sin3A did not coprecipitate. Surprisingly, co-precipitation of Sin3A and HDAC3 was observed, though it has not been reported before. Together these findings suggest that there might be two different repressive complexes at the FSHβ gene promoter in αT3-1 cells, one with Sin3A-HDAC2/HDAC3 and the other with SMRT-HDAC3. HDAC4 has been shown by other lab members, to be crucial for the recruitment of HDAC3, but not HDAC2 to the 68 FSHβ promoter in the αT3-1 cells, as knocking down HDAC4 caused dissociation of HDAC3, but did not affect HDAC2 (Lim et al. 2007). However, co-IP assays failed to show HDAC4 in a complex with SMRT, although it co-precipitated weakly with Sin3A. So far, we are not clear about the role of HDAC4 in contribution to the formation of the repressive complex. It may be placed in the center of the complex helping to link the rest of the co-factors through its various domains, as has been shown for other class IIa HDACs in MEF2-dependent myocyte development (Verdin et al. 2003); this might explain why HDAC4 is not easily detected by co-IP. Though the core proteins of the two complexes, SMRT and Sin3A, do not co-precipitate, it does not mean that the two complexes are functionally independent. Previous findings have shown that knocking down either Sin3A or SMRT results in the dissociation of all the HDACs from the FSHβ promoter, and restores the FSHβ expression (Lim et al. 2007), which suggests a functional interaction between these two complexes in the αT3-1 cells. In support of this possibility, it has been reported that remodeling complexes Swi/Snf can be placed upon the Sin3 scaffold (Sif et al. 2001), resulting the modification of nucleosomes which may greatly affect the accessibility of chromatin to other transcription regulators. GnRH stimulation is clearly able to overcome the repression of the gonadotropin βsubunit genes; three possible mechanisms might explain this GnRH-mediated derepression. Firstly, the GnRH signaling pathway may result in the modification of DNAbound repressor, causing its release from the promoter DNA, at the same time, activators, which compete with repressors for the same binding site will replace it (Melamed et al. 2006). Alternatively, GnRH could alter the conformation of the repressor or co-repressor, 69 causing the repressive complex to be released from the repressor and the binding of coactivators can occur. This type of activation characteristically happens as a result of ligand binding by certain nuclear receptors (Lavinsky et al. 1998; Hong and Privalsky 2000; Zhou et al. 2000). Thirdly, in addition to modulating protein-protein interactions, GnRH signaling pathway also causes changes in sub-cellular distributions of some corepressors, such as N-CoR/SMRT, and also of class IIa HDACs (Grozinger and Schreiber 2000; Hong and Privalsky 2000; Mckinsey et al. 2000a; Mckinsey et al. 2000b; Jang et al. 2001; Wu et al. 2001), resulting in the disruption of the repressive complex. In contrast to HDAC3, 4, and 5 which clearly dissociated from the respective gene promoters, HDAC1 and HDAC2 are found still associated with either LH or FSH β promoters following GnRH treatment. This finding, consistent with some previous reports, indicates that class I HDACs may still play a role at the actively transcribed genes (Jepsen et al. 2000; Metivier et al. 2003; Kurdistani et al. 2004; Gao et al. 2005). The co-repressor Sin3A, which has been shown as a core factor in the repressive complex, dissociated from the FSHβ promoter following GnRH treatment, while the association between SMRT and the FSHβ promoter seems not affected. In LβT2 cells, GnRH treatment not only causes dissociation of SMRT from the FSHβ promoter, but also its replacement by N-CoR. It is not surprising to find SMRT or N-CoR associated with on-going transcribed genes, as this has been reported for several genes (Jepsen et al. 2000; Pernasetti et al. 2001), and they are known to substitute each other in the control of NF-κB expression (Gao et al. 2005). Given the fact that HDAC2 is still associated with the FSHβ promoter following GnRH treatment, it is possible that after GnRH stimulation 70 HDAC2 can be recruited to the FSHβ gene through a different complex with the altered SMRT. The current results show that GnRH stimulation can cause the removal of HDAC4 and HDAC5 from the respective genes. Both HDAC4 and HDAC5 belong to class IIa HDACs, which have been widely reported as versatile regulators of gene transcription, not just deacetylases (Verdin et al. 2003). As previous results show that knocking down of the relevant class IIa HDACs is sufficient to restore the gonadotropin β genes expression (Lim et al. 2007), they are believed to play crucial roles in regulating these genes. Compared to class I HDACs, class IIa HDACs are much more regulated; this may happen at different levels of their expression, protein-protein interaction and sub-cellular localization. All class IIa HDACs shuttle between the nucleus and cytoplasm (Grozinger and Schreiber 2000; Mckinsey et al. 2000a; Mckinsey et al. 2000b; Dressel et al. 2001; Kao et al. 2001; Miska et al. 2001; Zhao et al. 2001), and their translocation may due to specific modification, such as phosphorylation, ubiquitination or sumoylation (De Ruijter et al. 2003; Verdin et al. 2003; Yang and Gregoire 2005). Although post-translational modification by SUMO has diverse effects on transcription factor activity, in most cases SUMOylation has been found to inhibit transcription (Gill 2003; Verger et al. 2003). Removal of SUMO by over-expression of a de-SUMOylating enzyme, such as SENP1 (sentrin-specific protease 1) has been reported to increase activity of dozens of transcription factors, including androgen receptor (AR), the CAAT/Enhancer-binding (C/EBP) proteins, Elk-1, Sp3 and Smad4 (Poukka et al. 2000; 71 Kim et al. 2002; Ross et al. 2002; Sapetschnig et al. 2002; Subramanian et al. 2003; Yang et al. 2003; Long et al. 2004). In the αT3-1 cells, over-expressing SENP1 was also found to increase transcript level of both the LH and FSHβ genes, especially for FSHβ. This indicates the involvement of SUMOylation in repression of the gonadotropin βsubunit gene expression, though the target of SUMOylation and how it facilitates the repression is still unclear. According to previous findings, SENP1’s ability to enhance AR-dependent transcription is not mediated through de-SUMOylation of AR, but rather through its ability to de-conjugate HDAC1, reducing its deacetylase activity (Cheng et al. 2004). This may be relevant also in the repression of the gonadotropin β gene expression, because HDAC1 has also been found in the repressive complex associated with the LHβ promoter. The repressive ability of HDAC4 has also been reported to be regulated by SUMO modification, probably through regulating its nuclear localization (Kirsh et al. 2002). Interestingly, in the current study, another class IIa HDAC, HDAC5 was found as two forms in the αT3-1 cells, one appearing 30 kD bigger than that of the expected size. Though HDAC5 has been reported to have two isoforms with the difference of 85 amino acids (Nagase et al. 1998; Grozinger et al. 1999), the possibility that the larger form is due to SUMOylation was considered. Since NEM treatment has been reported to be necessary to detect SUMO-modified proteins (Kuo et al. 2005), it was added during cell lysing to verify the putative SUMOylation of HDAC5. However, two forms of HDAC5 were still detected from cell lysate without NEM, which lends weight to the possibility that the larger HDAC5 might be a HDAC5 isoform, rather than SUMO modification. 72 Even though SUMOylation of HDAC5 has not been detected directly, sub-cellular distribution of the wild-type HDAC5 was found to be SUMO-dependent. At basal level, wild-type HDAC5 is mostly localized in the nucleus, but its level in the nucleus decreased obviously following SENP1 over-expression. This indicates the involvement of SUMO modification in HDAC5 nuclear sequestration. In fact, a short peptide that contains the ψKxE motif and a nuclear localization signal (NLS) suffices to produce a SUMO conjugate in vivo (Rodriguez et al. 2001), and numerous substrates, such as SP100, HDAC4, MDM2 fail to be modified by SUMO after their NLS are mutated. Given the present knowledge of the three types of SUMO E3 ligases, a two-step model has been proposed to elucidate the relationship between SUMOylation and translocation (Seeler and Dejean 2003). According to this, a substrate with a NLS can be SUMOlated by the E3 ligase activity of RanBP2 which is placed in the nuclear pore complex (NPC), during nuclear import and then either de-modified by a Ulp1-type SUMO protease and/or re-modified, under the control of a PIAS or Pc2 E3 ligase in the nucleus (Figure 25). Therefore, SUMO modification of these transcription factors may not trigger their nuclear translocation, but might occur as they pass the nuclear pore and facilitate their sequestration in the nucleus. This would clearly be the prerequisite for the recruitment of the class IIa HDACs into the repressive complex, to repress the expression of gonadotropin β genes. 73 Figure 25: SUMOylation and nuclear import. According to this model a substrate that contains a nuclear localization signal (NLS) might be sumoylated at the nuclear pore by the E3 ligase activity of RanBP2, after which it might be de-modified by a Ulp1-type SUMO protease that resides at the nucleoplasmic face of the nuclear pore complex (NPC), or by a Ulp2-type, nucleoplasmic protease. Once inside the nucleus, substrates might undergo SUMO modification that is mediated by PIAS or Pc2 E3 ligases. NE, nuclear envelope; Pc2, Polycomb protein 2; PIAS, protein inhibitors of activated STAT; RanBP2, Ran-binding protein 2. Adapted from Seeler and Dejean, 2003. 74 Previous findings indicate the nuclear export of both HDAC4 and HDAC5 following GnRH treatment in αT3-1 cells, which is further confirmed by the current western assay after GnRH treatment, showing the level of the wild-type HDAC5 decreased in the nucleus while the level clearly increased in the cytoplasm. Since both GnRH treatment and over-expressing SENP1 show the same nuclear export of wild-type HDAC5, it is possible that SENP1-induced de-SUMOylation may be employed by the GnRH-activated pathway. HDAC4 has been shown previously to translocate from the nucleus following the activation of calcium/calmodulin-dependent protein kinase (CaMK) signaling which facilitates HDAC4 binding by 14-3-3 protein (Wang et al. 2000; Mckinsey et al. 2001). Interestingly moreover, expression of CaMKI together with HDAC4 and SUMO-1 considerably reduced the pool of SUMOylated protein (Kirsh et al. 2002), though it still can not be excluded that CaMKI affects SUMOylation of HDAC4 by mechanisms distinct from its nuclear export-facilitating capacity. The C-terminal region of SENP1 is composed of the catalytic core domain of SENP1, containing two NLSs and one nuclear export signal (NES), while de-SUMOylation of HIPK2, (homeodomain-interacting protein kinase 2) is enhanced either by the forced translocation of SENP1 into the nucleus or by the SENP1 NES mutant (Kim et al. 2005). It is therefore possible that deSUMOylation of HDAC4 by activating CaMKI is through its regulation on the nuclear localization of SENP1. Given that GnRH treatment is able to activate CaMKI in αT3-1 cells (Lim et al. 2007), together with the current results, it is suggested that GnRH stimulation activates CaMKI in a synchronized or sequential manner, to phosphorylate or to de-SUMOylate class IIa HDACs, exporting them from the nucleus, resulting in the disruption of the repressive complex (Figure 26). 75 At the basal level, wild-type HDAC5 is also detected in the cytoplasm at a very low level, but following SENP1 over-expression, cytoplasmic wild-type HDAC5 cannot be detected. Considering that SUMOylation is thought to be largely a nuclear process, it is surprising to find that the cytoplasmic localization of the wild-type HDAC5 is SUMOdependent. GnRH treatment is able to increase the amount of wild-type HDAC5 in the cytoplasm, however, after combining GnRH treatment and SENP1 over-expression, no wild-type HDAC5 was detected in the cytoplasm. Whether the exported wild-type HDAC5 and possibly also HDAC4, need to be re-tagged with SUMO when leaving the nucleus to stabilize their cytoplasmic localization, and how this occurs, needs to be further investigated. In summary, findings from the current study support a scenario in which expression of the FSH β-subunit gene is repressed in immature gonadotropes by the actions of two repressive complexes, containing distinct repressive factors. GnRH stimulation is able to overcome this HDAC-mediated repression, involving activation of CaMKI, phosphorylation and/or de-SUMOylation of class IIa HDACs causing their nuclear export. Removal of class IIa HDACs results in the disruption of the repressive complexes, facilitating the binding of the transcription complex and histone acetyltransferases (HATs) to initiate the transcription of the FSHβ gene (Figure 26). Reproductive development and fucnction rely on the precisely regulated circulating levels of the pituitary gonadotropins, LH and FSH. Although they are produced during fetal development, their synthesis is repressed soon after birth until their re-activation by 76 GnRH stimulation at puberty. The molecular mechanisms involved in repressing the gonadotropin genes during reproductively inactive stages have not previously been described. Findings from the current study on the repressive complexes at both gonadotropin β gene promoters and their disruption following GnRH, form a basis to understand how GnRH is able to de-repress these genes. 77 GnRH Gαq PLCβ Ca2+ calmodulin SENP1 ? HDAC3 P CaMKI SUMO HDAC4 HDAC2 Sin3A Repressor SENP1 HDAC3 Repressor X FSH 14-3-3 P SMRT HDAC4 HDAC4 ? HDAC2 HDAC4 SUMO SMRT Activator FSH Figure 26: Repressive complexes containing distinct HDACs repress expression of the gonadotropin β-subunit genes in αT3-1 cells, and this is overcome by GnRH treatment. Through CaMKI and/or de-SUMOylation pathways, GnRH stimulation is able to export HDAC4 from the nucleus, causing the disruption of the repressive complex and over-come HDAC-mediated repression of the FSHβ gene expression. 78 CHAPTER 5 REFERENCES Ahringer, J. (2000). "NuRD and SIN3 histone deacetylase complexes in development." Trends Genet 16(8): 351-6. Alarid, E.T., Windle, J.J., Whyte, D.B. and Mellon, P.L. (1996). "Immortalization of pituitary cells at discrete stages of development by directed oncogenesis in transgenic mice." Development 122(10): 3319-29. Bourne, G.A. (1988). "cAMP indirectly mediates the extracellular calcium independent release of LH." Mol Cell Endocrinol 58: 155-160. Bradford, M.M. (1976). "A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding." Anal Biochem 72: 248-54. Brown, P. and McNeilly, A.S. (1999). "Transcriptional regulation of pituitary gonadotrophin subunit genes." Rev. Reprod. 4: 117-124. Burger, L.L., Haisenleder, D.J., Dalkin, A.C. and Marshall, J.C. (2004). "Regulation of gonadotropin subunit gene transcription." J Mol Endocrinol 33(3): 559-84. Cheng, J., Wang, D., Wang, Z. and Yeh, E.T. (2004). "SENP1 enhances androgen receptor-dependent transcription through desumoylation of histone deacetylase 1." Mol Cell Biol 24(13): 6021-8. de Ruijter, A.J., van Gennip, A.H., Caron, H.N., Kemp, S. and van Kuilenburg, A.B. (2003). "Histone deacetylases (HDACs): characterization of the classical HDAC family." Biochem J 370(Pt 3): 737-49. Dobkin-Bekman, M., Naidich, M., Pawson, A.J., Millar, R.P., Seger, R. and Naor, Z. (2006). "Activation of mitogen-activated protein kinase (MAPK) by GnRH is cellcontext dependent." Mol Cell Endocrinol 252(1-2): 184-90. Downes, M., Ordentlich, P., Kao, H.Y., Alvarez, J.G. and Evans, R.M. (2000). "Identification of a nuclear domain with deacetylase activity." Proc Natl Acad Sci U S A 97(19): 10330-5. Dressel, U., Bailey, P.J., Wang, S.C., Downes, M., Evans, R.M. and Muscat, G.E. (2001). "A dynamic role for HDAC7 in MEF2-mediated muscle differentiation." J Biol Chem 276(20): 17007-13. 79 Fischle, W., Dequiedt, F., Hendzel, M.J., Guenther, M.G., Lazar, M.A., Voelter, W. and Verdin, E. (2002). "Enzymatic activity associated with class II HDACs is dependent on a multiprotein complex containing HDAC3 and SMRT/N-CoR." Mol Cell 9(1): 45-57. Fischle, W., Kiermer, V., Dequiedt, F. and Verdin, E. (2001). "The emerging role of class II histone deacetylases." Biochem Cell Biol 79(3): 337-48. Gao, Z., Chiao, P., Zhang, X., Zhang, X., Lazar, M.A., Seto, E., Young, H.A. and Ye, J. (2005). "Coactivators and corepressors of NF-kappaB in IkappaB alpha gene promoter." J Biol Chem 280(22): 21091-8. Garrel, G., McArdle, C.A., Hemmings, B.A. and Counis, R. (1997). "Gonadotropinreleasing hormone and pituitary adenylate cyclase-activating polypeptide affect levels of cyclic adenosine 3',5'-monophosphate-dependent protein kinase A (PKA) subunits in the clonal gonadotrope alphaT3-1 cells: evidence for cross-talk between PKA and protein kinase C pathways." Endocrinology 138(6): 2259-66. Gharib, S.D., Wierman, M.E., Shupnik, M.A. and Chin, W.W. (1990). "Molecular biology of the pituitary gonadotropins." Endocr Rev 11(1): 177-99. Gill, G. (2003). "Post-translational modification by the small ubiquitin-related modifier SUMO has big effects on transcription factor activity." Curr Opin Genet Dev 13(2): 10813. Gill, G. (2005). "Something about SUMO inhibits transcription." Curr Opin Genet Dev 15(5): 536-41. Graham, K.E., Nusser, K.D. and Low, M.J. (1999). "LbetaT2 gonadotroph cells secrete follicle stimulating hormone (FSH) in response to activin A." J Endocrinol 162: R1-5. Gregoire, S. and Yang, X.J. (2005). "Association with class IIa histone deacetylases upregulates the sumoylation of MEF2 transcription factors." Mol Cell Biol 25(6): 227387. Grosse, R., Schmid, A., Schoneberg, T., Herrlich, A., Muhn, P., Schultz, G. and Gudermann, T. (2000). "Gonadotropin-releasing hormone receptor initiates multiple signaling pathways by exclusively coupling to G(q/11) proteins." J Biol Chem 275(13): 9193-200. Grozinger, C.M., Hassig, C.A. and Schreiber, S.L. (1999). "Three proteins define a class of human histone deacetylases related to yeast Hda1p." Proc Natl Acad Sci U S A 96(9): 4868-73. Grozinger, C.M. and Schreiber, S.L. (2000). "Regulation of histone deacetylase 4 and 5 and transcriptional activity by 14-3-3-dependent cellular localization." Proc Natl Acad Sci U S A 97(14): 7835-40. 80 Grozinger, C.M. and Schreiber, S.L. (2002). "Deacetylase enzymes: biological functions and the use of small-molecule inhibitors." Chem Biol 9(1): 3-16. Grumbach, M.M.a.S., D. M. (2003). "Williams Textbook of Endocrinology." 10th Edition. Chapter 24, Saunders. Hong, S.H. and Privalsky, M.L. (2000). "The SMRT corepressor is regulated by a MEK1 kinase pathway: inhibition of corepressor function is associated with SMRT phosphorylation and nuclear export." Mol Cell Biol 20(17): 6612-25. Hsieh, K.P. and Martin, T.F. (1992). "Thyrotropin-releasing hormone and gonadotropinreleasing hormone receptors activate phospholipase C by coupling to the guanosine triphosphate-binding proteins Gq and G11." Mol Endocrinol 6: 1673-1681. Huang, E.Y., Zhang, J., Miska, E.A., Guenther, M.G., Kouzarides, T. and Lazar, M.A. (2000). "Nuclear receptor corepressors partner with class II histone deacetylases in a Sin3-independent repression pathway." Genes Dev 14(1): 45-54. Jacobson, G.W., Miyamoto, D.M. and Mai, S.H. (1979). "Rathke's pouch morphogenesis in the chick embryo." J. Exp. Zool. 207: 351-366. Jang, M.K., Goo, Y.H., Sohn, Y.C., Kim, Y.S., Lee, S.K., Kang, H., Cheong, J. and Lee, J.W. (2001). "Ca2+/calmodulin-dependent protein kinase IV stimulates nuclear factorkappa B transactivation via phosphorylation of the p65 subunit." J Biol Chem 276(23): 20005-10. Jepsen, K., Hermanson, O., Onami, T.M., Gleiberman, A.S., Lunyak, V., McEvilly, R.J., Kurokawa, R., Kumar, V., Liu, F., Seto, E., Hedrick, S.M., Mandel, G., Glass, C.K., Rose, D.W. and Rosenfeld, M.G. (2000). "Combinatorial roles of the nuclear receptor corepressor in transcription and development." Cell 102(6): 753-63. Jepsen, K. and Rosenfeld, M.G. (2002). "Biological roles and mechanistic actions of corepressor complexes." J Cell Sci 115(Pt 4): 689-98. Joshi, D., Lekhtman, I., Billiar, R.B. and Miller, M.M. (1993). "Gonadotropin hormonereleasing hormone induced luteinizing hormone responses in young and old female C57BL/6J mice." Proc Soc Exp Biol Med 204(2): 191-4. Junoy, B., Maccario, H., Mas, J.L., Enjalbert, A. and Drouva, S.V. (2002). "Proteasome implication in phorbol ester- and GnRH-induced selective down-regulation of PKC (alpha, epsilon, zeta) in alpha T(3)-1 and L beta T(2) gonadotrope cell lines." Endocrinology 143(4): 1386-403. Kaiser, U.B., Sabbagh, E., Katzenellenbogen, R.A., Conn, P.M. and Chin, W.W. (1995). "A mechanism for the differential regulation of gonadotropin subunit gene expression by gonadotropin-releasing hormone." Proc Natl Acad Sci U S A 92(26): 12280-4. 81 Kakar, S.S., Winters, S.J., Zacharias, W., Miller, D.M. and Flynn, S. (2003). "Identification of distinct gene expression profiles associated with treatment of LbetaT2 cells with gonadotropin-releasing hormone agonist using microarray analysis." Gene 308: 67-77. Kao, H.Y., Downes, M., Ordentlich, P. and Evans, R.M. (2000). "Isolation of a novel histone deacetylase reveals that class I and class II deacetylases promote SMRTmediated repression." Genes Dev 14(1): 55-66. Kao, H.Y., Verdel, A., Tsai, C.C., Simon, C., Juguilon, H. and Khochbin, S. (2001). "Mechanism for nucleocytoplasmic shuttling of histone deacetylase 7." J Biol Chem 276(50): 47496-507. Kato, Y., Imai, K., Sakai, T. and Inoue, K. (1989). "Simultaneous effect of gonadotropinreleasing hormone (GnRH) on the expression of two gonadotropin ?genes by passive immunization to GnRH." Mol. Cell. Endocrinol. 62: 47-53. Kerckaert, J.P., Deweindt, C., Tilly, H., Quief, S., Lecocq, G. and Bastard, C. (1993). "LAZ3, a novel zinc-finger encoding gene, is disrupted by recurring chromosome 3q27 translocations in human lymphomas." Nat Genet 5(1): 66-70. Khochbin, S., Verdel, A., Lemercier, C. and Seigneurin-Berny, D. (2001). "Functional significance of histone deacetylase diversity." Curr Opin Genet Dev 11(2): 162-6. Khochbin, S. and Wolffe, A.P. (1997). "The origin and utility of histone deacetylases." FEBS Lett 419(2-3): 157-60. Kim, J., Cantwell, C.A., Johnson, P.F., Pfarr, C.M. and Williams, S.C. (2002). "Transcriptional activity of CCAAT/enhancer-binding proteins is controlled by a conserved inhibitory domain that is a target for sumoylation." J Biol Chem 277(41): 38037-44. Kim, Y.H., Sung, K.S., Lee, S.J., Kim, Y.O., Choi, C.Y. and Kim, Y. (2005). "Desumoylation of homeodomain-interacting protein kinase 2 (HIPK2) through the cytoplasmic-nuclear shuttling of the SUMO-specific protease SENP1." FEBS Lett 579(27): 6272-8. Kirsh, O., Seeler, J.S., Pichler, A., Gast, A., Muller, S., Miska, E., Mathieu, M., HarelBellan, A., Kouzarides, T., Melchior, F. and Dejean, A. (2002). "The SUMO E3 ligase RanBP2 promotes modification of the HDAC4 deacetylase." EMBO J 21(11): 2682-91. Knoepfler, P.S. and Eisenman, R.N. (1999). "Sin meets NuRD and other tails of repression." Cell 99(5): 447-50. Kuo, H.Y., Chang, C.C., Jeng, J.C., Hu, H.M., Lin, D.Y., Maul, G.G., Kwok, R.P. and Shih, H.M. (2005). "SUMO modification negatively modulates the transcriptional 82 activity of CREB-binding protein via the recruitment of Daxx." Proc Natl Acad Sci U S A 102(47): 16973-8. Kuo, M.H. and Allis, C.D. (1998). "Roles of histone acetyltransferases and deacetylases in gene regulation." Bioessays 20(8): 615-26. Kurdistani, S.K., Tavazoie, S. and Grunstein, M. (2004). "Mapping global histone acetylation patterns to gene expression." Cell 117(6): 721-33. Laherty, C.D., Billin, A.N., Lavinsky, R.M., Yochum, G.S., Bush, A.C., Sun, J.M., Mullen, T.M., Davie, J.R., Rose, D.W., Glass, C.K., Rosenfeld, M.G., Ayer, D.E. and Eisenman, R.N. (1998). "SAP30, a component of the mSin3 corepressor complex involved in N-CoR-mediated repression by specific transcription factors." Mol Cell 2(1): 33-42. Lavinsky, R.M., Jepsen, K., Heinzel, T., Torchia, J., Mullen, T.M., Schiff, R., Del-Rio, A.L., Ricote, M., Ngo, S., Gemsch, J., Hilsenbeck, S.G., Osborne, C.K., Glass, C.K., Rosenfeld, M.G. and Rose, D.W. (1998). "Diverse signaling pathways modulate nuclear receptor recruitment of N-CoR and SMRT complexes." Proc Natl Acad Sci U S A 95(6): 2920-5. Li, J., Wang, J., Wang, J., Nawaz, Z., Liu, J.M., Qin, J. and Wong, J. (2000). "Both corepressor proteins SMRT and N-CoR exist in large protein complexes containing HDAC3." Embo J 19(16): 4342-50. Lim, S., Luo, M., Koh, M., Yang, M., Abdul Kadir, M.N., Tan, J., Ye, Z., Wang, W. and Melamed, P. (2007). "Distinct mechanisms involving diverse histone deacetylases repress expression of the two gonadotropin β -subunit genes in immature gonadotropes, and their actions are overcome by GnRH, (submitted)." Liu, F., Austin, D.A., Mellon, P.L., Olefsky, J.M. and Webster, N.J. (2002a). "GnRH activates ERK1/2 leading to the induction of c-fos and LHbeta protein expression in LbetaT2 cells." Mol Endocrinol 16(3): 419-34. Liu, F., Usui, I., Evans, L.G., Austin, D.A., Mellon, P.L., Olefsky, J.M. and Webster, N.J. (2002b). "Involvement of both G(q/11) and G(s) proteins in gonadotropin-releasing hormone receptor-mediated signaling in L beta T2 cells." J Biol Chem 277(35): 32099108. Lodish, H., Berk, A., Matsudaira, P., Kaiser, A., C., , Krieger, M. and Scott, P., M., (2004). Molecular Cell Biology. New York, W. H. Freeman and Company. Long, J., Wang, G., He, D. and Liu, F. (2004). "Repression of Smad4 transcriptional activity by SUMO modification." Biochem J 379(Pt 1): 23-9. 83 McKinsey, T.A., Zhang, C.L., Lu, J. and Olson, E.N. (2000a). "Signal-dependent nuclear export of a histone deacetylase regulates muscle differentiation." Nature 408(6808): 10611. McKinsey, T.A., Zhang, C.L. and Olson, E.N. (2000b). "Activation of the myocyte enhancer factor-2 transcription factor by calcium/calmodulin-dependent protein kinasestimulated binding of 14-3-3 to histone deacetylase 5." Proc Natl Acad Sci U S A 97(26): 14400-5. McKinsey, T.A., Zhang, C.L. and Olson, E.N. (2001). "Control of muscle development by dueling HATs and HDACs." Curr Opin Genet Dev 11(5): 497-504. Melamed, P., Kadir, M.N., Wijeweera, A. and Seah, S. (2006). "Transcription of gonadotropin beta subunit genes involves cross-talk between the transcription factors and co-regulators that mediate actions of the regulatory hormones." Mol Cell Endocrinol 252(1-2): 167-83. Metivier, R., Penot, G., Hubner, M.R., Reid, G., Brand, H., Kos, M. and Gannon, F. (2003). "Estrogen receptor-alpha directs ordered, cyclical, and combinatorial recruitment of cofactors on a natural target promoter." Cell 115(6): 751-63. Miska, E.A., Langley, E., Wolf, D., Karlsson, C., Pines, J. and Kouzarides, T. (2001). "Differential localization of HDAC4 orchestrates muscle differentiation." Nucleic Acids Res 29(16): 3439-47. Muslin, A.J. and Xing, H. (2000). "14-3-3 proteins: regulation of subcellular localization by molecular interference." Cell Signal 12(11-12): 703-9. Nagase, T., Ishikawa, K., Suyama, M., Kikuno, R., Hirosawa, M., Miyajima, N., Tanaka, A., Kotani, H., Nomura, N. and Ohara, O. (1998). "Prediction of the coding sequences of unidentified human genes. XII. The complete sequences of 100 new cDNA clones from brain which code for large proteins in vitro." DNA Res 5(6): 355-64. Nagy, L., Kao, H.Y., Chakravarti, D., Lin, R.J., Hassig, C.A., Ayer, D.E., Schreiber, S.L. and Evans, R.M. (1997). "Nuclear receptor repression mediated by a complex containing SMRT, mSin3A, and histone deacetylase." Cell 89(3): 373-80. Nathan, D., Sterner, D.E. and Berger, S.L. (2003). "Histone modifications: Now summoning sumoylation." Proc Natl Acad Sci U S A 100(23): 13118-20. Nussey, S.S. and Whitehead, S.A. (1999). "Endocrinology, an integrated approach." BIOS Scientific Publishers Ltd. Papavasiliou, S.S., Zmeili, S., Khoury, S., Landefeld, T.D., Chin, W.W. and Marshall, J.C. (1986). "Gonadotropin-releasing hormone differentially regulates expression of the 84 genes for luteinizing hormone a and ?subunits in male rats." Proc. Natl. Acad. Sci. USA. 83: 4026-4029. Pernasetti, F., Vasilyev, V.V., Rosenberg, S.B., Bailey, J.S., Huang, H.J., Miller, W.L. and Mellon, P.L. (2001). "Cell-specific transcriptional regulation of follicle-stimulating hormone-beta by activin and gonadotropin-releasing hormone in the LbetaT2 pituitary gonadotrope cell model." Endocrinology 142(6): 2284-95. Plant, T.M., Gay, V.L., Marshall, G.R. and Arslan, M. (1989). "Puberty in monkeys is triggered by chemical stimulation of the hypothalamus." Proc Natl Acad Sci U S A 86(7): 2506-10. Poukka, H., Karvonen, U., Janne, O.A. and Palvimo, J.J. (2000). "Covalent modification of the androgen receptor by small ubiquitin-like modifier 1 (SUMO-1)." Proc Natl Acad Sci U S A 97(26): 14145-50. Privalsky, M.L. (2004). "The role of corepressors in transcriptional regulation by nuclear hormone receptors." Annu Rev Physiol 66: 315-60. Rodriguez, M.S., Dargemont, C. and Hay, R.T. (2001). "SUMO-1 conjugation in vivo requires both a consensus modification motif and nuclear targeting." J Biol Chem 276(16): 12654-9. Ross, S., Best, J.L., Zon, L.I. and Gill, G. (2002). "SUMO-1 modification represses Sp3 transcriptional activation and modulates its subnuclear localization." Mol Cell 10(4): 831-42. Ruf, F., Fink, M.Y. and Sealfon, S.C. (2003). "Structure of the GnRH receptorstimulated signaling network: insights from genomics." Front Neuroendocrinol 24(3): 181-99. Ruf, F. and Sealfon, S.C. (2004). "Genomics view of gonadotrope signaling circuits." Trends Endocrinol Metab 15(7): 331-8. Sapetschnig, A., Rischitor, G., Braun, H., Doll, A., Schergaut, M., Melchior, F. and Suske, G. (2002). "Transcription factor Sp3 is silenced through SUMO modification by PIAS1." Embo J 21(19): 5206-15. Seeler, J.S. and Dejean, A. (2003). "Nuclear and unclear functions of SUMO." Nat Rev Mol Cell Biol 4(9): 690-9. Shacham, S., Cheifetz, M.N., Lewy, H., Ashkenazi, I.E., Becker, O.M., Seger, R. and Naor, Z. (1999). "Mechanism of GnRH receptor signaling: from the membrane to the nucleus." Ann Endocrinol (Paris) 60(2): 79-88. 85 Shacham, S., Topf, M., Avisar, N., Glaser, F., Marantz, Y., Bar-Haim, S., Noiman, S., Naor, Z. and Becker, O.M. (2001). "Modeling the 3D structure of GPCRs from sequence." Med Res Rev 21(5): 472-83. Shiio, Y. and Eisenman, R.N. (2003). "Histone sumoylation is associated with transcriptional repression." Proc Natl Acad Sci U S A 100(23): 13225-30. Shiio, Y., Rose, D.W., Aur, R., Donohoe, S., Aebersold, R. and Eisenman, R.N. (2006). "Identification and characterization of SAP25, a novel component of the mSin3 corepressor complex." Mol Cell Biol 26(4): 1386-97. Sif, S., Saurin, A.J., Imbalzano, A.N. and Kingston, R.E. (2001). "Purification and characterization of mSin3A-containing Brg1 and hBrm chromatin remodeling complexes." Genes Dev 15(5): 603-18. Subramanian, L., Benson, M.D. and Iniguez-Lluhi, J.A. (2003). "A synergy control motif within the attenuator domain of CCAAT/enhancer-binding protein alpha inhibits transcriptional synergy through its PIASy-enhanced modification by SUMO-1 or SUMO-3." J Biol Chem 278(11): 9134-41. Treier, M., Gleiberman, A.S., O'Connell, S.M., Szeto, D.P., McMahon, J.A., McMahon, A.P. and Rosenfeld, M.G. (1998). "Multistep signaling requirements for pituitary organogenesis in vivo." Genes Dev 12(11): 1691-704. Urnov, F.D., Yee, J., Sachs, L., Collingwood, T.N., Bauer, A., Beug, H., Shi, Y.B. and Wolffe, A.P. (2000). "Targeting of N-CoR and histone deacetylase 3 by the oncoprotein v-erbA yields a chromatin infrastructure-dependent transcriptional repression pathway." Embo J 19(15): 4074-90. Verdin, E., Dequiedt, F. and Kasler, H.G. (2003). "Class II histone deacetylases: versatile regulators." Trends Genet 19(5): 286-93. Verger, A., Perdomo, J. and Crossley, M. (2003). "Modification with SUMO. A role in transcriptional regulation." EMBO Rep 4(2): 137-42. Wang, A.H., Kruhlak, M.J., Wu, J., Bertos, N.R., Vezmar, M., Posner, B.I., Bazett-Jones, D.P. and Yang, X.J. (2000). "Regulation of histone deacetylase 4 by binding of 14-3-3 proteins." Mol Cell Biol 20(18): 6904-12. Wen, Y.D., Perissi, V., Staszewski, L.M., Yang, W.M., Krones, A., Glass, C.K., Rosenfeld, M.G. and Seto, E. (2000). "The histone deacetylase-3 complex contains nuclear receptor corepressors." Proc Natl Acad Sci U S A 97(13): 7202-7. Wildt, L., Marshall, G. and Knobil, E. (1980). "Experimental induction of puberty in the infantile female rhesus monkey." Science 207(4437): 1373-5. 86 Windle, J.J., Weiner, R.I. and Mellon, P.L. (1990). "Cell lines of the pituitary gonadotrope lineage derived by targeted oncogenesis in transgenic mice." Mol Endocrinol 4(4): 597-603. Wu, X., Li, H., Park, E.J. and Chen, J.D. (2001). "SMRTE inhibits MEF2C transcriptional activation by targeting HDAC4 and 5 to nuclear domains." J Biol Chem 276(26): 24177-85. Yang, S.H., Jaffray, E., Hay, R.T. and Sharrocks, A.D. (2003). "Dynamic interplay of the SUMO and ERK pathways in regulating Elk-1 transcriptional activity." Mol Cell 12(1): 63-74. Yang, X.J. and Gregoire, S. (2005). "Class II histone deacetylases: from sequence to function, regulation, and clinical implication." Mol Cell Biol 25(8): 2873-84. Zhao, X., Ito, A., Kane, C.D., Liao, T.S., Bolger, T.A., Lemrow, S.M., Means, A.R. and Yao, T.P. (2001). "The modular nature of histone deacetylase HDAC4 confers phosphorylation-dependent intracellular trafficking." J Biol Chem 276(37): 35042-8. Zheng, L., Stojilkovic, S.S., Hunyady, L., Krsmanovic, L.Z. and Catt, K.J. (1994). "Sequential activation of phospholipase-C and -D in agonist-stimulated gonadotrophs." Endocrinology 134(3): 1446-54. Zhou, X., Richon, V.M., Wang, A.H., Yang, X.J., Rifkind, R.A. and Marks, P.A. (2000). "Histone deacetylase 4 associates with extracellular signal-regulated kinases 1 and 2, and its cellular localization is regulated by oncogenic Ras." Proc Natl Acad Sci U S A 97(26): 14329-33. 87 [...]... PKC and ERK in response to GnRH stimulation (Burger et al 2004) 14 1. 3 Regulation of LH and FSH β genes through their transcriptional repression 1. 3 .1 Histone deacetylases (HDACs) repress gene expression Distinct sets of HDACs have been found to be associated with the LH or FSH β gene promoter, repressing the expression of both gonadotropin β-subunit genes, and GnRH was shown to overcome this repression. .. to interact directly with mSin3A, and SMRT is 22 Figure 9 Domains of the N-CoR and SMRT co-repressors The primary structure of the human N-CoR and murine SMRT α Codon numbering is indicated on top The locations of the repression domains (RD1 to RD4), the deacetylase activating domain (DAD), the conserved SANT motifs that include sites of histone interaction, and of the CoRNR box/nuclear receptor interaction... Activin α, GnRHr α, LH , FSH GnRHr FSH α, LH GnRHr LβT αT3 -1 Early gonadotrope Embryonic Day e 11. 5 LβT2 Fully differentiated gonadotrope e16.5 e17.5 Figure 11 The gonadotrope cell lines along the developmental cell lineages of the anterior pituitary The distinct stages of differentiation are represented by the immortalized pituitary cell lines created by target oncogenesis in transgenic mice In this study,... maintained by opposing activities of histone acetyltransferases and deacetylases Acetyl coenzyme A is the high-energy acetyl moiety donor for histone acetylation Histone acetyltransferases (HATs) transfer the acetyl moiety to the ε-NH3 group of internal lysine residues of histone N-terminal domains Reversal of this reaction is catalyzed by histone deacetylases (HDACs) (Kuo and Allis 19 98) b Histone. .. resulting in activation of transcription factors and rapid induction of early genes This figure illustrates the distributed and interconnected movement of information from the receptor to the genome (Ruf and Sealfon 2004) 13 Phospholipase Cβ is activated by Gq /11 proteins (Hsieh and Martin 19 92), leading to the hydrolysis of phosphatidylinositol 4, 5-bisphosphate to 1, 4,5 - inositol trisphosphate (IP3) and. .. for continued development and function of corpora lutea In males, LH acts upon the Leydig cell of the testis and stimulates testosterone production that promotes spermatogenesis and is responsible for the male secondary sexual characteristics 9 1. 2 Gonadotropin-releasing hormone (GnRH) regulates LH and FSH β-subunit synthesis 1. 2 .1 Basal expression of LH and FSH β-subunit genes During embryogenesis, a... Trichostatin A Ubc Ubiquitin conjugating 5 CHAPTER 1 1 .1 INTRODUCTION The gonadotropins: lutenizing hormone (LH) and follicle-stimulating hormone (FSH) The pituitary gland is a small gland located at the base of the brain, functionally linked to the hypothalamus It is divided into two lobes: the anterior or front lobe and the posterior or rear lobe (Figure 1) The anterior pituitary is composed of a number of. .. cascade involving multiple signaling pathways determines the transcription factor expression which initiates the basal expression of gonadotropin genes (Treier et al 19 98) The initiation of the gonadotrope cell lineage is characterized by expression of the α-subunit followed by the expression of LH and FSH β subunit transcripts after a further 5 - 6 days Transcription factors such as pituitary homeobox 1. .. gonadotrope cell lines were generated by targeted oncogenesis in transgenic mice The αT3 -1 cell line was isolated from the carcinoma developed in the embryos following expression of the oncogene driven by the gonadotropin α subunit gene promoter (Windle et al 19 90), and the LβT2 cell line was derived by a similar method, using the LH β subunit gene promoter (Alarid et al 19 96) The αT3 -1 cell line, which represents... hypothalamus, binds to GnRH receptors on the surface of the gonadotrope This leads to the synthesis and secretion of LH and FSH, which stimulate the production of steroid hormones Testosterone, estrogen and progesterone negatively or positively regulate the synthesis of the gonadotropins directly at the pituitary or indirectly by modulating GnRH secretion from the hypothalamus The gonadal peptides, inhibin, activin .. .DISTINCT HISTONE DEACETYLASES REPRESS EXPRESSION OF LH AND FSH β GENES IN THE IMMATURE GONADOTROPE αT3-1 CELLS AND THE REPRESSION IS REVERSED BY GNRH YANG MENG A THESIS SUBMITTED FOR THE. .. and/ or Sin3A comprise distinct repressive complexes at the LH and FSH β gene promoters, and that GnRH is able to disrupt the complex(es) through the removal of some of these proteins, resulting... HDACs and Sin3A from LH and/ or FSH β gene promoters, which results in the disruption of the repressive complex De -repression of the LH and FSH β genes after GnRH stimulation might be caused by class