Identification of polymorphisms in the nuclear receptors (PXR, CAR and HNF4X) genes in the local population

IDENTIFICATION OF POLYMORPHISMS IN THE NUCLEAR RECEPTORS (PXR, CAR AND HNF4α) GENES IN THE LOCAL POPULATION HOR SOK YING NATIONAL UNIVERSITY OF SINGAPORE 2007 ACKNOWLEDGEMENTS I would like to thank my supervisor, Dr Theresa Tan, for her invaluable ideas, suggestions and contributions for this project. Not to mention the countless amendments for both my manuscript and thesis. Thanks for being so understanding and patient with me all these years. I would like to thank HaoSheng, Li Yang, Weiqi, Bai Jing, Yang Fei, Jasmine, and Thomas for all the helps, suggestions and countless ideas for my project. For that and much, much more I am extremely grateful. Thanks for being such great friends. Most importantly, I would like to thank my husband, Dewayne, for being so supportive and encouraging throughout my course of study. A big “Thank You” for my parents and parents-in-law for all the help they have rendered to me. Great thanks also go to: Dr Goh Boon Cher and Dr Lee Soo Chin for their precious samples and suggestions; Lai San, for helping me with all the statistical analysis; Huiling and Jiayi, for helping me with BigDye sequencing; and Rex, for helping me with Pyrosequencing. I am also grateful to the followings for permission to reproduce copyright material: Elsevier Lippincott & Williams Wilkins The American Association for the Advancement of Science And lastly, I would like to thank Biomedical Research Council of Singapore (BMRC 01/1/26/18/060) for their generosity in supporting this work. i TABLE OF CONTENTS Acknowledgements…………………………………………………………………….. i Summary……………………………………………………………………………….. iv List of Tables…………………………………………………………………………... vi List of Figures………………………………………………………………………….. viii List of Abbreviations…………………………………………………………………... x 1. Introduction……………………………………………………………………. 1 1.1 Drug Metabolism and Disposition…………………………………………1 1.2 Cytochrome P450………………………………………………………….4 1.2.1 CYP3A…………………………………………………………….. 8 1.2.2 CYP3A4……………………………………………………………10 1.2.3 CYP3A5……………………………………………………………12 1.2.4 CYP3A7……………………………………………………………12 1.2.5 CYP3A43…………………………………………………………..13 1.3 Nuclear Receptor………………………………………………………….14 1.3.1 Pregnane X Receptor………………………………………………17 1.3.2 Constitutive Androstane Receptor…………………………………18 1.3.3 Hepatocyte Nuclear Receptor 4-alpha……………………………..19 1.4 Regulation of CYP3A4 Expression by PXR, CAR and HNF4α………….23 1.5 Docetaxel………………………………………………………………….26 1.5.1 2. Docetaxel Metabolism and Elimination Pathway…………………28 Objectives and Overview of the Study………………………………………...31 ii 3. Materials and Method…………………………………………………………..35 3.1 Materials…………………………………………………………………...35 3.2 Methods……………………………………………………………………36 4. 3.2.1 Study Population………………………………………………….. 36 3.2.2 Genotyping…………………………………………………………38 3.2.3 Alignment of Sequences……………………………………………46 3.2.4 Statistical Analysis………………………………………………… 47 Results…………………………………………………………………………..49 4.1 Screening of PXR, CAR and HNF4α Genes in Local Healthy Population...49 4.1.1 Amplification of Exons and Sequencing…………………………...49 4.1.2 Variants in the PXR, CAR and HNF4α Genes……………………...53 4.2 Screening of PXR, CAR and HNF4α Genes in the Breast Cancer Population………………………………………………………………….60 4.3 Comparing the Allele Frequencies between Local Healthy and Breast Cancer Population………………………………………………….63 4.4 Pharmacokinetics Correlations……………………………………….……64 5. Discussion……………………………………………………………………... 75 5.1 Exonic Variants in PXR, CAR and HNF4α genes…………………………76 5.2 PXR, CAR and HNF4α Genotypes and Docetaxel Pharmacokinetics…….79 6. Conclusion …………………………………………………………………….81 7. Publications…………………………………………………………………….82 8. References……………………………………………………………………...83 iii SUMMARY The nuclear receptor (NR) superfamily is a large class of pharmacologically important receptors that play vital roles in the defence mechanisms in the human body. It is responsible for protecting the body from a diverse array of harmful endogenous and exogenous toxins by modulating the expression of the genes involved in drug metabolism and disposition. The detoxifying and elimination of these toxins is mainly mediated by cytochrome P450 (CYP) enzymes, along with phase I and phase II drug metabolising enzymes, as well as drug transporters. Three closely related nuclear receptors, namely the pregnane X receptor (PXR), constitutive androstane receptor (CAR) and hepatocyte nuclear factor 4-alpha (HNF4α) have recently been identified as the master transcriptional regulators of CYPs expression. The human CYP3A sub-family collectively comprises the largest portion of CYP proteins expressed in the liver and they are involved in the metabolism of more than 60% of all currently prescribed drugs. CYP3A4, the most abundantly expressed CYP3A isoform, is considered as the main oxidase for these drugs in the liver. In recent years, much work had been carried out to identify single nucleotide polymorphisms (SNPs) in the three receptor genes (PXR, CAR and HNF4α) and to examine the significance of these SNPs in relation to CYPs expression in terms of drug disposition or responsiveness. It is hypothesized that genetic variation in these nuclear receptors may contribute to human inter-individual variation in drug metabolism and also drug-drug interactions. iv The first part of this study aims to identify SNPs in the exons of the PXR, CAR and HNF4α genes in the local healthy population. We identified a 5’ UTR variant for the PXR gene (- 24381 A > C), one variant for the CAR gene (Pro180Pro) and two coding variants for the HNF4α gene (Met49Val and Thr130Ile). The second part of this study was conducted to screen for SNPs in breast cancer patients administered with docetaxel in their chemotherapy treatment. The objective of the second study was to address the clinical significance of the SNPs identified in the receptor genes in relation to docetaxel kinetics. Docetaxel is an anti-cancer agent that is metabolised by CYP3A4. Thus, any SNPs in these receptor genes could possibly affect docetaxel clearance in the breast cancer patients. From our data, the same four variants were again identified in the breast cancer cohort. No additional SNP was observed. Statistically, no significant correlation was noted for the docetaxel clearance, body-surface-area normalised docetaxel clearance, area under curve and half-life for PXR, CAR and HNF4α genes. In conclusion, the SNPs identified in the PXR, CAR and HNF4α genes in this study appear not to have any significant contribution to the variability in docetaxel clearance among the breast cancer patients. v LIST OF TABLES Table 1 Summary of the major drug metabolising cytochrome P450 enzymes, their main tissue localisation and the anti-cancer agents which they metabolise……………………………………………………………. 6 Table 2 Summary of the tissue distribution and type of reactions catalyzed by some human cytochrome P450 enzymes involved in the maintenance of cellular homeostasis……………………………………………………. 7 Table 3 List of reagents needed for this study and the suppliers………………….. 35 Table 4 A set of PCR forward and reverse primers that were used to amplify each individual exonic region of the PXR gene…………………………. 40 Table 5 A set of PCR forward and reverse primers that were used to amplify each individual exonic region of the CAR gene……………………….… 41 Table 6 A set of PCR forward and reverse primers that were used to amplify each individual exonic region of the HNF4α gene……………………… 42 Table 7 Forward and reverse primers for pyrosequencing………………………. 45 Table 8 Polymorphisms identified in the PXR, CAR and HNF4α gene in the healthy control population (n = 287)…………………………………… 56 Table 9 Genotypic distribution and allele frequencies of PXR, CAR and HNF4α variants in healthy control………………………………... 57 Table 10 Comparison of SNP frequencies of PXR exon 1 variant……………… 58 vi Table 11 Comparison of SNP frequencies of CAR exon 5 variant……………… 58 Table 12 Comparison of SNP frequencies of HNF4α exon 1C variant…………. 59 Table 13 Comparison of SNP frequencies of HNF4α exon 4 variant……………59 Table 14 Genotypic distribution and allele frequencies of PXR, CAR and HNF4α variants in breast cancer patients (n = 101)……………….61 Table 15 Genotypic distribution and allele frequencies of PXR, CAR and HNF4α for the different ethnic groups in the breast cancer population (n = 101)………………………………………………….. 62 vii LIST OF FIGURES Figure 1 Pie chart illustrations of phase I and phase II drug metabolising enzymes……………………………………………………………….. 3 Figure 2 The schematic organization of the human CYP3A locus………………9 Figure 3 Transcription factor binding sites within the regulatory regions of human CYP3A4 gene……………………………………………….11 Figure 4 Structure of a typical nuclear receptor……………………………….. 15 Figure 5 The structure of HNF4α gene and its spliced isoforms……………… 22 Figure 6 An illustration of the effects of docetaxel in tumour cell……………. 27 Figure 7 Proposed metabolic pathways of docetaxel by CYP3A enzymes…... 30 Figure 8 A summary of the functions of PXR, CAR and HNF4α in drug detoxification and elimination………………………………………. 33 Figure 9 Flow chart showing the study approach to identify PXR, CAR and HNF4α SNPs in healthy subjects and breast cancer patients….. 34 Figure 10 The principle of Pyrosequencing……………………………………..44 Figure 11 PCR amplification of all nine PXR exons from patient genomic DNA……………………………………………………………….... 50 Figure 12 PCR amplification of all eight CAR exons from patient genomic DNA………………………………………………………………… 50 viii Figure 13 PCR amplification of all twelve HNF4α exons from patient genomic DNA…………………………………………….……….... 51 Figure 14 PCR amplification of PXR exon 1, CAR exon 5, HNF4α exon 1C and HNF4α exon 4 from patient genomic DNA using Pyrosequencing primers……….…………………………….……... 51 Figure 15 Electropherograms of PXR, CAR and HNF4α SNPs……….….….. 52 Figure 16 Docetaxel clearance (L/h/m2) against PXR exon 1, CAR exon 5, HNF4α exon 1C and HNF4α exon 4 genotypes...………... 66 Figure 17 BSA normalised docetaxel clearance (L/h/m2) against PXR exon 1, CAR exon 5, HNF4α exon 1C and HNF4α exon 4 genotypes…………………………………………………………... 68 Figure 18 Maximum concentration of docetaxel, Cmax, (mg/L) against PXR exon 1, CAR exon 5, HNF4α exon 1C and HNF4α exon 4 genotypes……………………………………………………………70 Figure 19 Area under curve, AUC, (mg/L*h) against PXR exon 1, CAR exon 5, HNF4α exon 1C and HNF4α exon 4 genotypes………..… 72 Figure 20 Half life, t1/2, (hours) against PXR exon 1, CAR exon 5, HNF4α exon 1C and HNF4α exon 4 genotypes…………………………… 74 ix LIST OF ABBREVIATIONS ADH Alcohol dehydrogenase AF-1 Activation function 1 AF-2 Activation function 2 ALDH Aldehyde dehydrogenase APS Adenosine 5’ phosphosulfate AUC Area under the concentration-time curve Bp Base pair CAR Constitutive androstane receptor CCD Charged coupled device CL Clearance CLEM Constitutive liver enhancer module Cmax Maximum concentration COMT Catechol O-methyl-transferase CRE cAMP response element CYP Cytochrome P450 CYPOR cytochrome P450 oxidoreduactase DBD DNA binding domain DME Drug metabolizing enzyme dNTP Deoxyribonucleotide triphosphate DPD Dihydropyrimidine dehydrogenase DR Direct repeat ER Everted repeat EST Expressed-Sequence Tag GRE Glucocorticoid responsive element GST Glutathione S-transferase HMT Histamine methyl-transferase HNF4α Hepatocyte nuclear factor 4- alpha HSP Heat shock protein Ile Isoleucine x IR Inverted repeat k Elimination rate constant LBD Ligand binding domain Met Methionine MDR Multidrug resistance MODY Maturity-onset diabetes in the young MRP Multidrug resistance associated protein NADPH Nicotinamide adenine dinucleotide NAT N-acetyl-transferase NHR Nuclear hormone receptor NQO1 NADH:quinone oxidoreductase or DT diaphorase NR Nuclear receptor NUMI National University Medical Institute OATP Organic anion transporter PAR Pregnane activated receptor PCN Pregnenolone 16α-carbonitrile PCR Polymerase chain reaction P-gp P-glycoprotein PPi pyrophosphate Pro Proline PXR Pregnane X-receptor RE Response element RORα Retinoic acid receptor alpha RXR Retinoid X receptor SAP Shrimp Alkaline Phosphatase SNP Single nucleotide polymorphism ST Sulfotransferase SULT Sulfotransferase SXR Steroid and xenobiotic receptor t1/2 Half life TAE Tris-Acetate-EDTA xi Thr Threonine TPMT Thiopurine methyl-transferase UGT Uridine 5’-triphosphate glucuronosyltransferases. USF-1 Upstream stimulatory factor 1 UTR Untranslated region Val Valine XREM Xenobiotic-responsive enhancer module xii 1. INTRODUCTION 1.1 Drug Metabolism and Disposition The body’s first line of defence against the accumulation of potential toxic endogenous and exogenous lipophilic compounds is the liver. This is the site where drugs and toxic xenobiotics are being transformed to less toxic water soluble metabolites that subsequently can be excreted out of the body. In multicellular organisms, two different defence mechanisms have evolved for this purpose, biotransformation and transport. Biotransformation and transport processes comprise three phases; phase I (functional reaction) and phase II (conjugative reaction) form the biotransformation or drug metabolism pathway while phase III forms the drug transportation and disposition pathway (Gibson and Skett, 2001). The phase I enzymes are responsible for primary modification of lipophilic compounds into more polar forms. Phase I reactions generally include oxidation, reduction, hydrolysis, hydration, dethioacetylation and isomerisation. On the other hand, Phase II reactions include glucuronidation, glycosidation, methylation, Nacetylation, sulfation, amino acid and glutathione conjugation. (Gibson and Skett, 2001; Handschin and Meyer, 2003) Phase II comes into play by acting on phase I metabolites or on the parent compounds to further convert or detoxify to inactive derivatives, which accounts for bulk of the excreted products. Thus, phase II 1 reactions are considered the true “detoxification” pathway. However, there are instances where phase II reactions lead to reactive metabolites. Phase III comprises the transport and elimination steps where the parent drug and its metabolites are exported out of the cell and eventually removed from the body through the bile or urine. Figure 1 illustrates the contribution of phase I and phase II enzymes to the metabolism of drugs. 2 Figure 1: Pie chart illustrations of phase I and phase II drug metabolising enzymes. The relative size of each section on the charts show the relative contribution of each phase I and phase II enzymes to drug metabolism. Phase I enzymes are responsible for modification of functional groups and phase II is involved in conjugation with endogenous substituents. ADH, alcohol dehydrogenase; ALDH, aldehyde dehydrogenase; CYP, cytochrome P450; DPD, dihydropyrimidine dehydrogenase; NQO1, NADH:quinone oxidoreductase or DT diaphorase; COMT, catechol O-methyl-transferase; GST, glutathione Stransferase; HMT, histamine methyl-transferase; NAT, N-acetyl-transferase; STs, sulfotransferase; TPMT, thiopurine methyl-transferase; UGTs, uridine 5’triphosphate glucuronosyltransferases. Adapted from Evans and Relling, 1999, with permission from The American Association for the Advancement of Science. 3 1.2 Cytochrome P450 Cytochrome P450 (CYPs) enzymes were first discovered in 1958 by Martin Klingenberg while studying the spectrophotometric properties of rat liver microsomal pigments. The name P450 was derived from the property of these pigments which has a maximum absorbance reading at 450nm (Hasler et al., 1999). CYPs constitute a superfamily of heme-thiolate containing proteins that belong to a group of enzymes involved in hepatic detoxification of endogenous and exogenous compounds (phase I enzymes). CYP, together with its reducing counterpart nicotinamide adenine dinucleotide (NADPH) - cytochrome P450 oxidoreductase (CYPOR), is able to catalyze mono-oxygenase reactions with lipophilic compounds by allowing the attachment of a hydroxyl group as a reactive group that can later be modified by phase II enzymes (Handschin and Meyer, 2003). CYPs play an important role in the maintenance of the human cellular homeostasis. Predominately express in the human liver, CYPs metabolize a wide spectrum of endogenous steroid hormones, bile acids, fatty acids and xenobiotic substrates such as drugs, carcinogens, food additives, pollutants and environmental chemicals. In human beings, there are 18 known CYP gene families and 43 subfamilies (Kretschmer and Baldwin, 2005; Nelson DR, 2003). Only three of these, CYP1, 4 CYP2 and CYP3, are actively involved in drugs and xenobiotics metabolism. Members of CYP1A, CYP2B, CYP2C and CYP3A gene subfamilies are highly inducible by a diverse array of xenobiotics (Handschin and Meyer; 2003). Besides being involved in drug metabolism, these CYPs also play an important role in cholesterol biosynthesis, vitamin D metabolism, bile acid metabolism, biosynthesis and catabolism of steroids (Pascussi et al., 2003; Nelson DR, 1999). In the CYP family, the major isoforms responsible for drug metabolism are CYP2C9, CYP2C19, CYP2D6 and CYP3A4 (Ingelman-Sundberg, 2004). Table 1 shows the main tissue localisation of these CYPs and their anti-cancer substrates (Ingelman-Sundberg, 2004; Van Schaik, 2005). Different forms of CYP are found to be expressed in intestine, lung and kidneys but the liver is the major site for CYP-mediated oxidative metabolism, with CYP3A family as the dominant class. In this study, the focus will be on the CYP3A sub-family members. This is because of their dominant role in drug metabolism in the liver, and their regulation by nuclear receptors. Table 2 shows the reactions catalysed by CYPs in humans and their tissue localization. 5 Cytochrome P450 Main Tissue Enzyme Localisation CYP2C9 CYP2C19 CYP2D6 Liver Liver Liver Anti-cancer Agent Cyclophosphamide Tamoxifen Ifosfamide Tegafur Thalidomide Ifosfamide Cyclophosphamide Tamoxifen Tamoxifen Gefitinib / Iressa CYP3A4 Liver Intestine Cyclophosphamide Imatinib / Gleevec Ifosfamide Irinotecan Docetaxel Paclitaxel / Taxol Etoposide Teniposide Flutamide Tamoxifen Gefitinib / Iressa Vinca-alkaloids Table 1: Summary of the major drug metabolising cytochrome P450 enzymes, their main tissue localisation and the anti-cancer agents which they metabolise. Adapted from Ingelman-Sundberg, 2004; Van Schaik, 2005. 6 Tissue Liver and Intestine Function (i) Bile acid formation (ii) Polyunsaturated fatty acid epoxidation (iii) Xenobiotic metabolism ► N- & O-dealkylations ► Alcohol oxidation ► Alkane & Arene oxygenation ► Aromatic hydroxylation Kidney (i) Omega hydroxylation of fatty acids Adrenal (i) 21-OH of Progesterone Placenta (i) 17α-OH of Pregnenolone Ovary (i) Aromatase Table 2: Summary of the tissue distribution and type of reactions catalyzed by some human cytochrome P450 enzymes involved in the maintenance of cellular homeostasis. Reactions include (a) synthesis and degradation of prostaglandins and other unsaturated fatty acids, (b) metabolism of cholesterol to bile acids and (c) metabolism of endogenous and exogenous compounds (Hasler et al., 1999) 7 1.2.1 CYP3A The human CYP3A sub-family is relatively small, comprising only four members; CYP3A4, CYP3A5, CYP3A7 and CYP3A43 which are mapped on human chromosomal position 7q21-q22.1 (Figure 2) (Gellner et al., 2001; Plant, 2007). CYP3As can be induced by a large array of compounds. These include naturally occurring and synthetic glucocorticoids, pregnane compounds such as pregnenolone 16α-carbonitrile (PCN) and macrolide antibiotics like rifampicin (Quattrochi and Guzelian, 2001). Inter-individual variability in induction of CYP3A activity by these compounds could be due to the genetic variation of CYP3A sub-family members or its transcription regulators. To date, the number of variants for CYP3A4, 3A5, 3A7 and 3A43 are 40, 24, 7 and 5 respectively. This information is published on the official allele nomenclature committee website (http:www.imm.ki.se/CYPalleles) (Plant, 2007). As the most abundantly expressed CYP3A isoform in the human liver and intestine, CYP3A4 is one of the best studied member of the CYP3A gene subfamily. CYP3A4 plays a crucial role in the metabolic elimination of a broad range of structurally diverse substrates and thus contributes critically to the first-pass and systemic metabolism in the human body. 8 CYP3A43 CYP3A4 CYP3A7 CYP3A5 Figure 2: The schematic organization of the human CYP3A locus. The assembled 231kb sequence contains the four CYP3A sub-family members, CYP3A4, CYP3A5, CYP3A7 and CYP3A43. This cluster is localised on chromosome 7q21-7q22.1 (Burk and Wojnowski, 2004; Finta and Zaphiropoulos, 2000). Both CYP3A4 and CYP3A5 genes contain 502 amino acids each and they have molecular weights of 57299 Dalton and 57109 Dalton respectively. CYP3A7 and CYP3A43 genes each contain 503 amino acids with molecular weights of 57526 Dalton and 57670 Dalton respectively. This information is published on http://www.genecards.org. 9 1.2.2 CYP3A4 CYP3A4 is most abundantly expressed in the liver and small intestine. Accounting for 30-40% of the total CYPs in the liver, CYP3A4 is considered as the main oxidase for xenobiotics in this organ. It is catalytically effective on cyclosporine, macrolide antibiotics, anti-cancer agents such as taxol and is responsible for the metabolism of more than 60% of the prescribed drugs marketed today (Hasler et al., 1999; Kretschmer and Baldwin, 2005; Plant, 2007). CYP3A4 is also expressed weakly in stomach, colon, lung and adrenal (Guengerich, 2005). Other than its own genetic variations that could possibly contribute to intervariation in drug metabolism, genetic variation in its regulatory transcriptional partners could also affect how efficiently the gene is transcribed and expressed. This would eventually have an impact on drug clearance processes, which is an important determinant of drugs efficacy and toxicity. In recent studies, pregnane X-receptor (PXR), constitutive androstane receptor (CAR) and hepatocyte nuclear factor 4- alpha (HNF4α) have been identified to serve key roles in regulating CYP3A4 transcription (Quattrochi and Guzelian, 2001; Burk and Wojnowski, 2004). This seems reasonable as PXR, CAR and HNF4α binding sites have been revealed in the CYP3A4 gene (Figure 3) and would be further discussed in Section 1.4 Thus, any variability in these transcriptional controls could also either upregulate or down-regulate CYP3A4 activity. 10 -11400 HNF 4 HNF 1 HNF 4 E-Box (USF1) E-Box (USF1) CRE (AP-1) E-Box (USF1) -10900 CLEM4 Region -7840 -7270 P/GRE HNF 4 RORα CAAT PXRE PXRE P/GRE XREM Region Figure 3: Transcription factor binding sites within the regulatory regions of human CYP3A4 gene. The two regulatory regions shown are CLEM4 and XREM that lies upstream of CYP3A4 promoter (Plant, 2007). HNF4α binding sites have been identified in both CLEM4 and XREM regions of CYP3A4 gene. PXR and CAR bind to the same binding site, PXRE, in the XREM region. 11 1.2.3 CYP3A5 CYP3A5 or H1p3 has approximately 85% sequence identity to CYP3A4. CYP3A5 is found to be expressed in liver, small intestine, kidney, lung, prostate and adrenal gland. CYP3A5 accounts for approximately 20% of total hepatic CYPs. Unlike CYP3A4, CYP3A5 is polymorphically expressed in fetal liver. The regulation and catalytic selectivity of CYP3A5 has also been documented. Comparison of the metabolic capabilities of the CYP3A isoforms for a series of CYP3A substrates (including midazolam, alprazolam, triazolam, clarithromycin, tamoxifen, testosterone, estradiol, diltiazem, nidefipine and 7-benzyloxy-4trifluoromethylcoumarin) showed that CYP3A5 generally has lower affinities for these substrates than CYP3A4 (Williams et al., 2002). In addition, the clearance values were also lower for most of the substances except for the clearance for 1’hydroxy midazolam. 1.2.4 CYP3A7 CYP3A7 was initially named as HFLa. It is the main CYP present in human fetal liver, when CYP3A4 is not expressed. CYP3A7 was believed to be significantly down regulated after birth, even though low levels of approximately less than 2% of the total CYPs in adult liver has been detected in some individuals (De Wildt et al., 1999; Guengerich, 2005). Other known expression sites include kidney, lung 12 and adrenal. Compared to other CYP3A members, less work has been done on CYP3A7 in relation to drug metabolism. However, it has been shown that CYP3A7 has a significantly weaker metabolic capacity (in terms of affinity and clearance) when compared to CYP3A4 (Williams et al., 2002). 1.2.5 CYP3A43 CYP3A43 was first characterized in 2001 by three groups and is found to be expressed in liver, kidney, pancreas and prostate (Domanski et al., 2001; Gellner et al., 2001; Westlind et al., 2001). The level of expression of CYP3A43 was considerably low in human liver, accounting for only approximately 0.1% of CYP3A isoforms (Guengerich, 2005). Since, the main site of drug metabolism in the human system is the liver, CYP3A43 is deemed to make little contribution to this aspect due to its low expression. 13 1.3 Nuclear Receptors Nuclear hormone receptors (NHRs) constitute a superfamily of ligand-dependent and ligand-independent transcription factors that govern important physiological processes such as development, homeostasis and disease. To date, more than 50 nuclear receptors have been identified in various species. They generally have two transcription activation function domains (AF-1 and AF-2) located at the amino and carboxyl termini respectively, a zinc finger DNA binding domain and a ligand binding domain as illustrated in Figure 4. NHRs are able to induce or regulate drug metabolism by binding to small lipophilic ligands. Following ligand binding and dimerization, they then bind to DNA element repeats of the nucleotide hexamers in different arrangements like the ones found in drugresponsive enhancers of CYPs. The hexamers can be arranged either as direct repeats (DR), everted repeats (ER) or inverted repeats (IR). Upon binding to a specific ligand, the receptor may undergo a conformational change that either facilitates the binding of co-activator proteins or interaction to fellow transcription factors which eventually regulates the transcriptional activity of the target gene. 14 N AF-1 DBD Hinge LBD AF-2 Figure 4: Structure of a typical nuclear receptor. Nuclear receptors share a common modular structure which consists of activation function 1 (AF-1) domain located at the amino-terminal and AF-2 domain at the carboxy-terminal. The DNA binding domain (DBD) is connected to the ligand binding domain (LBD) by a flexible hinge. Upon ligand binding to the LBD, AF-2 will undergo a conformational change that disrupts interaction with transcriptional co-repressors and allows the interaction with transcriptional co-activators. The activated nuclear receptor will then bind to the response elements on the regulatory regions of target genes and initiates transcription. 15 C NHRs are categorized into three main classes. Class I receptors bind to steroid hormones and in absence of ligand, these receptors are associated with molecular chaperones like heat shock proteins (HSPs). Class II receptors bind to thyroid hormone, vitamin D3, 9-cis-retinoic acid and trans-retinoic acid. Upon binding of ligands, class II receptors dimerizes with retinoid X receptor (RXR). In both cases, upon binding ligand binding, the receptors may undergo conformational changes that eventually cause the dissociation of co-repressors and binding of coactivators. Class III belongs to a group of receptors whose physiological ligands have not yet been identified (Handschin and Meyer, 2003; Pascussi et al., 2003) Over the past decades, some members of the NHR superfamily were termed ‘orphan’ receptors because at the time of their cloning, nothing was known about their physiological ligands or co-activators. Till now, the term remains for these receptors even though their ligands are now known. The first ‘orphan’ receptor was identified in 1988 and since then, the number of orphan receptors has increased tremendously (Wang and LeCluyse, 2003; Kliewer, 2005). Scientists are not only interested in researching on the novel physiological ligands of these orphan receptors but also the biological functions and signaling cascades that these receptors elicit. The next part of the introduction will focus on three members of the NHR superfamily (PXR, CAR and HNF4α) and their relationship with the CYP family. 16 1.3.1 Pregnane X Receptor The pregnane X receptor (PXR, NR1I2), also known as pregnane activated receptor (PAR) or the steroid and xenobiotic receptor (SXR), is a member of the NHR superfamily. The PXR gene is located on chromosome 3q12-q13.3 and consists of nine exons. The size of this gene is approximately 38kb. The length of the unprocessed precursor protein is 434 amino acid long and it has a molecular weight of 49762 Dalton (http://www.expasy.org/uniprot/O75469). PXR was first discovered in 1997 from a search performed on the Washington University Mouse Expressed-Sequence Tag (EST) database (Kliewer et al., 1998). It derived its name based on its activation by 21-carbon steroids (pregnanes), namely pregnenolone 16α-carbonitrile (PCN) (Willson and Kliewer, 2002; Kliewer, 2005) PXR coordinates the induction and regulation of phase I and II DMEs, and phase III drug transporters that accelerate systemic clearance upon drug exposure. Phase I enzymes that are regulated by PXR include CYP3As, CYP2Bs and CYP2Cs (Bertilsson et al., 1998; Blumberg et al., 1998; Kliewer et al.,1998; Lehmann et al., 1998). Phase II enzymes include uridine diphospho-glucuronosyltransferases 1A1 (UGT1A1), glutathione-S-transferase 1 (GST1) and sulfotransferase 2A1 (SULT 2A1), and phase III enzymes include drug efflux transporters such as multidrug resistance 1 (MDR1), multidrug resistance associated proteins 2, 3 and 4 (MRP2, MRP3 and MRP4) as well as uptake transporter like Na+-independent 17 organic anion transporter 2 (Oatp2) (Kretschmer and Baldwin, 2005; Lamba et al., 2005). PXR resides in the cytoplasm. Upon activation by ligand binding, PXR heterodimerised with RXR and subsequently binds to PXR response elements in the promoter region of target genes, such as the CYP3A genes. PXR, like its primary target CYP3A4, is expressed predominantly in the liver and to a lesser extent in the colon and small intestine (Blumberg et al., 1998; Kliewer et al., 1998; Lehmann et al., 1998; Lamba et al., 2005) 1.3.2 Constitutive Androstane Receptor The constitutive androstane receptor (CAR, NR1I3) was initially known as MB67. CAR regulates the drug metabolism and disposition pathway and the gene encoding for CAR is located on chromosome 1q23.3 and consists of 9 exons. The size of this gene is approximately 8.5kb. The length of the unprocessed precursor protein is 352 amino acid long and it has a molecular weight of 39942 Dalton (http://www.expasy.org/uniprot/Q14994). CAR was first identified in 1994 through screening of a cDNA library using a nuclear receptor DNA binding domain (DBD)-based oligonucleotide probe. It was originally known as constitutive activated receptor as it could transactivate target gene as a 18 heterodimerised complex with RXR in the absence of ligands (Wang and LeCluyse, 2003; Lamba et al., 2005) CAR, like PXR, is predominately expressed in liver and intestine, and regulates a variety of drug detoxifying genes (Pascussi et al., 2003). These include the CYP3As, CYP2Bs, CYP2Cs, UGT1A1, GST, SULT, MDR1, MRP2, MRP3 and MRP4 (Handschin and Meyer, 2003; Lamba et al., 2005). CAR resides in the cytoplasm and translocates into the nucleus upon binding to its ligand (Kawamoto et al., 1999; Savkur et al., 2003; Tirona and Kim, 2005). Interestingly, there are evidences that suggest ligand binding is not always necessary for CAR translocation (Goodwin and Moore, 2004). Thus, it appears that there might be some unidentified cellular signaling cascade regulations, crosstalk or feedback mechanisms that could trigger the translocation and activation of CAR. 1.3.3 Hepatocyte Nuclear Receptor 4-alpha Hepatocyte nuclear receptor 4-alpha (HNF4α, NR2A1) is a member of the NHR that was first identified in 1989 in crude rat liver nuclear extracts (Costa et al., 1989; Sladek et al., 1990). It plays important roles in metabolic processes in the liver and is involved in glucose homeostasis and insulin secretion in the pancreas. HNF4α also plays a critical role in development and cell differentiation (Odom et 19 al., 2004). HNF4α is highly expressed in liver, kidney and intestine and to a lesser extent in pancreas and stomach (Sladek and Seidel, 2001) This gene is localized on chromosome 20q12-q13.1 and consists of 10 exons. The size of this gene is approximately 75.6kb. The length of the unprocessed precursor protein is 474 amino acid long and it has a molecular weight of 52785 Dalton (http://www.expasy.org/uniprot/p41235). At least nine possible HNF4α isoforms can be generated through alternative promoters (P1 and P2) usage and splicing (Figure 5), although to date, only four have been detected in vivo. The P2 promoter lies at approximate 45.5kb upstream of P1 promoter. The different isoforms expression varies with development stages, differentiation and tissue origin. In adult liver and kidney, the expression of HNF4α is initiated mainly at the P1 promoter (Nakhei et al., 1998; Sladek and Seidel, 2001). It was also demonstrated that the HNF4α P1 promoter transcription site exhibits stronger transcriptional activity and recruits co-activators more efficiently as compared to the P2 promoter. This could be explained by the presence of the activation function domain AF-1 which is encoded by exon 1A proximal to P1 promoter initiation site. AF-1 plays a crucial role in HNF4α transcriptional potential and interaction with its co-activators (Green et al., 1998; Kistanova et al., 2001; Eeckhoute et al., 2001; Eeckhoute et al., 2003). HNF4α was originally known as an ‘orphan’ nuclear receptor as its physiological ligands were not identified. However, fatty acyl-CoA thioesters were recently 20 shown to be the natural putative ligand of HNF4α (Dhe-Paganon et al., 2002). Like PXR and CAR, HNF4α also plays a significant role in the regulation of CYPs. But unlike them, HNF4α is not associated with RXR and functions as homodimers that subsequently bind to specific DNA response elements. 21 Figure 5: The structure of HNF4α gene and its spliced isoforms. Adapted from Sladek and Seidel, 2001, with permission from Elsevier 22 1.4 Regulation of CYP3A Expression by PXR, CAR and HNF4α PXR and CAR are considered to be the master regulators of drug clearance in the body because of their close relationship with the key DMEs, CYP3A4 and CYP2B6. This was further supported by studies which show that PXR-RXRα and CAR-RXRα heterodimers are capable of binding to the proximal promoter region of the CYP3A4 gene and mediates PXR or CAR transactivation of the CYP3A4 promoter respectively (Bertilsson et al., 1998; Goodwin et al., 2002; Akiyama and Gonzalez, 2003). The activation of CYP3A4 promoter by the nuclear receptors heterodimer is dependent upon ligand binding leading to the binding of the nuclear receptors to the response elements (REs) in the 5’ flanking region of CYP3A4. Transactivation of CYP3A4 by PXR and CAR upon ligand activation is mediated by the “proximal ER6” element located at -153bp to -170bp, and by the DR3 motif at the distal xenobiotic-responsive enhancer module (XREM) (Goodwin et al., 2002) (Figure 3). It has also been shown that regulation by PXR and CAR extended well beyond the CYP3A4 gene. Together, PXR and CAR coregulate members of CYP2B, CYP2C, GST, SULT, MRP2 and UGT families (Kliewer et al., 2002). In 2004, a second enhancer module that confers constitutive activation of the CYP3A4 gene was identified by Matsumura’s group. It is known as the constitutive liver enhancer module (CLEM4) and is located between -11400bp and -10900bp upstream of CYP3A4 promoter (Figure 3). Because of the poor 23 sequence conservation of CLEM4 between the CYP3A gene members, CLEM4 appears to be specific for regulation of CYP3A4 expression (Matsumura et al., 2004; Plant, 2007). Beside PXR and CAR, HNF4α also emerges as one of the widely acting transcription factor in the liver. Not only does HNF4α regulates DMEs such as CYP3A4, CYP3A5, CYP2A6, CYP2B6, CYP2C9 and CYP2D6, it is also involved in transcriptional regulation of glucose, cholesterol, fatty acid, urea and bile acid metabolism (Akiyama and Gonzalez, 2003). In addition, mutations in human HNF4α gene is linked to maturity-onset diabetes in the young (MODY1) and is characterized by defective secretion of insulin by the pancreatic-β cells (Ryffel, 2001; Gupta et al., 2005). Most importantly, an HNF4α binding site was identified in both the PXR and CYP3A4 promoter region (Kamiya et al., 2003; Burk and Wojnowski, 2004). In addition, two other binding sites have been identified in the CYP3A4 gene, one within the CLEM4 region and the other within the XREM region (see Figure 3). The HNF4 binding site identified within the CLEM4 has been assessed and was found to be necessary for maximal enhancer activity (Plant, 2007). The HNF4α binding site (DR1) identified in the CYP3A4 XREM region lies between -7783bp and -7771bp, adjacent to the DR3 motif. In the studies done by Tirona et al (2003), it was demonstrated that the binding of HNF4α to DR1 can confers maximal PXR-mediated transcriptional activation. Similar to that observed for PXR, HNF4α was also able to augment the activation of the CYP3A4 promoter by CAR. 24 Other sources of evidence that support the importance of PXR, CAR and HNF4α as the regulators of CYP3A induction came from work in animal models. PXR and CAR null mice failed to induce CYP3A activity upon induction by respective agonists. HNF4α deficient fetal mice, too, demonstrated absence of CYP3A and PXR mRNAs. Reduced level CYP3A mRNA was also observed in adult mice with deleted hepatic Hnf4a gene (Honkakoski et al., 2003). Thus, it is now evident that HNF4α not only influences the basal activity of the CYP3A promoter, it is also necessary for maximal PXR- or CAR- mediated transcriptional activation. Hence, any sequence variations in the three nuclear receptors, PXR, CAR and HNF4α would likely contribute to altered induction of target DME genes such as CYP3A and this would eventually affects the systemic clearance of xenobiotics, homeostasis, development and disease. 25 1.5 Docetaxel Docetaxel [4 - acetoxy - 2α - benzoyloxy - 5β, 20 – epoxy - 1, 7β - 10β trihydroxy – 9 – oxotax – 11 - ene13α - y1 - (2R, 3S) – 3 – tert – butoxycarbonyl – amino – 2 - hydroxyphenylpropionate] or Taxotere®, RP56976, is a semisynthetic compound. It is modified from a non-toxic precursor, 10-deacetyl baccatin III, which is extracted from needles of the European yew tree (Taxus baccata L.). It is semi-synthetically prepared from 10-deacetyl baccatin III via a direct acylation at the C13 position and then esterified with a synthetic side chain (Shou et al., 1998; Clarke and Rivory, 1999). It has an anhydrous molecular weight of 807.9 or 861.9 in the trihydrate form. The chemical formula of docetaxel is C43H53NO14 (Clarke and Rivory, 1999). Docetaxel, a member of the taxane family, is a highly effective broad spectrum anticancer agent used in treatment of solid malignancies such as breast, ovarian, lung, head and neck cancers (Baker et al., 2006). Docetaxel acts as an anti-microtubule agent that stabilizes microtubulin assembly and inhibits depolymerisation, thereby disrupting the microtubule dynamic networks. This leads to a series of event including arrest in G2/M phase of the cell cycle and apoptosis. Docetaxel also inhibits angiogenesis, the process whereby tumors develop new capillary blood vessels (Herbst and Khuri, 2003). Figure 6 summarized the effects of docetaxel in tumour cell. 26 Docetaxel Inactive metabolites EFFLUX P-glycoprotein CYP3A4 Docetaxel β-tubulin Apoptosis G2/M Arrest TUMOR CELL Figure 6: An illustration of the effects of docetaxel on tumour cell. Docetaxel can be metabolised by CYP3A4 into inactive metabolites or export by Pglycoprotein (p-gp) as it is a substrate of this transporter. Docetaxel also acts as an anti-microtubule agent that stabilizes microtubulin assembly and inhibits depolymerisation. This could leads to a series of event including arrest in G2/M phase of the cell cycle and apoptosis. 27 1.5.1 Docetaxel Metabolism and Elimination Pathway Docetaxel is metabolized mainly by hepatic CYPs and eliminated through the bile. The CYP3A class of enzymes dominates at this tissue site, therefore, it is necessary to address the two important members that played a key role docetaxel metabolism; CYP3A4 and CYP3A5 (Shou et al., 1998; Baker et al., 2006). Of these two enzymes, CYP3A4 is considered the main enzyme in docetaxel metabolism (Marre et al., 1996; Hirth et al., 2000). Unlike CYP3A4, CYP3A5 is polymorphically expressed in some individuals, varying greatly by race and ethnic group. Even though, individuals with polymorphically expressed CYP3A5 isoform is capable of contributing approximately up to 50% of total hepatic CYPs or comparable level to CYP3A4, the latter is still the dominant contributor in docetaxel metabolism. It is believed that low expression of CYP3A4 in some adults is compensated by increased CYP3A5 polymorphic expression in these individuals. This suggests that individual difference in CYP3As expression may give rise to variability in docetaxel metabolism among individuals (Burk and Wojnowski, 2004; Vaclavikova et al., 2004). Docetaxel is metabolised by CYP3A4 to inactive metabolites (Figure 7). High CYP3A4 activity would, therefore, result in poor therapeutic outcome of the drug, while low CYP3A4 activity may cause toxicity in patients (Hirth et al., 2000; Goh et al., 2002; Rodriguez-Antona and Ingelman-Sundberg., 2006). 28 Besides individual variability in CYP3As expression, individual variability in nuclear receptor genes (PXR, CAR and HNF4α) that regulate CYP3As transcription is also a factor to take note of in docetaxel metabolism. Any sequence variation in these receptors would first affect the interaction between the receptors and ligand or CYP3As, followed by changes in the transcription activity. This cascade of reactions, in turn, may alter docetaxel metabolism by these CYP3As. A combination of factors such as genetic variation of CYP3A4 regulatory genes (PXR, CAR and HNF4α) and CYP3A4 genotypes may influence the outcome of chemotherapy treatment in cancer patients. Docetaxel metabolism involves the initial hydroxylation of the methyl of the tertbutyl ester group on the side chain that generates a primary alcohol metabolite; evident of CYPs metabolism. A subsequent oxidation of a putative aldehyde yields two diastereomeric hydroxyl-oxazolidinones after cyclization (Figure 7) (Shou et al., 1998; Baker et al., 2006). These non-cytotoxic inactive derivatives are then disposed off in faeces and urine. Cellular efflux of the metabolites is facilitated by intestinal efflux transporter P-glycoprotein (P-gp) (Baker et al., 2006). It was also documented that docetaxel is also a substrate for P-gp but rather than being transport-dependent, CYP3A metabolism is the prominent elimination route for docetaxel. This was supported by observations whereby mice lacking the ABCB1 gene (also known as MDR1) that encodes P-gp have similar drug clearance as wild type mice (Baker et al., 2006). However, MDR1 29 expression could be regulated by PXR and this may also influence docetaxel elimination. Hydroxy - DOC CYP3A4 CYP3A5 CYP3A4 Aldehyde - DOC Docetaxel (DOC) R- and S- Hydroxyoxazolidinones Figure 7: Proposed metabolic pathways of docetaxel by CYP3A enzymes. Adapted from Shou et al., 1998, with permission from Lippincott & Williams Wilkins. 30 2. OBJECTIVES AND OVERVIEW OF THE STUDY Drug metabolism and disposition is an important physiological process. With the daily exposure to exogenous chemicals or ‘xenobiotic’, such as food additives, pesticides, insecticides and pollutants either indigested in the diet or absorbed through the skin or lungs, the detoxification and elimination system forms a crucial surveillance role in the human body. Human CYP3A4 is a major CYP enzyme that is present abundantly in human liver and it influences the inter-individual variability of drug response and drugdrug interaction in the human system. As mentioned in the previous chapter, nuclear receptors and transcription factors may be the important determinants of CYP3A4 transcriptional activation and regulation (Figure 8). In recent years, it has been acknowledged that genetic polymorphisms contribute to great alteration in terms of drug disposition or responsiveness. A large number of single nucleotide polymorphisms (SNPs) in the three genes (PXR, CAR and HNF4α) have been identified and reported in many populations such as African Americans, European and Asian like the Japanese. However, this has not been done in the local population. Therefore, it would be of great interest to determine the SNPs in PXR, CAR and HNF4α genes in the local population and to establish the importance (if any) of the identified SNPs as potential determinant of altered drug disposition profiles. 31 Singapore is a multiethnic country comprising of three major ethnic groups – Chinese, Malay and Indian. This study was carried out firstly to determine the polymorphisms in the coding regions of PXR, CAR and HNF4α genes in the three ethnic groups in normal control populations. After the screening for SNPs in the nuclear receptor genes of the ethnic groups, this study was taken further to screen for the SNPs in breast cancer patients treated with docetaxel. In vitro studies have demonstrated that CYP3A4 is the main enzyme involved in docetaxel metabolism (Marre F et al., 1996; Hirth et al., 2000). As mentioned earlier, CYP3A4 is transcriptional regulated by PXR, CAR and HNF4α (Figure 8), therefore, any SNPs in these receptor genes could possibly contribute to variability in docetaxel response and clearance in the cancer patients. The purpose of the second part of this study was thus to explore the role of PXR, CAR and HNF4α polymorphisms in the variability of docetaxel pharmacokinetics in the local population. An illustration of the study approach is shown in Figure 9. 32 HNF4α PXR/CAR RXR CYP3A4 Drug Enzyme CYP3A4 CLEM4 / XREM Nucleus Drug OH Drug UGT SULT GST MDR1 CONJUGATE Cytoplasm Drug MRP2 Drug Elimination /or Clearance Figure 8: A summary of the functions of PXR, CAR and HNF4α in drug detoxification and elimination. The nuclear receptors are activated by endogenous or exogenous drugs and bind to the consensus sequences on the CLEM4 or XREM regions of the CYP3A4 gene. Together with the other phase I and II enzymes, the activated CYP3A4 will then “detoxify” the drugs. The toxicants and the metabolites are then eliminated by phase III transporters. 33 Extraction of patient genomic DNA A B Normal healthy subjects Breast cancer patients PCR Amplification of individual exons from PXR, CAR and HNF4α genes BigDye V3.1 Sequencing Alignment of Sequences Breast cancer population only Pyrosequencing for identified SNPs in PXR, CAR and HNF4α genes. Statistical analysis Figure 9: Flow chart showing the study approach to identify PXR, CAR and HNF4α SNPs in healthy subjects and breast cancer patients. Screening of SNPs by BigDye V3.1 sequencing was first conducted in normal healthy subjects. Any identified SNPs by BigDye technique was confirmed by pyrosequencing. In the second part of the study, screening of SNPs was done for the breast cancer population in the same manner. Statistical analysis and data correlation (drug clearance) for the different genotype groups for the identified variants were conducted for the breast cancer population only. 34 3. MATERIALS AND METHOD 3.1 Materials The reagents needed for this study and the suppliers are listed in Table 3. Reagent Company Adriamycin Aventis Pharma BV, Hoevelaken, Netherlands Agarose BioRad BigDye Terminator V3.1 Applied Biosystems Inc Deoxyribonucleotide triphosphate New England Biolabs, Inc (dNTP) Docetaxel Aventis Pharma BV, Hoevelaken, Netherlands DyNazyme DNA polymerase Finnzymes, Finland Ethidium bromide BioRad Exonuclease I GE Healthcare, US Gentra DNA Purification Kit Gentra Systems, Inc, Minneapolis, Minn Hi-Di Formamide Applied Biosystems Inc Magnetic beads Amersham Pharmacia Biotech, Uppsala, Sweden PCR primers Proligo Singapore Pte Ltd Pyro sequencing primers Proligo Singapore Pte Ltd Shrimp Alkaline Phosphatase GE Healthcare, US TAE Buffer National University Medical Institute (NUMI) 100bp DNA Ladder BioRad Table 3: List of reagents needed for this study and the suppliers. 35 3.2 Methods 3.2.1 Study Population In this study, two groups of subjects were recruited. In the first group, a total of 287 healthy subjects were screened for SNPs in the PXR, CAR and HNF4α genes. The healthy population consisted of 103 Chineses, 111 Malays and 73 Indians. In the second group, the study population comprised of 101 female patients with histologically or cytologically proven locally advanced or metastatic breast cancer who were receiving primary systemic chemotherapy. The breast cancer population consisted of 66 Chineses, 26 Malays, 7 Indians and 2 others. Subjects were randomized to receive one of two alternating sequences of adriamycin (A) and docetaxel (T), starting either with adriamycin 75mg/m2 as a slow bolus or docetaxel 75mg/m2 infused over one hour, every 3 weeks for 6 cycles (T→A→T→A→T→A or A→T→A→T→A→T). Plasma samples were obtained from each subject when they received their first cycle of docetaxel or adriamycin (Taxotere; Aventis Pharma BV, Hoevelaken, The Netherlands) for measurement of drug concentrations at the following time points. Time points for docetaxel: pre-dose, 1 hour, 2 hours, 4 hours, 7 hours, 10 hours, and 24 hours; and for adriamycin: pre-dose, 1 hour, 2 hours, 6 hours, 8 hours, 12 hours and 24 hours, following drug administration. Docetaxel concentrations were measured using an isocratic liquid chromatography/tandem mass spectrometry (LC/MS/MS) method as described previously (Guitton et al., 2005). Non-compartmental analysis for docetaxel was performed using Kinetica 4.4 (InnaPhase Corp., Philadelphia, PA), 36 and area under the concentration-time curve (AUC) was estimated using the loglinear trapezoidal option from time 0 to infinity. The study protocol was approved by the Institutional Ethics Committee (DSRB, National University Hospital) and written informed consent was obtained from all patients according to institutional and governmental guidelines. 37 3.2.2 Genotyping DNA extraction and amplification 10ml of whole blood was collected from each subject, and genomic DNA was extracted from peripheral mononuclear cells using the Gentra DNA Purification Kit. The extraction was carried out according to the manufacturer’s protocol. Each exon from the PXR, the CAR or the HNF4α gene was amplified by polymerase chain reaction (PCR). The PCR reaction contained 100ng of genomic DNA, 0.5U of DyNAzyme DNA polymerase, 0.2 mM dNTP and 0.4 μM each of forward and reverse primers. The sequences of the PXR, CAR and HNF4α PCR primers are listed in Table 4, Table 5 and Table 6 respectively. PCR was performed using the Eppendorf Mastercycler (Eppendorf, USA), with an initial denaturing step at 920C to 950C for 2 minutes, followed by 30 to 35 cycles of denaturing at 92 to 950C for 90 seconds, annealing at 55.50C to 670C for 30 seconds, and extension at 720C for 1 minute. A final 10 minutes extension step at 720C was then carried out. 8μl of the PCR product was resolved by 1% ethidium bromide stained agarose gel electrophoresis. The size of the product was determined by comparing it against the 100bp DNA marker. The remaining PCR products were stored at -200C till required. 38 DNA Sequencing 1μl of amplified PCR products were treated with 2.5U of Exonuclease (Exo) I and 0.5U of Shrimp Alkaline Phosphatase (SAP) for 30 minutes at 370C to remove unincorporated nucleotides and primers. The reaction was stopped by heating at 800C for 15 minutes. Treated PCR products were then sequenced using BigDye® Terminator v3.1 Cycle Sequencing Kit. The 20μl sequencing reaction mixture consisted of 4μl of Exo-SAP treated DNA template, 1 μl of BigDye, 3.5μl of the sequencing buffer, 1μl (10μM appropriate primer (forward or reverse primer) and 10.5 μl of water. The reaction was allowed to proceed in the Eppendorf Mastercycler (Eppendorf, USA) for 25 cycles. Each cycle consists of a denaturation step at 960C for 30 seconds, annealing at 500C for 5 seconds, and extension at 600C for 4 minute. 3μl of 3M sodium acetate and 50μl of absolute ethanol were used to precipitate the extended DNA for an hour at 200C. The sample was centrifuged at 12,000 rpm for 30 minutes. The pellet was then rinsed with 50μl of 70% ethanol and centrifuged for 10 minutes at 12,000 rpm. The air dried pellet was dissolved in 13μl of Hi-Di Formamide and run on the ABI 3100 automated Sequence Analyzer (Applied Biosystems Inc), with the forward PCR primer and the reverse PCR primer. Any variants identified were confirmed by sequencing both the sense and the anti-sense strands as well as by pyrosequencing. Pyrosequencing was done to reassure that the variants identified were true and to re-confirm the alleles (homozygous or heterozygous) by comparing it against the classical Big Dye electropherogram. 39 40 TCTGGGATATAAATGGCTCCC GGCAGAGATTACCGACTCC ACTGGGGAACTGCCTAGCTT GGAGGGTCTTCTGACACCAA AGCCACCTGTGGATGGTAAC GGCAAAGACAAGCTCAGTCC CCCCTGTTTGCTTGTGTTTT CATAGACCCCAGATGGCCTA AACAATTCCAACCCCCATTC ACTCCCACCTACACCCTTCC AGGGGAGAATTGCTTGTCAC CAAGCAGGGATGTGTGTGAC GGTTGTGAGGGGAGAGATGA CTGCAGTTATGGGAGGAAGG TATGGCCTTGCTCCTCATTC AAGCCTTGTCTCTTGGCTGA PXR Exon 2 PXR Exon 3 PXR Exon 4 PXR Exon 5 PXR Exon 6 PXR Exon 7 PXR Exon 8 PXR Exon 9 92 92 92 92 92 92 94 92 92 Denaturing (0C) 61.8 61.8 64.2 64.2 60.5 64.2 61.8 61.8 60.5 Annealing (0C) Table 4: A set of PCR forward and reverse primers that were used to amplify each individual exonic region of the PXR gene. The respective forward or reverse primer was later used in BigDye V3.1 sequencing of the PCR products. CAACATTAAGTGATTGTTTTCATGC 5’ to 3’ 5’ to 3’ CCCTTTTCCTGTGTTTTTG Reverse Sequence Forward Sequence PXR Exon 1 Primer 41 GTGGGAGAGCTAGATCATGAG GAACATTAGCTAGAGGCTCTGG GCCTGTACTTCAGAGATGGAG GGAAGGACAAGTTGGGTGGC GGAAGGACAAGTTGGGTGGC GCCTCTGAGCTACTACTTTGC CATTGCAACCACTGGGCTCC GCTTTCTGGAGTGATCCTGTG CAGGTTGGTGGAAGTGTATAGG GCACCGACAGGATTTGGGTTG CACCTGAGGTCAGTAGTTGG GATGGTGCTAGAGCAATAGGG CACCTCTGCCCAAATACTCAG GAGCATGGTGAGAGAAGACAG CAR Exon 3 CAR Exon 4 CAR Exon 5 CAR Exon 6 CAR Exon 7 CAR Exon 8 CAR Exon 9 92 94 94 94 94 94 94 94 Denaturing (0C) 67.0 62.8 62.8 66.7 62.8 62.8 62.8 66.7 Annealing (0C) Table 5: A set of PCR forward and reverse primers that were used to amplify each individual exonic region of the CAR gene. The respective forward or reverse primer is later used in BigDye V3.1 sequencing of the PCR products. CAAGATGTAGGATGCCAGCC 5’ to 3’ 5’ to 3’ GTAGTCCCTGCTACTCAGG Reverse Sequence Forward Sequence CAR Exon 2 Primer 42 GCAGCCTCATACTGGCTGAG CCTTGCCGTCTCTCTGAACC CCTTGAAGGCCCTGAAGGGC CCCTCTTCTCAGCCATTAGCC CTCGGAGCTGAGCTGATCGC CTGGATAGTAGCTATGTGACC CCAGGGATAACCCTGATCGTGC CGCCCGGCCATATTGTCTC CACTTAGAACAGTGACTGGC CCTCATCCAGTGGATTGCC GGTGAAGGTGAAGGCAGTGGC CCTGCTGTGTATATATGCAG GGCGTGGAGGCAGGGAGAAT GTCAGGAGGTCACTGAGTGG CACCTTTCCAGCTCCTGGTGG CCCACTCCTCATCAGTCACAG CCCTCCGTTTTTACCCTGAGC CATCAGGCACACAGAAGAGGC GCAGTGCAGTTCCAGAATCTG CTGCCTGTGTCTAGGAAATC GATGGGAATGGTACACCCTAG GCTTTATGATCTGGGACTCACAG HNF4α Exon 1B HNF4α Exon 1C HNF4α Exon 2 HNF4α Exon 3 HNF4α Exon 4 HNF4α Exon 5 HNF4α Exon 6 HNF4α Exon 7 HNF4α Exon 8 HNF4α Exon 9 HNF4α Exon 10 92 92 92 92 92 94 92 92 92 94 92 94 Denaturing (0C) 63.1 58.0 58.0 58.0 63.1 66.4 58.7 63.1 65.0 66.1 55.5 66.1 Annealing (0C) Table 6: A set of PCR forward and reverse primers that were used to amplify each individual exonic region of the HNF4α gene. The respective forward or reverse primer is later used in BigDye V3.1 sequencing of the PCR products. CCTTGCCGTCTCTCTGAACC 5’ to 3’ 5’ to 3’ GGCGTGGAGGCAGGGAGAAT Reverse Sequence Forward Sequence HNF4α Exon 1A Primer Pyrosequencing The pyrosequencing PCR reactions were performed using the Eppendorf Mastercycler (Eppendorf, US) in a total reaction volume of 30μl with 0.5U of DyNAzyme DNA polymerase, 0.2 mM dNTP and 0.4 μM each of forward and reverse primers listed in Table 7. For primers that required biotin labelling (PXR exon 1 reverse primer, CAR exon 5 forward primer and HNF4α Exon 4 forward primer), a ratio of 1:9 part (10μM) primer to universal primer stocks were made prior to use. PCR was carried out with an initial denaturing step at 950C for 4 minutes, followed by 39 cycles of denaturing at 950C for 30 seconds, annealing at 600C for 30 seconds, and extension at 720C for 30 seconds, followed by a final 1 minute extension step at 720C. PCR products were incubated with 3µl of streptavidin magnetic beads and 1x binding buffer (10mM Tris–HCl, 2M NaCl, 1mM EDTA, 0.1% Tween 20) for 10 minutes at 37oC. This is followed by denaturing the product mix for 5 seconds in 0.2M NaOH solution. Washing was then carried out with annealing buffer (20mM Tris–acetate, 2mM magnesium acetate) for 10 seconds. The single-stranded products were then transferred to the annealing buffer containing 15pmol of the sequencing primer (see Table 7) and incubated for 2 minutes at 80oC in a Hybaid Maxi 14 hybridization oven (Thermo Electron, USA). Pyrosequencing was then performed on a PSQ96MA pyrosequencer (Biotage AB, Uppsala, Sweden). 43 [A] DNA Polymerase (DNA)n + dNTP [B] (DNA)n+1 + PPi Sulfurylase Light APS + PPi ATP Luciferin Oxyluciferin Time Luciferase ATP Light Figure 10: The principle of pyrosequencing. Pyrosequencing is sequencing by synthesis and used for accurate and quantitative analysis of DNA sequences. [a] The first step in Pyrosequencing involves the hybridisation of sequencing primer to a single stranded PCR amplified DNA template in which the reaction is incubated with DNA polymerase, ATP sulfurylase, luciferase and apyrase. The reaction mix is incubated with the substrates, adenosine 5’ phosphosulfate (APS) and luciferin. [b] The first of the four deoxynucleotide triphosphates (dNTP) is added to the reaction. DNA polymerase catalyses the incorporation of the dNTP into the DNA strands. Each incorporation of dNTP results in the release of pyrophosphate (PPi) in a quantity equimolar to the amount of incorporated nucleotide. ATP sulfurylase quantitatively converts PPi to ATP in the presence of APS. This ATP drives the luciferase-mediated conversion of luciferin to oxyluciferin that generates visible light in amounts that are proportional to the amount of ATP. This light is then detected by a charge coupled device (CCD) camera and recorded as a peak in a program. Each light signal is proportional to the number of nucleotides incorporated. (http://www.pyrosequencing.com) 44 Primer Primer Sequence 5’ to 3’ end PXR Exon 1 Forward CGGGAAGAGGAAGCACTG PXR Exon 1 Reverse* GGGACACCGCTGATCGTTTACCATACCTGCTTGGTGGTAAGT PXR Exon 1 Sequence GCTAATACTCCTGTCCTGAA HNF4α Exon 1C Forward* (Biotin) ATCACAGGCATTCTGGGTGAAG HNF4α Exon 1C Reverse TTGCCGTCTCTCTGAACCTAG HNF4α Exon 1C Sequence GGGGGAGCTCACCAT HNF4α Exon 4 Forward* GGGACACCGCTGATCGTTTAAATGAGCGGGACCGGATC HNF4α Exon 4 Reverse GGCAGGATCACCCCGGTAC HNF4α Exon 4 Sequence TCCTCATAGCTTGACCTT CAR Exon 5 Forward* GGGACACCGCTGATCGTTTACACACTTCGCAGACATCAACA CAR Exon 5 Reverse CGGGGTGGATATACAATTTACTG CAR Exon 5 Sequence GGTCACTCACCGGAA Universal Primer (Biotin) GGGACACCGCTGATCGTTTA Table 7: Forward and reverse primers for pyrosequencing. Primers with asterisk (*) mean they are biotinylated primers. All except HNF4α exon 1C were not pre-tagged with biotin during primer synthesis phase by Proligo Singapore Pte Ltd. HNF4α exon 1C and universal primer were tagged with biotin at primer synthesis phase. Universal primer is required to be added together with the non-tagged biotin primer prior to use. 45 3.2.3 Alignment of Sequences. The nucleotide sequences of PXR, HNF4α and CAR genes were retrieved from GenBank. The PXR gene (GenBank accession number: AF364606), located on chromosome 3q12-q13.3, consists of nine exons. Exon 2 to 9 contains the coding region and exon 1 contains the 5’ untranslated region (UTR). The CAR gene (GenBank accession number: Z30425), located on chromosome 1q23.1, consists of 9 exons. The coding region of CAR spans from exon 2 through exon 9. The HNF4α gene (GenBank accession number: U72959 to U72969), located on chromosome 20q12-q13.1, consist of 10 exons with 3 sub exon 1 (1A, 1B, 1C), all spanning the coding region (Ryffel, 2001). Sequence alignments were performed using the Multiple Sequence Alignment program by Florence Corpet (http://prodes.toulouse.inra.fr/multalin/multalin.html) (Corpet, 1988). 46 3.2.4 Statistical Analysis. Descriptive statistics were used to study the population distribution of docetaxel clearances. Analysis of genotypes with continuous pharmacokinetics parameters such as docetaxel clearances, body surface area normalized clearance (CL), maximum concentration (Cmax), area under the curve (AUC) and half life (t1/2) were performed using the student’s t-test or one-way ANOVA test as appropriate. All genetic variants were tested for departure from Hardy-Weinberg equilibrium for each ethnic group using Chi square test with one degree of freedom. All docetaxel kinetics data were provided by Dr Goh Boon Cher and Dr Lee Soo Chin, Department of Haematology-Oncology, National University Hospital, Singapore. Statistical analyses were performed using SPSS Version 11.5 (SPSS Inc, Chicago I11), with P ≤0.05 considered to be statistically significant. Derivation of area under curve (AUC) AUC (0 – infinity) = Dose / CL AUC is referred to as the area under the plasma (serum or blood) concentration versus time curve. It is most commonly derived by the trapezoidal method. For example, breaking up the areas in trapezoids (or segments), and making a summation of the areas of each trapezoid which can be calculated by multiplying the average concentration by the segment width. (http://www.boomer.org) 47 Derivation of clearance (CL) CL = Dose / AUC Clearance is describes how quickly drugs are eliminated, metabolised or distributed throughout the body. Clearance can be calculated by measuring the amount of drug eliminated during some time interval and the drug concentration. The total amount of drug that can be eliminated is the total amount administrated, that is the dose. (http://www.boomer.org) Derivation of half-life (t1/2) t1/2 = ln 2 / k or t1/2 = 0.693 / k The half-life is the time taken for the plasma concentration to fall to half its original value. k is the elimination rate constant describing removal of drug by all elimination processes. (http://www.boomer.org) The elimination rate constant can be calculated as follows: Elimination rate constant (k) = 1 / time 48 4. RESULTS The liver is the main organ for xenobiotic metabolism and the major CYP enzyme that is expressed in the liver is CYP3A4. The expression of CYP3A4 can be regulated by various nuclear receptors and transcription factors. These include PXR, CAR and HNF4α. In this study, the aim is to examine the polymorphisms in the genes encoding these receptors. The populations used in this study include firstly, healthy subjects (comprising of Chinese, Malays and Indians) and secondly, a cohort of breast cancer patients. 4.1 Screening of PXR, CAR and HNF4α Genes in Local Healthy Population 4.1.1 Amplification of Exons and Sequencing In the first part of this study, screening was carried out on all the exons of the PXR, CAR and HNF4α genes in 287 healthy subjects comprising of 103 Chinese, 111 Malays and 73 Indians. Amplification of the exons from genomic DNA was achieved by PCR and this was followed by sequencing (see Figure 11, 12 and 13). Sequencing was carried out for both the sense and anti-sense strand. Sequences from subjects that were homozygous and heterozygous were first identified via the electropherogram obtained through Big Dye sequencing (aligned against the wild type sequence) and then confirmed by pyrosequencing. Amplification of the individual SNP exon for pyrosequencing reaction (see Figure 14) was achieved by 49 PCR using the respective pyrosequencing primers (see Table 7). An example of the electropherogram showing the nucleotide changes for the three genes is shown in Figure 15. PXR Exon M 1 2 3 4 5 6 7 8 9 700 bp 600 bp 500 bp Figure 11: PCR amplification of all nine PXR exons from patient genomic DNA. The PCR product size are (a) exon 1, 635bp; (b) exon 2, 541bp; (c) exon 3, 518bp; (d) exon 4, 721bp; (e) exon 5, 649bp; (f) exon 6, 525bp; (g) exon 7, 526bp; (h) exon 8, 504bp; and (i) exon 9, 655bp. CAR Exon M 2 3 4 5 6 7 8 9 800 bp 700 bp 600 bp 500 bp 400 bp Figure 12: PCR amplification of all eight CAR exons from patient genomic DNA. The coding region in the CAR gene begins at exon 2 and ends at exon 9. The PCR product size are (a) exon 2, 558bp; (b) exon 3, 512bp; (c) exon 4, 582bp; (d) exon 5, 545bp; (e) exon 6, 803bp; (f) exon 7, 387bp; (g) exon 8, 525bp; and (h) exon 9, 453bp. 50 HNF4α Exon M 1A 1B 1C 2 3 4 5 6 7 8 9 10 800 bp 700 bp 600 bp 500 bp Figure 13: PCR amplification of all twelve HNF4α exons from patient genomic DNA. The PCR product size are (a) exon 1A, 537bp; (b) exon 1B, 399bp; (c) exon 1C, 537bp; (d) exon 2, 444bp; (e) exon 3, 389bp; (f) exon 4, 474bp; (g) exon 5, 612bp; (h) exon 6, 624bp; (i) exon 7, 676bp; (j) exon 8, 649bp; (k) exon 9, 551bp; and (l) exon 10, 613bp. M a b c d 500 bp 300 bp 200 bp 100 bp Figure 14: PCR amplification of PXR exon 1, CAR exon 5, HNF4α exon 1C and HNF4α exon 4 from patient genomic DNA using pyrosequencing primers. The PCR products were used for pyrosequencing reaction. The PCR products are (a) PXR exon 1, 225bp; (b) CAR exon 5, 135bp; (c) HNF4α exon 1C, 229bp; and (d) HNF4α exon 4, 118bp. 51 [A] [B] PXR exon 1 A > C (- 24381 A > C) [C] CAR exon 5 C > T (Pro180Pro) [D] HNF4α exon 1C A>G (Met49Val) HNF4α exon 4 C>T (Thr130Ilel) Figure 15: Electropherograms of PXR, CAR and HNF4α SNPs. Arrows indicate the variant nucleotide positions. 52 4.1.2 Variants in the PXR, CAR and HNF4α Genes The variants that were observed in the local population include the A>C at -24381 for the PXR gene, the C>T at the codon 180 for the CAR gene, the A>G and C>T at the codon 49 and codon 130 for the HNF4α gene respectively (Table 8). These had all been previously reported in other studies (Moller et al., 1997; Price et al., 2000; Rissanen et al., 2000; Sakurai et al., 2000; Zhang et al., 2001; Ikeda et al., 2003; Pruhova et al., 2003; Lamba et al., 2005; Ek et al., 2005; Bosch et al., 2006). The CAR variant is a silent coding region variant (Pro180Pro). This proline residue is located in the ligand-binding domain of the receptor (Lamba et al., 2005). The PXR variant is a 5’UTR variant. Both the HNF4α variants are nonsynonymous coding region variants; Met49Val and Thr130Ile in exon 1C and exon 4 respectively. The HNF4α Met49Val and Thr130Ile variants are located in the N-terminal functional domain and the DNA binding domain of the receptor, respectively (Hadzopoulou-Cladaras et al., 1997; Jiang and Sladek, 1997; Jakob et al., 2005). The genotypic distribution and allele frequencies of PXR, CAR and HNF4α polymorphic variants in different ethnic groups shown in Table 9. The allele frequencies for the three genes were similar for the Chinese and Malay ethnic groups. However, for the Indian subjects, the distribution was different with the exception of the frequencies for the HNF4α exon 4 variant, Thr130Ile. No homozygous was observed for HNF4α Thr130Ile in all the three ethnic groups. 53 Heterozygous for HNF4α Thr130Ile reported in this study was rare with frequency of ≤ 0.05. A comparison of what was obtained for our subjects was also carried out with those previously described for other population (Moller et al., 1997; Price et al., 2000; Rissanen et al., 2000; Sakurai et al., 2000; Zhang et al., 2001; Ikeda et al., 2003; Pruhova et al., 2003; Lamba et al., 2005; Ek et al., 2005; Bosch et al., 2006). The results of this comparison are shown in Table 10, Table 11, Table 12 and Table 13. In general, what we had observed in our three ethnic groups were different from these population with a few exceptions. The allele frequencies for the Indian and Dutch population for the PXR variant were similar while the Caucasian, the Chinese and the Malay population showed that the wild-type occurs in about 60% of these populations. The reported value for the African American subjects was very much lower (Table 10). However, this value may not be accurate as the sample size was very small (n=20). It is of interest to note that for the HNF4α exon 4 variant, the wild type predominates in more than 95% of all populations (Table 13). In addition, no homozygous was detected for this variant. This may be due to the fact that this amino acid residue is located in the DNA binding domain and it may be critical for the function of this nuclear factor. The allele frequencies for the Chinese and Malay population for the CAR exon 5 variant were similar, reporting a low wild type frequency value of 0.18 compared to the Japanese population with almost half of the population having SNPs in this gene (Table 11). Our study reported similar HNF4α exon 1C allele frequencies 54 between the Chinese and Malay population (wild-type frequency = 0.28) and much lower for the Indian population (wild-type frequency = 0.12). The allele frequencies for all the three ethnic groups in this study were very different from those in reported population (Czech and Japanese). It is noted that the minor allele for the HNF4α exon 1C in all three ethnic groups in the local populations is actually the major allele in the Czech and Japanese populations (see Table 12). These differences may be attributed to genetic selection, dietary or environmental influences or to drug interactions. HNF4α exon 1C wild type predominates in more than 70% in both the Czech and Japanese population (see Table 12). The other known reported exonic or intronic SNPs beside the ones studied in this study are listed in following web links:- PXR gene http://www.ncbi.nlm.nih.gov/SNP/snp_ref.cgi?locusId=8856 CAR gene http://www.ncbi.nlm.nih.gov/SNP/snp_ref.cgi?locusId=9970 HNF4α gene http://www.ncbi.nlm.nih.gov/SNP/snp_ref.cgi?locusId=3172 55 Gene Location Nucleotide position Nucleotide Change Codon Change SNP Name PXR 5’ UTR -24381 A to C ------- rs1523127 CAR Exon 5 540 CCC to CCT Pro180Pro rs2307424 HNF4α Exon 1C 145 ATG to GTG Met49Val rs2071197 HNF4α Exon 4 389 ACT to ATT Thr130Ile rs1800961 Table 8: Polymorphisms identified in the PXR, CAR and HNF4α gene in the healthy control population (n = 287). In the screening of the breast cancer population (n = 101), the same set of four SNPs were identified in the three genes. No additional SNPs were found in the breast cancer population for all three genes. 56 Allele Frequency Location and Chinese Subjects (n = 103) Malay Subjects (n = 111) Indian Subjects (n = 73) PXR gene AA = 0.66 AA = 0.61 AA = 0.46 - 24381 A > C AC = 0.31 AC = 0.36 AC = 0.44 CC = 0.03 CC = 0.03 CC = 0.10 CAR gene CC = 0.18 CC = 0.18 CC = 0.23 Pro180Pro CT = 0.46 CT = 0.54 CT = 0.60 TT = 0.36 TT = 0.28 TT = 0.17 HNF4α gene AA = 0.28 AA = 0.28 AA = 0.12 Met49Val AG = 0.42 AG = 0.44 AG = 0.44 GG = 0.30 GG = 0.28 GG = 0.44 HNF4α gene CC = 0.95 CC = 0.98 CC = 0.95 Thr130Ile CT = 0.05 CT = 0.02 CT = 0.05 Designation Table 9: Genotypic distribution and allele frequencies of PXR, CAR and HNF4α variants in healthy control. PXR gene (- 24381 A > C): AA, AC and CC are wild type, heterozygous and homozygous respectively. CAR gene (Pro180Pro): CC, CT and TT are wild type, heterozygous and homozygous respectively. HNF4α gene (Met49Val): AA, AG and GG are wild type, heterozygous and homozygous respectively. HNF4α gene (Thr130Ile): CC and CT are wild type and heterozygous respectively. 57 Population Number of Subjects Allele Frequency Reference Singapore Chinese 103 0.66 / 0.34 ----- Singapore Malay 111 0.61 / 0.39 ----- Singapore Indian 73 0.46 / 0.54 ----- African American 20 0.27 / 0.73 Zhang et al., 2001 Caucasian 150 0.59 / 0.41 Zhang et al., 2001 Dutch 100 0.46 / 0.54 Bosch et al., 2006 Table 10: Comparison of SNP frequencies of PXR exon 1 variant. Study population include Singaporean (comprising of Chinese, Malays and Indians), African American, Caucasian and Dutch. Population Number of Subjects Allele Frequency Reference Singapore Chinese 103 0.18 / 0.82 ----- Singapore Malay 111 0.18 / 0.82 ----- Singapore Indian 73 0.23 / 0.77 ----- Japanese 253 0.48 / 0.52 Ikeda et al., 2003 Table 11: Comparison of SNP frequencies of CAR exon 5 variant. Study population include Singaporean (comprising of Chinese, Malays and Indians) and Japanese. 58 Population Number of Subjects Allele Frequency Reference Singapore Chinese 103 0.28 / 0.72 ----- Singapore Malay 111 0.28 / 0.72 ----- Singapore Indian 73 0.12 / 0.88 ----- Caucasian 100 0.08/ 0.92 Price et al., 2000 Czech 61 0.73 / 0.27 Pruhova et al., 2003 Japanese 100 0.95 / 0.05 Sakurai et al., 2000 Table 12: Comparison of SNP frequencies of HNF4α exon 1C variant. Study population include Singaporean (comprising of Chinese, Malays and Indians), Caucasian, Czech and Japanese. Population Number of Subjects Allele Frequency Reference Singapore Chinese 103 0.95 / 0.05 ----- Singapore Malay 111 0.98 / 0.02 ----- Singapore Indian 73 0.95 /0.05 ----- Caucasian 100 0.99 / 0.01 Price et al., 2000 Chinese 52 0.96 / 0.04 Rissanen et al., 2000 Czech 61 0.98 / 0.02 Pruhova et al., 2003 Danish 239 0.98 / 0.02 Moller et al., 1997 Danish 369 0.95 / 0.05 Moller et al., 1997 Danish 4726 0.97 / 0.03 Ek et al., 2005 Japanese 100 1.0 / 0 Sakurai et al., 2000 Swedish 666 0.95 / 0.05 Moller et al., 1997 Table 13: Comparison of SNP frequencies of HNF4α exon 4 variant. Study population include Singaporean (comprising of Chinese, Malays and Indians), Caucasian, Chinese, Czech, Danish, Japanese and Swedish. 59 4.2 Screening of PXR, CAR and HNF4α Genes in the Breast Cancer Population PXR, CAR and HNF4α are known to be master transcriptional regulators of CYP3A4 gene, which played an eminent role in drug metabolism. We postulated that any SNPs in these receptor genes could affect CYP3A4 gene transcription which may lead to possible variation in drug clearance in the patients. In the second part of this study, 111 female breast cancer patients were recruited and the exons of the PXR, CAR and HNF4α genes were analysed. This cohort included 66 Chinese, 26 Malays, 7 Indians and 2 of other ethnic origins. The mean age of the study population was 45.6 ± 12 years. The variants that were observed in the three genes studied were identical to those observed for the healthy local population (see Table 8 and Table 14). The genotypic distribution and frequency of PXR, CAR and HNF4α polymorphic variants for all 101 breast cancer patients are summarised in Table 14. Allele frequency of the four variants in the different ethnic groups is shown in Table 15. 60 Location and Designation Allele Frequency PXR gene AA = 0.60 -24381 A > C AC = 0.31 CC = 0.09 CAR gene CC = 0.26 Pro180Pro CT = 0.41 TT = 0.33 HNF4α gene AA = 0.24 Met49Val AG = 0.41 GG = 0.35 HNF4α gene CC = 0.98 Thr130Ile CT = 0.02 TT = 0 Table 14: Genotypic distribution and allele frequencies of PXR, CAR and HNF4α variants in breast cancer patients (n = 101). PXR gene (- 24381 A > C): AA, AC and CC are wild type, heterozygous and homozygous respectively. CAR gene (Pro180Pro): CC, CT and TT are wild type, heterozygous and homozygous respectively. HNF4α gene (Met49Val): AA, AG and GG are wild type, heterozygous and homozygous respectively. HNF4α gene (Thr130Ile): CC, CT and TT are wild type, homozygous and heterozygous respectively. 61 Allele Frequency Variant Chinese (n = 66) Malay (n = 26) Indian (n = 7) Others (n = 2) PXR gene AA = 0.56 AA = 0.77 AA = 0.29 AA = 1.00 - 24381 A > C AC = 0.36 AC = 0.19 AC = 0.29 AC = 0 CC = 0.08 CC = 0.04 CC = 0.42 CC = 0 CAR gene CC = 0.24 CC = 0.30 CC = 0.29 CC = 0 Pro180Pro CT = 0.48 CT = 0.35 CT = 0.14 CT = 0 TT = 0.28 TT = 0.35 TT = 0.57 TT = 1.00 HNF4α gene AA = 0.23 AA = 0.27 AA = 0 AA = 1.00 Met49Val AG = 0.38 AG = 0.46 AG = 0.71 AG = 0 GG = 0.39 GG = 0.27 GG = 0.29 GG = 0 HNF4α gene CC = 0.97 CC = 1.00 CC = 1.00 CC = 1.00 Thr130Ile CT = 0.03 CT = 0 CT = 0 CT = 0 TT = 0 TT = 0 TT = 0 TT = 0 Table 15: Genotypic distribution and allele frequencies of PXR, CAR and HNF4α for the different ethnic groups in the breast cancer population (n = 101). In the cohort of 101 patients, there are 66 Chinese, 26 Malays, 7 Indians and 2 of other ethnic origins. PXR gene (- 24381 A > C): AA, AC and CC are wild type, heterozygous and homozygous respectively. CAR gene (Pro180Pro): CC, CT and TT are wild type, heterozygous and homozygous respectively. HNF4α gene (Met49Val): AA, AG and GG are wild type, heterozygous and homozygous respectively. HNF4α gene (Thr130Ile): CC, CT and TT are wild type, homozygous and heterozygous respectively. 62 4.3 Comparing the Allele Frequencies between Local Healthy and Breast Cancer Population It was not appropriate to compare the allele frequencies between different ethnic groups of both healthy and breast cancer population as the sample size differs greatly. The sample size for Chinese (n = 66), Malay (n = 26) and Indian (n = 7) in the breast cancer cohort were too small to conduct a fair comparison against the healthy patient cohort. Therefore, we compared the allele frequency observed in the three ethnic groups for the local healthy population against the breast cancer population as a whole. The allele frequencies for the Chinese, Malay and breast cancer patients for the PXR variant were similar, showing that the wild-type occurs in about 60%. CAR exon 5 variant (Pro180Pro) and HNF4α exon 1C variant (Met49Val), too, showed similar allele frequencies distribution for the Chinese, Malay and breast cancer population. The only variant that displayed similar allele frequency across all the ethnic groups and the breast cancer population is HNF4α exon 4 variant (Thr130Ile). As discussed in previous section, HNF4α exon 4 wild-type predominates in more than 95% of all populations. This may be because this amino acid residue plays a crucial functional role for this nuclear factor. 63 4.4 Pharmacokinetics Correlations Following the sequencing and genotyping for the breast cancer population, statistical analysis test was carried out to determine if there were any correlations between drug clearance and individual genotype groups. Analysis was also done to determine whether the SNPs in the PXR, CAR and HNF4α genes affected the metabolism of docetaxel in these breast cancer patients. The correlation was done for only 97 subjects as 4 subjects dropped out in the midst of study. No significant correlations were observed between the genotypes and the docetaxel clearance; body surface area (BSA) normalized docetaxel clearance, Cmax, AUC or half-life (t1/2). The docetaxel clearances by PXR, CAR and HNF4α genotype are shown in Figure 16. BSA normalised docetaxel clearance, Cmax, AUC and half life by PXR, CAR and HNF4α genotype are also shown in Figure 17, Figure 18, Figure 19 and Figure 20, respectively. 64 120 2 Docetaxel Clearance (L/h/m ) A 100 80 60 40 20 0 AA AC CC PXR Exon 1 Genotype 120 2 Docetaxel Clearance (L/h/m ) B 100 80 60 40 20 0 CC CT TT CAR Exon 5 Genotype 65 2 Docetaxel Clearance (L/h/m ) C 120 100 80 60 40 20 0 AA AG GG 120 2 D Docetaxel Clearance (L/h/m ) HNF4α Exon 1C Genotype 100 80 60 40 20 0 CC CT HNF4α Exon 4 Genotype Figure 16: [A] Docetaxel clearance (L/h/m2) against PXR exon 1 genotype. AA, AC, and CC represent wild type, heterozygous and homozygous respectively. [B] Docetaxel clearance (L/h/m2) against CAR exon 5 genotype. CC, CT, and TT represent wild type, heterozygous and homozygous respectively. [C] Docetaxel clearance (L/h/m2) against HNF4α exon 1C genotype. AA, AG, and GG represent wild type, heterozygous and homozygous respectively. [D] Docetaxel clearance (L/h/m2) against HNF4α exon 4 genotype. CC and CT represent wild type and heterozygous respectively. The bar indicates the mean docetaxel clearance value. Statistical analysis result in p-values > 0.05. 66 B BSA Normalised Docetaxel Clearance 2 (L/h/m ) BSA Normalised Docetaxel Clearance (L/h/m2) A 70 60 50 40 30 20 10 0 AA CC AC CT CC PXR Exon 1 Genotype 70 60 50 40 30 20 10 0 TT CAR Exon 5 Genotype 67 BSA Normalised Docetaxel Clearance (L/h/m2) C 70 60 50 40 30 20 10 0 AA AG GG D BSA Normalised Docetaxel Clearance 2 (L/h/m ) HNF4α Exon 1C Genotype 70 60 50 40 30 20 10 0 CC CT HNF4α Exon 4 Genotype Figure 17: [A] BSA normalised docetaxel clearance (L/h/m2) against PXR exon 1 genotype. AA, AC, and CC represent wild type, heterozygous and homozygous respectively. [B] BSA normalised docetaxel clearance (L/h/m2) against CAR exon 5 genotype. CC, CT, and TT represent wild type, heterozygous and homozygous respectively. [C] BSA normalised docetaxel clearance (L/h/m2) against HNF4α exon 1C genotype. AA, AG, and GG represent wild type, heterozygous and homozygous respectively. [D] BSA normalised docetaxel clearance (L/h/m2) against HNF4α exon 4 genotype. CC and CT represent wild type and heterozygous respectively. The bar indicates the mean BSA normalised docetaxel clearance value. Statistical analysis result in pvalues > 0.05. 68 A 35 Cmax (mg/L) 30 25 20 15 10 5 0 AA AC CC PXR Exon 1 Genotype B 35 Cmax (mg/L) 30 25 20 15 10 5 0 CC CT TT CAR Exon 5 Genotype 69 C 35 Cmax (mg/L) 30 25 20 15 10 5 0 AA AG GG HNF4α Exon 1C Genotype D 35 Cmax (mg/L) 30 25 20 15 10 5 0 CC CT HNF4α Exon 4 Genotype Figure 18: [A] Maximum concentration of docetaxel, Cmax, (mg/L) against PXR Exon 1 genotype. AA, AC, and CC represent wild type, heterozygous and homozygous respectively. [B] Maximum concentration of docetaxel, Cmax, (mg/L) against CAR Exon 5 genotype. CC, CT, and TT represent wild type, heterozygous and homozygous respectively. [C] Maximum concentration of docetaxel, Cmax, (mg/L) against HNF4α exon 1C genotype. AA, AG, and GG represent wild type, heterozygous and homozygous respectively. [D] Maximum concentration of docetaxel, Cmax, (mg/L) against HNF4α exon 4 genotype. CC and CT represent wild type and heterozygous respectively. The bar indicates the mean Cmax value. Statistical analysis result in p-values > 0.05. 70 A 25 AUC (mg/L*h) 20 15 10 5 0 AA AC CC PXR Exon 1 Genotype B 25 AUC (mg/L*h) 20 15 10 5 0 CC CT TT CAR Exon 5 Genotype 71 C 25 AUC (mg/L*h) 20 15 10 5 0 AA AG GG HNF4α Exon 1C Genotype D 25 AUC (mg/L*h) 20 15 10 5 0 CC CT HNF4α Exon 4 Genotype Figure 19: [A] Area under curve, AUC, (mg/L*h) against PXR Exon 1 genotype. AA, AC, and CC represent wild type, heterozygous and homozygous respectively. [B] Area under curve, AUC, (mg/L*h) against CAR Exon 5 genotype. CC, CT, and TT represent wild type, heterozygous and homozygous respectively. [C] Area under curve, AUC, (mg/L*h) against HNF4α exon 1C genotype. AA, AG, and GG represent wild type, heterozygous and homozygous respectively. [D] Area under curve, (mg/L*h), against HNF4α exon 4 genotype. CC and CT represent wild type and heterozygous respectively. The bar indicates the mean AUC value. Statistical analysis result in p-values > 0.05. 72 A Half Life (Hours) 25 20 15 10 5 0 AA AC CC PXR Exon 1 Genotype B 25 Half Life (Hours) 20 15 10 5 0 CC CT TT CAR Exon 5 Genotype 73 C 25 Half Life (Hours) 20 15 10 5 0 AA AG GG HNF4α Exon 1C Genotype D 25 Half Life (Hours) 20 15 10 5 0 CC CT HNF4α Exon 4 Genotype Figure 20: [A] Half life, t1/2, (hours) against PXR Exon 1 genotype. AA, AC, and CC represent wild type, heterozygous and homozygous respectively. [B] Half life, t1/2, (hours) against CAR Exon 5 genotype. CC, CT, and TT represent wild type, heterozygous and homozygous respectively. [C] Half life, t1/2, (hours) against HNF4α exon 1C genotype. AA, AG, and GG represent wild type, heterozygous and homozygous respectively. [D] Half life, t1/2, (hours) against HNF4α exon 4 genotype. CC and CT represent wild type and heterozygous respectively. The bar indicates the mean t1/2 value. Statistical analysis result in p-values > 0.05. 74 5. DISCUSSION In recent years, drug therapy has placed its focus exclusively on factors determining systemic drug disposition (distribution and clearance). The application of pharmacogenetic approaches to optimize drug dosage and treatment regimes is critically important as it provides therapeutic control in the pharmacotherapy in individual patients (Brouwer and Pollack, 2002). The nuclear hormone receptors PXR, CAR and HNF4α play important roles as xenobiotic-sensing receptors, transcription enhancers and regulators that serve to regulate the expression of drug metabolizing enzymes and drug transporters. SNPs, insertions, deletions and microsatellite polymorphism in these three nuclear receptors may contribute to clinically significant variations in drug metabolizing enzyme activities, which may in turn have major effects on drug clearance, efficacy, and toxicity. As discussed earlier, the main drug metabolising CYP isoform is CYP3A4. There is considerable inter-individual variation in CYP3A4 activity and expression. Approximately 90% of these CYP3A4 variations were thought to be caused by genetic factors (Ingelman-Sundberg, 2004). From previous studies, the CYP3A4 variants identified are either rare among populations or occur with low allele frequencies (Dai et al., 2001; Hsieh et al., 2001; Lamba et al., 2002; Bosch et al., 2006; Du et al., 2006). This makes it difficult to relate CYP3A4 genotype to the pharmacokinetics and pharmacodynamics of CYP3A4 substrates (Bosch et al., 75 2006). Thus, it is necessary to examine the genes that regulate CYP3A4 transcription. Looking into the genetic variations of the regulatory genes such as PXR, CAR and HNF4α may help to explain any possible genetic basis for the inter-individual variability in the expression of CYP3A4 (Ingelman-Sundberg, 2004; Bosch et al., 2006). 5.1 Exonic Variants in PXR, CAR and HNF4α Genes We sequenced the human PXR, CAR and HNF4α genes and identified a total of four SNPs and determined their allelic frequencies in both the healthy control and breast cancer population. The four variants that were observed were: PXR 5’-UTR variant (-24381A>C), CAR (Pro180Pro), HNF4α (Met49Val) and HNF4α (Thr130Ile). For the PXR gene, the SNP that was observed was in the 5’UTR. Comparison of the three Singaporean ethnic groups with other populations (Table 10) showed that the allele frequencies for this variant were similar for the Chinese and Malay population. This is also similar to that reported in a study with Caucasian subject (Zhang et al., 2001). However, the local Indian population have a lower occurrence of the wild-type allele and shows similar occurrence as that of a Dutch study (Bosch et al., 2006). It is unclear what functional consequence this A>C change may have. It may be possible that this change which is not within the 76 open-reading frame of PXR may influence transcription initiation. Alternatively, it may also impact on translation of the PXR transcription by influencing ribosomal binding. The only CAR variant found in this study is a synonymous SNP in exon 5 (Pro180Pro). This proline residue is located within the ligand-binding domain. In all the three local ethnic groups, more than 45% of the population are heterozygous and the allele frequency is more than 0.75. In contrast, the frequency reported in for a Japanese study was 0.52 (Ikeda et al., 2003). What functional consequence this variant has is currently unclear. It may be that there is no functional consequence since this is a synonymous SNP and most variations in CAR function are associated with splice variants rather than coding region polymorphisms (Okey et al., 2005) Two non-synonymous SNPs in exon 1C (Met49Val) and exon 4 (Thr130Ile) were detected for the HNF4α gene, In the Singaporean population, the allele frequency for Met49Val is very different from that of Czech and Japanese population (Table 12). The variant predominates at a much higher frequency than that previously reported. The Met49Val variant is located in the N-terminal functional domain AF-1, also referred to as the A/B domain. The AF-1 plays a crucial role in HNF4α-mediated transcription regulation and recruitment of co-activators. It has been demonstrated that AF-1 is indispensable for HNF4α function. Absence of AF-1 led to decrease in both the transcriptional potential and interaction with co- 77 activators (Green et al., 1998; Eeckhoute et al., 2001; Kistanova et al., 2001; Eeckhoute et al., 2003). However, to date, there has been no study carried out to examine the effect of mutating Met49 to Val. Thus, it is not possible to determine as yet if such a change has any functional consequence although in our breast cancer cohort, this variant is not associated with any of the examined parameters of docetaxel pharmacokinetics. The other non-synonymous SNP for the HNF4α gene was Thr130Ile. This variant has been shown to occur in very low frequencies in most populations examined (this study and that of in the Caucasian, Chinese, Czech, Danish, Japanese and Swedish studies). Thr130Ile variant is located in the D domain, which is involved in DNA binding. In vitro transactivation studies have been carried out for this missense polymorphism. When compared to the wild-type, a significant decrease in transactivation activity was observed for the Thr130Ile variant (Ek et al., 2005). This together with the observation that no heterozygous was observed certainly indicates that Thr130Ile is critical to the function of HNF4α. 78 5.2 PXR, CAR and HNF4α Genotypes and Docetaxel Pharmacokinetics CYP3A4 is the main enzyme involved in the metabolism of docetaxel. The expression of CYP3A4 is transcriptionally regulated by various nuclear receptors including PXR, CAR and HNF4α. Hence, in this study, we also sequenced the exons of the human PXR, CAR and HNF4α genes of a cohort of breast cancer patients undergoing docetaxel treatment. Similar to that observed for our healthy population, four variants, namely PXR 5’ UTR variant (-24381 A>C), CAR (Pro180Pro), HNF4α (Met49Val) and HNF4α (Thr130Ile) were observed in the breast cancer patients. The allele frequencies observed in the breast cancer population were similar to that observed for the Chinese and Malays. Pharmacokinetics analysis was performed for the breast cancer population and no clear correlation was found between the different genotypes and docetaxel pharmacokinetics. What was noteworthy was the lack of significant correlation for the HNF4α (Met49Val). There was no difference in all pharmacokinetic parameters between patients who are wild-type, heterozygous or homozygous despite the fact that this SNP occurs in the AF-1 domain which is important for interaction and recruitment of co-activators. One possible explanation to why no clear correlation was found could be due unequally distribution or numbers of patients in each individual ethnic group. By combining the three ethnic groups data for pharmacokinetics analysis could have 79 skewed the result of genotypes correlation to docetaxel pharmacokinetics data. Table 15 illustrated that different ethnic groups have different allele frequencies and not at all similar across the board. As known, the three ethnic groups have different dietary preferences, different racial origin and possible different gene selection. To improve the accuracy of analysis, a larger sample size for each race should be recruited. In addition, a more robust index should be set for the measurement of plasma concentration or docetaxel pharmacokinetics, although all these would be logistically demanding. 80 6. CONCLUSION In conclusion, our study identified four exonic variants in the PXR, CAR and HNF4α genes. All variants were observed in each of the three major ethnic groups examined but the frequencies were different between that of the Indians when compared to the Chinese and Malays. The allele frequencies observed for the local population was also generally different from that of other studies carried out with mainly Caucasian and Japanese subjects. Given the role of PXR, CAR and HNF4α in regulating the expression of CYP3A4, we had hypothesized that genetic polymorphisms of PXR, CAR and HNF4α would affect CYP3A4 expression and this would in turn alter docetaxel clearance and kinetics. However, we did not observe any correlation. Therefore, to completely rule out the lack of correlation, various addition factors need to be examined. A detail examination for polymorphisms in the PXR, CAR and HNF4α genes has to be carried out to include polymorphisms in the promoter regions of the genes as well as polymorphisms in the intron / splice sites. In addition, a larger cohort of patients with sufficient representation of the various ethnic groups needs to be recruited. Given the major role of CYP genes and its associated transcriptional regulators such as PXR, CAR and HNF4α in drug elimination, the variability of SNPs examined in both ethnically diverse healthy and breast cancer populations might 81 be helpful in providing a clearer interpretation of inter-individual variability in drug elimination capacity. 7. PUBLICATIONS Hor SY, Lee SC, Wong CI, Lim YW, Lim RC, Wang LZ, Fan L, Guo JY, Lee HS, Goh BC, Tan T. PXR, CAR and HNF4alpha genotypes and their association with pharmacokinetics and pharmacodynamics of docetaxel and doxorubicin in Asian patients. Pharmacogenomics J. 2007 Sep 18; ahead of print. Tham LS, Holford NH, Hor SY, Tan T, Wang L, Lim RC, Lee HS, Lee SC, Goh BC. Lack of Association of Single-Nucleotide Polymorphisms in Pregnane X Receptor, Hepatic Nuclear Factor 4{alpha}, and Constitutive Androstane Receptor with Docetaxel Pharmacokinetics. Clin Cancer Res 2007; 13(23):71267132. 82 8. REFERENCES Akiyama TE and Gonzalez FJ. Regulation of P450 genes by liver-enriched transcription factors and nuclear receptors. Biochim Biophys Acta 2003; 1619:223234. Baker SD, Sparreboom A, Verweij J. Clinical pharmacokinetics of docetaxel. Clin Pharmacokinet 2006; 45(3):235-252. Bertilsson G, Heidrich J, Svensson K, Åsman M, Jendeberg L, Sydow-Bäckman M, Ohlsson R, Postlind H, Blomquist P, Berkenstam A. Identification of a human nuclear receptor defines a new signaling pathway for CYP3A induction. Proc Natl Acad Sci 1998; 95:12208-12213. Blumberg B, Sabbagh W Jr, Juguilon H, Bolado J Jr, Van Meter CM, Ong ES, Evans RM. SXR, novel steroid and xenobiotic-sensing nuclear receptor. Genes Dev 1998; 12:3195-3205. Bosch TM, Deenen M, Pruntel R, Smits P HM, Schellens J HM, Beijnen J H, Meijerman I. Screening for polymorphisms in the PXR gene in a Dutch population. Eur J Clin Pharmacol 2006; 62: 395-399. 83 Bosch TM, Meijerman I, Beijnen JH, Schellens JHM. Genetic polymorphisms of drug-metabolising enzymes and drug transporters in the chemotherapeutic treatment of cancer. Clin Pharmacokinet 2006; 45(3):253-285. Brouwer K LR and Pollack GM. Pharmacogenetics: Is the right drug for the right patient sufficient?. Adv Drug Deliv Rev 2002; 54(10):1243-4. Burk O and Wojnowski L. Cytochrome P450 3A and their regulation. Naunyn Schmiedebergs Arch Pharmacol 2004; 369:105-124. Clarke SJ and Rivory LP. Clinical pharmacokinetics of docetaxel. Clin Pharmacokinet 1999; 36(2):99-114. Corpet F. Multiple sequence alignment with hierarchical clustering. Nucl Acids Res 1988; 16(22)10881-10890. Costa RH, Grayson DR, Darnell JE Jr. Multiple hepatocyte-enriched nuclear factors function in the regulation of transthyretin and α1-antitrysin genes. Mol Cell Bio 1989; 9(4):1415-1425. Dai D, Tang J, Rose R, Hodgson E, Bienstock RJ, Mohrenweiser HW, Goldstein JA. Identification of variants of CYP3A4 and characterization of their abilities to 84 metabolize testosterone and chlorpyrifos. J Pharmacol Exp Ther 2001; 299(3):825831. De Wildt SN, Kearns GL, Leeder JS, Van Den Anker JN. Cytochrome P450 3A: Ontogeny and Drug Disposition. Clin Pharmacokinet 1999; 37(6):485-505. Dhe-Paganon S, Duda K, Iwamoto M, Chi YI, Shoelson SE. Crystal structure of the HNF4 alpha ligand binding in complex with endogenous fatty acid ligand. J Biol Chem 2002; 277:37973-37976. Domanski TL, Finta C, Halpert JR, Zaphiropoulos PG. cDNA cloning and initial characterization of CYP3A43, a novel human cytochrome P450. Mol Pharmacol 2001; 59:386-392. Du J, Xing Q, Xu L, Xu M, Shu A, Shi Y, Yu L, Zhang A, Wang L, Wang H, Li X, Feng G, He L. Systematic screening for polymorphisms in the CYP3A4 gene in the Chinese population. Pharmacogenomics 2006; 7(6):831-841. Eeckhoute J, Formstecher P, Laine B. Maturity-onset diabetes of the young Type 1 (MODY1)-associated mutations R154X and E276Q in hepatocyte nuclear factor 4alpha (HNF4alpha) gene impair recruitment of p300, a key transcriptional coactivator. Mol Endocrinol 2001; 15(7):1200-10. 85 Eeckhoute J, Moerman E, Bouckenooghe T, Lukoviak B, Pattou F, Formstecher P, Kerr-Conte J, Vandewalle B, Laine B. Hepatocyte nuclear factor 4α isoforms originated from the P1 promoter are expressed in human pancreatic β-cells and exhibit stronger transcriptional potentials than P2 promoter-driven isoforms. Endocrinology 2003; 144(5):1686-1694. EK J, Rose CS, Jensen DP, Glumer C, Borch-Johnsen K, Jorgensen T, Pedersen O, Hansen T. The functional Thr130Ile and Val255Met polymorphisms of the hepatocyte nuclear factor-4alpha (HNF4A): gene associations with type 2 diabetes or altered beta-cell function among Danes. J Clin Endocrinol Metab 2005; 90(5):30543059. Evans WE and Relling MV. Pharmacogenomics: Translating functional genomics into rational therapeutics. Science 1999; 286:487-491. Finta C and Zaphiropoulos PG. The human cytochrome P450 3A locus. Gene evolution by capture of downstream exons. Gene 2000; 260:13-23. Gellner K, Eiselt R, Hustert E, Arnold H, Koch I, Haberl M, Deglmann CJ, Burk O, Buntefuss D, Escher S, Bishop C, Koebe HG, Brinkmann U, Klenk HP, Kleine K, Meyer UA, Wojnowski L. Genomic organization of the human CYP3A locus: identification of a new, inducible CYP3A gene. Pharmacogenetics 2001; 11:111-121. 86 Gibson GG and Skett P. (2001). Introduction to Drug Metabolism (3rd Ed.). Cheltenham, UK: Nelson Thornes Publisher (Chapter 1). Goh BC, Lee SC, Wang LZ, Fan L, Guo JY, Lamba J, Schuetz E, Lim R, Lim HL, Ong AB, Lee HS. Explaining interindividual variability of docetaxel pharmacokinetics and pharmacodynamics in Asians through phenotyping and genotyping strategies. J Clin Oncol 2002; 20(17):3683-90. Goodwin B, Hodgson E, D’Costa DJ, Robertson GR, Liddle C. Transcriptional regulation of the human CYP3A4 gene by the constitutive androstane receptor. Mol Pharmacol 2002; 62:359-365. Goodwin B and Moore JT. CAR: detailing new models. Trends Pharmacol Sci 2004;25(8):437-441. Green VJ, Kokkotou E, Ladias JA. Critical structure elements and multitarget protein interactions of the transcriptional activator AF-1 of hepatocyte nuclear factor 4. J Biol Chem 1998; 273:29950-29957. Guengerich FP. (2005). Cytochrome P450 structure, mechanism, and biochemistry. In Ortiz de Montellano PR (Eds), Human cytochrome P450 enzymes (pp 377-530). New York, USA: Kluwer Academic/Plenum Publishers. 87 Guitton J, Cohen S, Tranchand B, Vignal B, Droz JP, Guillaumont M, Manchon M, Freyer G. Quantification of docetaxel and its main metabolites in human plasma by liquid chromatography/tandem mass spectrometry. Rapid Commun Mass Spectrom 2005;19(17):2419-2426 Gupta RK, Vatamaniuk MZ, Lee CS, Flaschen RC, Fulmer JT, Matschinsky FM, Duncan SA, Kaestner KH. The MODY1 gene HNF-4α regulates selected genes involved in insulin secretion. J Clin Invest 2005; 115:1006-1015. Hadzopoulou-Cladaras M, Kistanova E, Evagelopoulou C, Zeng S, Cladaras C, Ladias JA. Functional domains of the nuclear receptor hepatocyte nuclear factor 4. J Biol Chem 1997; 272(1):539-550. Handschin C and Meyer UA. Induction of Drug Metabolism: The role of nuclear receptors. Pharmacol Rev 2003; 55:649-673. Hasler JA, Estabrook R, Murray M, Pikuleva I, Waterman M, Capdevila J, Holla V, Helvig C, Falck J R, Farrell G, Kaminsky LS, Spivack SD, Boitier E, Beaune P. Human cytochromes P450. Mol Aspects Med 1999; 20(1-2):1-137. Herbst RS and Khuri FR. Mode of action of docetaxel – a basis for combination with novel anticancer agents. Cancer Treat Rev 2003; 29(5):407-415. 88 Hirth J, Watkins PB, Strawderman M, Schott A, Bruno R, Baker LH. The effect of an individual’s cytochrome CYP3A4 activity on docetaxel clearance. Clin Cancer Res 2000; 6:1255-1258. Honkakoski P, Sueyoshi T, Negishi M. Drug-activated nuclear receptors CAR and PXR. Ann Med 2003; 35:172-182. Hsieh KP, Lin YY, Cheng CL, Lai ML, Lin MS, Siest JP, Huang JD. Novel mutations of CYP3A4 in Chinese. Drug Metab Dispos 2001; 29(3):268-273. Ikeda S, Kurose K, Ozawa S, Sai K, Hasegawa R, Komamura K, Ueno K, Kamakura S, Kitakaze M, Tomoike H, Nakajima T, Matsumoto K, Saito H, Goto Y, Kimura H, Katoh M, Sugai K, Minami N, Shirao K,Tamura T, Yamamoto N, Minami H, Ohtsu A, Yoshida T, Saijo N, Saito Y, Sawada J. Twenty-six novel single nucleotide polymorphisms and their frequencies of the NR1I3 (CAR) gene in a Japanese population. Drug Metab Pharmacokinet 2003; 18(6):413-418. Ingelman-Sundberg M. Human drug metabolising cytochrome P450 enzymes: properties and polymorphisms. Naunyn Schmiedebergs Arch Pharmacol 2004; 369:89-104. 89 Jiang G and Sladek FM. The DNA binding domain of hepatocyte nuclear factor 4 mediates cooperative, specific binding to DNA and heterodimerization with the retinoid X receptor alpha. J Biol Chem 1997; 272(2):1218-1225. Kamiya A, Inoue Y, Gonzalez FJ. Role of the hepatocyte nuclear factor 4α in control of the pregnane X receptor and xenobiotic metabolism during fetal liver development. Hepatology 2003; 37:1375-1384. Kawamoto T, Sueyoshi T, Zelko I, Moore R, Washbum K, Negishi M. Phenobarbitalresponsive nuclear translocation of the receptor CAR in induction of the CYP2B gene. Mol Cell Bio 1999;19(9):6318-6322. Kistanova E, Dell H, Tsantili P, Falvey E, Cladaras C, Hadzopoulou-Cladaras M. The activation function-1 of hepatocyte nuclear factor-4 is an acidic activator that mediates interactions through bulky hydrophobic residues. Biochem J 2001; 356:635642. Kliewer SA, Moore JT, Wade L, Staudinger JL, Watson MA, Jones SA, McKee DD, Oliver BB, Willson TM, Zetterstrom RH, Perlmann T, Lehmann JM. An orphan nuclear receptor activated by pregnanes defines a novel steroid signaling pathway. Cell 1998; 92:73-82. 90 Kliewer SA, Goodwin B, Willson TM. The nuclear pregnane X receptor: A key regulator of xenobiotic metabolism. Endo Rev 2002; 23(5):687-702. Kliewer SA. Pregnane X receptor: Predicting and preventing drug interactions. Thromb Res 2005; 117:133-136. Kretschmer XC and Baldwin WS. CAR and PXR: Xenosensors of endocrine disrupters?. Chem Biol Interact 2005; 155:111-128. Lamba JK, Lin YS, Schuetz EG, Thummel KE. Genetic contribution to variable human CYP3A4-mediated metabolism. Adv Drug Deliv Rev 2002; 54:1271-1294. Lamba J, Lamba V, Schuetz E. Genetic variants of PXR (NR1I2) and CAR (NR1I3) and their implications in drug metabolism and pharmacogenetics. Curr Drug Metab 2005; 6:369-383. Lehmann JM, McKee DD, Watson MA, Willson TM, Moore JT, Kliewer SA. The human orphan nuclear receptor PXR is activated by compounds that regulate CYP3A4 gene expression and cause drug interaction. J Clin Invest 1998; 102:10161023. 91 Marre F, Sanderink GJ, de Sousa G, Gaillard C, Martinet M, Rahmani. Hepatic biotransformation of docetaxel (taxotere®) in vitro: Involvement of the CYP3A subfamily in humans. Cancer Res 1996; 56:1296-1302. Matsumura K, Saito T, Takahashi Y, Ozeki T, Kiyotani K, Fujieda M, Yamazaki H, Kunitoh H, Kamataki T. Identification of a novel polymorphic enhancer of the human CYP3A4 gene. Mol Pharmacol 2004; 65:326-334. Moller AM, Urhammer SA, Dalgaard LT, Reneland R, Berglund L, Hansen T, Clausen JO, Lithell H, Pedersen O. Studies of the genetic variability of the coding region of the hepatocyte nuclear factor-4alpha in Caucasians with maturity onset NIDDM. Diabetologia 1997; 40(8):980-983. Nakhei H, Lingott A, Lemm I, Ryffel GU. An alternative spice variant of the tissue specific transcription factor HNF4α predominates in undifferentiated murine cell types. Nucleic Acids Res 1998; 26:497-504. Nelson DR. Cytochrome P450 and the individuality of species. Arch Biochem Biophys 1999; 369(1):1-10. Nelson DR. Human P450 data. Http://drnelson.utmem.edu/hum.html (6 October 2003) 92 Odom DT, Zizlsperger N, Gordon DB, Bell GW, Rinaldi NJ, Murray HL, Volkert TL, Schreiber J, Rolfe PA, Gifford DK, Fraenkel E, Bell GI, Young RA. Control of the pancreas and liver gene expression by HNF transcription factors. Science 2004; 303:1378-1381. Okey AB, Boutros PC, Harper PA. Polymorphisms of human nuclear receptors that control expression of drug-metabolizing enzymes. Pharmacogenet Genomics 2005; 15(6):371-9. Pascussi JM, Gerbal-Chaloin S, Drocourt L, Maurel P, Vilarem MJ. The expression of CYP2B6, CYP2C9 and CYP3A4 genes: a tangle of networks of nuclear and steroid receptors. Biochim Biophys Acta 2003; 1619:243-253. Plant N. The human cytochrome P450 sub-family: Transcriptional regulation, interindividual variation and interaction networks. Biochim Biophys Acta 2007; 1770(3):478-488. Price JA, Fossey SC, Sale MM, Brewer CS, Freedman BI, Wuerth JP, Bowden DW. Analysis of the HNF4α gene in Caucasian type II diabetic nephropathic patients. Diabetologia 2000; 43(3):364-372. 93 Pruhova S, Ek J, Lebl J, Sumnik Z, Saudek F, Andel M, Pedersen O, Hansen T. Genetic epidemiology of MODY in the Czech Republic: new mutations in the MODY genes HNF-4α, GCK and HNF-1α. Diabetologia 2003; 46(2):291-5. Quattrochi LC and Guzelian PS. CYP3A regulation: From pharmacology to nuclear receptors. Drug Metab Dispos 2001; 29:615-622. Rebhan, M, Chalifa-Caspi, V, Prilusky, J, Lancet, D. GeneCards: encyclopedia for genes, proteins and diseases. Weizmann Institute of Science, Bioinformatics Unit and Genome Center (Rehovot, Israel), 1997. GeneCard for [CYP3A] Http://www.genecards.org (Last updated on 28th Oct 2006). Rissanen J, Wang H, Miettinen R, Kärkkäinen P, Kekäläinen P, Mykkänen L, Kuusisto J, Karhapää, Niskanen L, Uusitupa M, Laakso M. Variants in the hepatocyte nuclear factor-1alpha and -4alpha genes in Finnish and Chinese subjects with lateonset type 2 diabetes. Diabetes Care 2000; 23(10):1533-1538. Rodriguez-Antona C and Ingelman-Sundberg M. Cytochrome P450 pharmacogenetics and cancer. Oncogene 2006; 25: 1679:1691. Ryffel GU. Mutations in the human genes encoding the transcription factors of the hepatocyte nuclear factor (HNF)1 and HNF4 families: functional and pathological consequences. J Mol Endocrinol 2001; 27:11-29. 94 Sakurai K, Seki N, Fujii R, Yagui K, Tokuyama Y, Shimada F, Makino H, Suzuki Y, Hashimoto N, Saito Y, Egashira T, Matsui K, Kanatsuka A. Mutations in the Hepatocyte Nuclear Factor-4α Gene in Japanese with non-insulin-dependent diabetes: A nucleotide substitution in the polypyrimidine tract of intron 1b. Horm Metab Res 2000; 32:316-320 Savkur RS, Wu Y, Bramlett KS, Wang M, Yao S, Perkins D, Totten M, Searfoss III G, Ryan TP, Su EW, Burris TP. Alternative splicing within the ligand binding domain of the human constitutive androstane receptor. Mol Genet Metab 2003; 80(12):216-226. Shou M, Martinet M, Korzekwa KR, Krausz KW, Gonzalez FJ, Gelboin HV. Role of human cytochrome P450 3A4 and 3A5 in the metabolism of taxotere and its derivatives: enzyme specificity, interindividual distribution and metabolic contribution in human liver. Pharmacogenetics 1998; 8:391-401. Sladek FM, Zhong WM, Lai E, Darnell JE Jr. Liver-enriched transcription factor HNF-4 is a novel member of the steroid hormone receptor superfamily. Genes Dev 1990; 4:2353-2365. 95 Sladek FM and Seidel SD. (2001). Nuclear Receptors and Genetic Disease. In Burris TP and McCabe ERB (Eds), Hepatocyte nuclear factor 4α (pp 309-361). London UK: Academic Press. Tirona RG, Lee W, Leake BF, Lan LB, Cline CB, Lamba V, Parviz F, Duncan SA, Inoue Y, Gonzalez FJ, Schuetz EG, Kim RB. The orphan nuclear receptor HNF4α determines PXR- and CAR-mediated xenobiotic induction of CYP3A4. Nat Med 2003; 9:220-224. Tirona RG and Kim RB. Nuclear receptors and drug disposition gene regulation. J Pharm Sci 2005; 94(6):1169-1176 Vaclavikova R, Soucek P, Svobodova L, Anzenbacher P, Simek P, Guengerich FP, Gut I. Different in vitro metabolism of paclitaxel and docetaxel in humans, rats, pigs, and minipigs. Drug Metab Dispos 2004; 32:666-674. Van Schaik RHN. Cancer treatment and pharmacogenetics of cytochrome P450 enzymes. Invest New Drugs 2005; 23:513-522. Wang HB and LeCluyse EL. Role of orphan nuclear receptors in the regulation of drug-metabolising enzymes. Clin Pharmacokinet 2003; 42(15):1331-1357. 96 Westlind A, Malmebo S, Johansson I, Otter C, Andersson TB, Ingelman-Sundberg M, Oscarson M. Cloning and tissue distribution of a novel human cytochrome P450 of the CYP3A subfamily, CYP3A43. Biochem Biophys Res Commun 2001; 281:1349-1355. Williams JA, Ring BJ, Cantrell VE, Jones DR, Eckstein J, Ruterbories K, Hamman MA, Hall SD, Wrighton SA. Comparative metabolic capabilities of CYP3A4, CYP3A5 and CYP3A7. Drug Metab Dispos 2002; 30(8):883-891. Willson TM and Kliewer SA. PXR, CAR and drug metabolism. Nat Rev Drug Discov 2002; 1(4):259-266. Zhang J, Kuehl P, Green ED, Touchman JW, Watkins PB, Daly A, Hall SD, Maurel P, Relling M, Brimer C, Yasuda K, Wrighton SA, Hancock M, Kim RB, Strom S, Thummel K, Russell CG, Hudson JR Jr, Schuetz EG, Boguski MS. The human pregnane X receptor: genomic structure and identification and functional characterization of natural allelic variants. Pharmacogenetics 2001; 11:555-572. 97 [...]... PXR-RXRα and CAR- RXRα heterodimers are capable of binding to the proximal promoter region of the CYP3A4 gene and mediates PXR or CAR transactivation of the CYP3A4 promoter respectively (Bertilsson et al., 1998; Goodwin et al., 2002; Akiyama and Gonzalez, 2003) The activation of CYP3A4 promoter by the nuclear receptors heterodimer is dependent upon ligand binding leading to the binding of the nuclear receptors. .. number of orphan receptors has increased tremendously (Wang and LeCluyse, 2003; Kliewer, 2005) Scientists are not only interested in researching on the novel physiological ligands of these orphan receptors but also the biological functions and signaling cascades that these receptors elicit The next part of the introduction will focus on three members of the NHR superfamily (PXR, CAR and HNF4α) and their... structure which consists of activation function 1 (AF-1) domain located at the amino-terminal and AF-2 domain at the carboxy-terminal The DNA binding domain (DBD) is connected to the ligand binding domain (LBD) by a flexible hinge Upon ligand binding to the LBD, AF-2 will undergo a conformational change that disrupts interaction with transcriptional co-repressors and allows the interaction with transcriptional... liver and intestine, and regulates a variety of drug detoxifying genes (Pascussi et al., 2003) These include the CYP3As, CYP2Bs, CYP2Cs, UGT1A1, GST, SULT, MDR1, MRP2, MRP3 and MRP4 (Handschin and Meyer, 2003; Lamba et al., 2005) CAR resides in the cytoplasm and translocates into the nucleus upon binding to its ligand (Kawamoto et al., 1999; Savkur et al., 2003; Tirona and Kim, 2005) Interestingly, there... 9-cis-retinoic acid and trans-retinoic acid Upon binding of ligands, class II receptors dimerizes with retinoid X receptor (RXR) In both cases, upon binding ligand binding, the receptors may undergo conformational changes that eventually cause the dissociation of co-repressors and binding of coactivators Class III belongs to a group of receptors whose physiological ligands have not yet been identified (Handschin... (Handschin and Meyer, 2003; Pascussi et al., 2003) Over the past decades, some members of the NHR superfamily were termed ‘orphan’ receptors because at the time of their cloning, nothing was known about their physiological ligands or co-activators Till now, the term remains for these receptors even though their ligands are now known The first ‘orphan’ receptor was identified in 1988 and since then, the. .. co-activators The activated nuclear receptor will then bind to the response elements on the regulatory regions of target genes and initiates transcription 15 C NHRs are categorized into three main classes Class I receptors bind to steroid hormones and in absence of ligand, these receptors are associated with molecular chaperones like heat shock proteins (HSPs) Class II receptors bind to thyroid hormone, vitamin... binding domain and a ligand binding domain as illustrated in Figure 4 NHRs are able to induce or regulate drug metabolism by binding to small lipophilic ligands Following ligand binding and dimerization, they then bind to DNA element repeats of the nucleotide hexamers in different arrangements like the ones found in drugresponsive enhancers of CYPs The hexamers can be arranged either as direct repeats (DR),... comprises the transport and elimination steps where the parent drug and its metabolites are exported out of the cell and eventually removed from the body through the bile or urine Figure 1 illustrates the contribution of phase I and phase II enzymes to the metabolism of drugs 2 Figure 1: Pie chart illustrations of phase I and phase II drug metabolising enzymes The relative size of each section on the charts... CYP2D6 and CYP3A4 (Ingelman-Sundberg, 2004) Table 1 shows the main tissue localisation of these CYPs and their anti-cancer substrates (Ingelman-Sundberg, 2004; Van Schaik, 2005) Different forms of CYP are found to be expressed in intestine, lung and kidneys but the liver is the major site for CYP-mediated oxidative metabolism, with CYP3A family as the dominant class In this study, the focus will be on the ... the amino-terminal and AF-2 domain at the carboxy-terminal The DNA binding domain (DBD) is connected to the ligand binding domain (LBD) by a flexible hinge Upon ligand binding to the LBD, AF-2... European and Asian like the Japanese However, this has not been done in the local population Therefore, it would be of great interest to determine the SNPs in PXR, CAR and HNF4α genes in the local population. .. Goodwin et al., 2002; Akiyama and Gonzalez, 2003) The activation of CYP3A4 promoter by the nuclear receptors heterodimer is dependent upon ligand binding leading to the binding of the nuclear receptors