Identification of mutations in exons 3 and 4 of the LDL-Receptor gene in patients with familial hypercholesterolemia

Familial hypercholesterolemia (FH) is an inherited disorder of lipid metabolism. FH is characterized by raised serum LDL - C levels, leading to accelerated atherosclerosis and increased risk of premature coronary heart disease. More than 80% of the time, FH is caused by mutations in the LDL receptor. The LDL receptor consists of 18 exons, and the largest number of LDLR mutations are believed to be in exons 4 and 3. The aim of our study was to examine mutations in exons 3 and 4 of the LDLR gene in Vietnamese patients with FH. The sample group consisted of 50 Vietnamese patients diagnosed with FH, based on Medped (USA) criteria. Blood samples were taken after an overnight fast for determination of lipoprotein parameters and DNA extraction. Polymerase chain reactions were performed to amplify exon 3 and 4 of LDL receptor gene, after which direct sequencing was done. Of the 50 FH patients in our sample, 9 patients were found to have mutations in exons 3 and 4 of the LDL receptor gene. These mutations included: mutation D69N (exon3), and mutations D206E, D147Y,C201R (exon 4).

JOURNAL OF MEDICAL RESEARCH IDENTIFICATION OF MUTATIONS IN EXONS AND OF THE LDL-RECEPTOR GENE IN PATIENTS WITH FAMILIAL HYPERCHOLESTEROLEMIA Pham Thi Minh Huyen1, Hoang Thi Yen2a, Dang Quang Huy2b, Nguyen Quynh Giao2c, Dang Thi Ngoc Dung3 Biochemistry department, 108 hospital; 2aGeneral laboratory, Hanoi Heart hospital, 2b,2c,Department of medical laboratory science, Hanoi Medical University, 3Biochemistry department, Hanoi Medical University Familial hypercholesterolemia (FH) is an inherited disorder of lipid metabolism FH is characterized by raised serum LDL - C levels, leading to accelerated atherosclerosis and increased risk of premature coronary heart disease More than 80% of the time, FH is caused by mutations in the LDL receptor The LDL receptor consists of 18 exons, and the largest number of LDLR mutations are believed to be in exons and The aim of our study was to examine mutations in exons and of the LDLR gene in Vietnamese patients with FH The sample group consisted of 50 Vietnamese patients diagnosed with FH, based on Medped (USA) criteria Blood samples were taken after an overnight fast for determination of lipoprotein parameters and DNA extraction Polymerase chain reactions were performed to amplify exon and of LDL receptor gene, after which direct sequencing was done Of the 50 FH patients in our sample, patients were found to have mutations in exons and of the LDL receptor gene These mutations included: mutation D69N (exon3), and mutations D206E, D147Y,C201R (exon 4) Key words: FH, LDL receptor mutation, D69N, D147Y, D206E, C201R I INTRODUCTION Familial hypercholesterolemia (FH) is one of the most common metabolic inherited disorders, affecting in 500 people yearly The prevalence of the disease is relatively high in most communities worldwide [1], particularly in African countries [2] FH is a monogenic inherited disease caused by mutations occurred mostly in genes that affect the metabolic clearance of LDL - C More than 80% of FH cases are believed to be caused by mutations in the LDLR gene, while other genes such as the apolipoprotein B (apoB) gene, the PCSK9 gene, and the LDLRAP1 gene are believed to be responsible for the majority of the other cases of FH [3] The LDL receptor (LDLR) gene locus is located on chromosome 19p13.1 - 13.3 and spans 45 kb It contains 18 exons and 17 introns [4] Patients with malfunctions in the LDLR gene have elevated LDL - C levels LDL - C deposits in tissues and causes external manifestations of FH, such as tendinous xanthomas More importantly, LDL - C deposits in arteries can lead to premature coronary heart disease (CHD) [5; 6] Individuals with untreated FH are at an approximately 20 - fold increased risk of Corresponding author: Pham Thi Minh Huyen, Biochemistry department, 108 hospital Email: minhhuyenv108@gmail.com Received: 02 November 2016 Accepted: 10 December 2016 JMR 105 E1 (7) - 2016 having CHD compared to healthy control groups [7] Untreated men have a 50% chance of a coronary event by the age of 50 and untreated women have a 30% chance of a 39 JOURNAL OF MEDICAL RESEARCH coronary event by the age of 60 [8] In contrast, early identification and treatment of Methods - Study design: Cross-sectional study patients with FH may reduce the risk of the development of early CHD [9] It is generally - Study process: difficult to diagnose young FH patients based Four mL of blood was obtained from each on the FH phenotype alone because the patient after an overnight fast Total plasma various physical manifestation of FH, such as cholesterol, triglyceride, and HDL-C levels the tendon xanthomas, not develop until were measured using commercially available later in life [10] Therefore, a molecular test kits (Beckman coulter) Plasma LDL-C was provides an unequivocal diagnosis prior to the calculated appearance of clinical symptoms In Vietnam, formula Genomic DNA was extracted from there is a lack of research on the diagnosis of peripheral blood samples by the phenol/ FH based on genetic analysis, resulting in a chloroform method Exon and exon of high mortality rate among young patients the LDLR gene were amplified using suffering polymerase chain reaction (PCR) method from coronary heart disease Therefore, this study aims to determine the rate and types of mutations in exons and of the LDLR gene in patients with FH in Vietnam II SUBJECTS AND METHOD Subjects according to the Friedewald the with two pairs of oligonucleotide primers: Exon 3: 5’TTTAGTAGGACAGGGTTTCACTATATTGG 3’ 3’CTGGTCAAGGGGGGATTTGA 5’ Exon 4: 5’TGATGGTGGTCTCGGCCCAT 3’ 3’ACACCTGGGGGAGCCCA 5’ The PCR reaction mix contained: 17.5 Fifty patients selected from 108 hospitals, who were examined between October 2015 and April 2016 and who fulfilled the Medped µlGoTaqmastermix, 1µl DNA, 0.5µl forward primer, 0.5µl reverse primer, and 5.5 µl water nuclease free The total volume for each PCR (USA) diagnostic criteria for FH (see below), reaction mix was 25 µl The thermal cycling were included in this study regimen consisted of cycle of denaturation at Inclusion criteria: 950 for minutes, followed by 35 cycles at 950 < 18 age: Cholesterol ≥ 7.0 and LDL-C ≥ for 30 seconds, an annealing at 580 for 30 5.2 (mmol/L) 18 - 29 age: Cholesterol ≥ 7.5 and LDL-C ≥ 5.7 (mmol/L) 30 - 39 age: Cholesterol ≥ 8.8 and LDL-C ≥ 6.2 (mmol/L) ≥ 40 age: Cholesterol ≥ 9.3 and LDL-C ≥ 6.7 (mmol/L) Exclusion criteria: a diagnosis of diabetes mellitus, renal syndrome, and/or hypothyroid 40 minutes, extension at 720 for 30 seconds, and a final extension of 720 for minutes The amplified products were identified on 2% agarose gel and were stained with ethidium bromide which was visualized under UV light The PCR products were then sequenced - Mutation analysis: DNA sequencing analysis was performed using Prism ABI 330xl software and the result- JMR 105 E1 (7) - 2016 JOURNAL OF MEDICAL RESEARCH ing sequences were compared with original Research ethics sequence on genebank All patients after being clearly explained about the study III RESULTS 1.General characteristics of the participants - Gender and age Table Age and gender of participants Variables Age ( n % X ± SD) 50.34 ± 12.64 Sex: Male 25 50 Female 25 50 Patients’ ages ranged from 24 to 79 years old The mean age of all participants was 50.34 years - Clinical characteristics of the FH patients included in this study Table Clinical characteristic n % Angina pectoris 14 Myocardial infarction 0 Hypertension 10 Xanthomas 0 BMI ( X ± SD) 21.96 ± 1.32 Seven patients (14%) had angina pectoris and five patients (10%) had hypertension There were no patients with xanthomas or myocardial infarction Average body mass index (BMI) was approximately 21.96 ± 1.32 (kg/m2) Patients’ BMI ranged from 18.97 to 24.46 (kg/m2) Lipid profile characteristics Table Lipid parameters Variables X ± SD Cholesterol Triglycerides HDL - C LDL - C Cholesterol/HDL (n = 50) (n = 50) (n = 50) (n = 50) ratio (n = 50) 10.35 ± 1.31 2.19 ± 0.96 1.6 ± 0.35 7.76 ± 1.19 6.7 ± 1.45 JMR 105 E1 (7) - 2016 41 JOURNAL OF MEDICAL RESEARCH The average cholesterol concentration was 10.35 ± 1.31 mmol/L, with a range from 8.76 to 16.09 mmol/L Triglyceride concentration ranged from 0.58 to 4.44 mmol/L LDL-C concentration ranged from 6.43 to 11.9 mmol/L Identification of mutations in exons and of the LDL receptor gene - PCR Picture Electrophoresis photograph of exon (477bp) M: marker; (-) negative; - 10: samples S1 - S10 Picture Electrophoresis photograph of exon (465bp) M: marker; (-): negative; - 9: samples S1 - S9 Electrophoresis bands were clear and their sizes were exact - Sequencing results Picture D69N mutation in exon of the LDLR gene in patient S35 42 JMR 105 E1 (7) - 2016 JOURNAL OF MEDICAL RESEARCH Picture D206E mutation in exon of the LDLR gene in patient S9 Picture D147Y mutation in exon of the LDLR gene in patient S4 Picture C201R mutation in exon of the LDLR gene in patient S19 JMR 105 E1 (7) - 2016 43 JOURNAL OF MEDICAL RESEARCH Mutation categories in our study Table Mutation categories in exon 3, of LDLR gene Name Exon n % D69N D147Y D206E 4 C201R 10 There was one mutation found in exon (D69N) and three mutations found in exon (D147Y, D206E, and C201R) IV DISCUSSION Our study group consisted of 50 Vietnam- (14%) with angina pectoris and patients ese FH patients who fulfilled the Medped (10%) with symptoms of hypertension There (USA) diagnostic criteria for FH The average were no patient with xanthomas or myocardial age of our patients was 50.34 years and the infarction In the study referenced above with range was from 24 to 79 years old Our Japanese FH patients, 26% of the 200 pa- average patient age and overall age range are tients in the study had CHD and 75% had xan- consistent thomas with previous studies of FH [13] In the study with patients One recent study of 605 FH patients Malaysian FH patients conducted in 2013, from the Netherlands saw an average age of 68% of patients had CHD, 40.8% of patients 47.08 (years old) [11]; another study included had xanthomas, and 23.14% of patients had 86 Asian FH patients (with 72 Chinese hypertension, among the 164 FH patients patients, 13 Malaysian patients and Indian included in the study [14] In our study, we patient) with an average age of presentation only selected patients who fulfilled MEDPED around 54 years old, and a range from 31 to criteria (based on Cholesterol concentration 71 years old [12] The male: female ratio in our matched with patients’ age) In the study study was 1:1, similar to the study conducted conducted with Japanese patients [13], FH in the Netherlands, where of the 605 patients was diagnosed according to the Simon included, 53% were female [11] Another study Broome criteria, which include: cholesterol conducted in 2002 among 200 Japanese FH levels ≥ 5.9 mmol/L with tendon xanthomas, or patients included 53.6% females [13] In FH among first-degree relatives In the study Malaysia, a study conducted in 2013 with 164 conducted in Malaysia, study subjects were FH patients included 48.4% women [14] patients who had elevated cholesterol levels Thus, our gender proportions are consistent and xanthomas or CHD in first degree rela- with previous studies conducted with FH tives Thus, these studies saw higher percent- patients In our study, there were patients ages 44 of patients with CHD and/and JMR 105 E1 (7) - 2016 JOURNAL OF MEDICAL RESEARCH xanthomas BMI measurements among the had D147Y mutation The D69N and D206E patients in our sample averaged out to 23.0 ± mutations were found in one patient each All 3.0 kg/m , with a range from 18.97 to 24.46 of the mutations were nonsynonymous mis- (kg/m2) All BMI values among the patients in sense mutations, with nucleotide substitutions our sample were within normal range that changed one amino acid into another FH is characterized by elevated LDL - C These mutation thus not change the size of levels In our study, the average cholesterol protein, but affect the proteins’ functions was 10.35 ± 1.31 mmol/L; the average triglyc- [15] Based on the effects of the mutations on eride level was 2.19±0.96 mmol/L; the average LDL metabolism, these mutations are in the HDL- C level was 1.6 ± 0.35 mmol/L; the aver- 2B class They not disrupt the synthesis of age LDL - C level was 7.76 ± 1.19 mmol/L; the LDLR, but they block transportation of and the average ratio of total cholesterol to LDLR proteins to the Golgi apparatus As a HDL - C was 6.7 ± 1.45 mmol/L result, LDLR proteins reach the cell surface at Cholesterol and LDL-C levels among the patients in our study were similar to the results of a study conducted with 605 FH patients in the Netherlands [11] However, because of different FH diagnostic criteria used in our a considerably reduced rate and are rapidly degraded, leading to defections of LDLR on the cell surface and decreasing LDL - C clearance [15] V CONCLUSION study versus in other studies, cholesterol and LDL-C levels among patients in our sample We found patients who carried mutations were higher than those of patients in studies in exons and of the LDLR gene, among conducted with FH patients in other Southeast the 50 FH patients included in our sample Asian countries, specifically Malaysia [12; 14] The mutations included the D69N mutation in To date, more than 1700 different muta- exon 3, and the D147Y, D206E and C201R tions of the LDLR gene have been reported mutations in exon Overall, the C201R worldwide as the cause of FH [5] The largest mutation was the most common mutation, number of LDLR mutations has been found in present in five of the nine patients with exons and of the LDLR gene [12 - 14] mutations in exons and Therefore, in our study, we analyzed exons and of the LDLR gene among the Vietnamese FH patients included in our sample Among 50 patients in our sample, we identified nine patients who carried mutations (one patient had a mutation in exon and Acknowledgements We would like to acknowledge the physicians from the health laboratory quality examination centre at the Hanoi Medical University eight patients had mutations in exon 4) All of for their technical assistance We would also the mutations were heterozygous The loca- like to acknowledge the contribution of the tions of mutations were: D69N (exon 3) and physicians from the chemistry departments D206E, D147Y, C201R (exon 4) Five patients from 108 hospitals in Vietnam who submitted carried the C201R mutation and two patients blood samples from FH patients JMR 105 E1 (7) - 2016 45 JOURNAL OF MEDICAL RESEARCH REFERENCES Diagnosis E a Varret M (2008) Genetic heterogeneity of autosomal dominant hypercholes2 E a Austin MA (2004) Genetic causes of monogenic heterozygous familial hypercholesterolemia: a Huge prevalence review Am J J Varghese (2014) Familial hypercholesterolemia: A review Annals of Paul N Hopkins, Peter P Toth, Christie M Ballantyne et al (2011) Familial hypercholesterolemias: Prevalence, genetics, diagnosis and screening recommendations from the National Lipid Association Expert on Familial Hypercholesterolemia G Kees Hovingh, Michael H Davidson, John J.P Kastelein et al (2013) Diagnosis and treatment of familial hypercholesterolemia European Heart journal, 34, 962 - mortality M A A Christopher, C Imes PhD (2013) Low-Density Lipoprotein Cholesterol, Apolipoprotein B, an Risk of Coronary Heart From Familial (2008) in statin-treated patients with heterozygous familial hypercholesterolaemia: a prospective registry study Eur Heart J, 29 10 J J P K Sigrid W Fouchier and Joep C Defesche (2001) The molecular Netherlands Human mutation, 109, 602 - 615 11 J J P K Sigrid W Fouchier and Joep C Defesche (2005) Update of the Molecular Basis of Familial Hypercholesterolemia in The Netherlands Human mutation, 26(6), 550 - 556 et al (2000) Low - density lipoprotein receptor gene Hyperlipidemia Genomics NIH Public Access, 15 (3), 292 308 mutations in a Southeast Asian population with familial hypercholesterolemia Clin Genet, 58, 98 - 105 13 971 A N Wenxin Yu, Toshinori Higashikata, Hong Lu et al (2002) Molecular genetic analysis of familial hypercholesterolemia: spectrum and regional difference of LDL receptor gene mutations in Japanese population Atheroclerosis, 165, 335 - 342 14 Alyaa Al-Khateeb, Hassanain Al- B M Feldman DI, Santos RD, Jones SR, J C A Neil, J Betteridge 12 Khoo KL, van Acker P, Defesche JC Clinical Lipidology, 5(s), - 17 Disease: Arzteblatt, 111 basis of familial hypercholesterolemia in The pediatric cardiology, 7(2), 107 - 117 Panel Deutsches (21), 2625 - 2633 Epidemiol, 160(5), 407 - 420 M Treatment Reductions in all-cause, cancer, and coronary terolemia Clin Genet, 73(1), 125 - 132 and Blumenthal RS Talib, Mohd S Mohamed et al (2013) Phe- (2015) notype-Genotype Analyses of Clinically Diag- Recommendations for the management of nosed Malaysian Familial Hypercholestrolemic Patients with Familial Hypercholesterolemia Patient Adv Clin Exp Med, (22), 57 - 67 Curr Atheroscler Rep, 17(1), 473 - 480 15 J.-P R Mathilde Varret (2012) Gerald Klose, Ulrich Laufs, Winfried Marz et al Hypercholesterolemia: 46 (2014) Familial Developements in Missense Mutation in the LDLR gene: A Wide Spectrum in the Severity of Familial Hypercholesterolemia Intech, 55 - 70 JMR 105 E1 (7) - 2016 ... number of LDLR mutations has been found in present in five of the nine patients with exons and of the LDLR gene [12 - 14] mutations in exons and Therefore, in our study, we analyzed exons and of the. .. disease Therefore, this study aims to determine the rate and types of mutations in exons and of the LDLR gene in patients with FH in Vietnam II SUBJECTS AND METHOD Subjects according to the Friedewald... among patients in our sample We found patients who carried mutations were higher than those of patients in studies in exons and of the LDLR gene, among conducted with FH patients in other Southeast