Identification of polymorphisms in the nuclear receptors (PXR, CAR and HNF4X) genes in the local population
... the amino-terminal and AF-2 domain at the carboxy-terminal The DNA binding domain (DBD) is connected to the ligand binding domain (LBD) by a flexible hinge Upon ligand binding to the LBD, AF-2 ... European and Asian like the Japanese However, this has not been done in the local population Therefore, it would be of great interest to determine the SNPs in PXR, CAR...
Ngày tải lên: 09/10/2015, 11:06
... in Fig Within the nucleus, the protein again seemed to be localized to compartments in the interchromatin space (Fig 7) To further confirm the localization of ISP36, an inter4329 Interchromatin ... Peptidyl-prolyl-cis-trans isomerase B precursor Fragment of lamin A or C Lamin A Lamin C or lamin A fragment Fragment of lamin A or C Fragment of lami...
Ngày tải lên: 30/03/2014, 20:20
... rs4578621 F : CAAGCTGGGTGCACTGGC 185 R : GAGAAATAGAGGAATTAACC rs6496589 F : CTGCCAACACTCG AGCTG 110 R : ACCTGACTCTTCCTTGTCT rs894160 F1 : GCTGAGACTGAGTCACATGC 403 R1 : GCTGAGACTGAGTCACATGC F2 : CTGTTTGTGGGGCTCCCTCG ... et al reported that the A allele was associated with enhanced basal and noradrenaline-induced lipolysis in human subcutaneous fat cells [7], it does not seem to have a...
Ngày tải lên: 11/08/2014, 08:20
Báo cáo y học: " The role of polymorphisms in ADAM33, a disintegrin and metalloprotease 33, in childhood asthma and lung function in two German populations" doc
... ACGTTGGATGAGTCGGTAGCAACACCAGG rev ACGTTGGATGACCATGACACCTTCCTGCTG fwd ACGTTGGATGGGAGTGAAAAGATGTGCTGG rev ACGTTGGATGCCACTTCCTCTGCACAAATC fwd ACGTTGGATGAGAGAACTGGGTTAAGGCAG rev ACGTTGGATGCCAGCACATCTTTTCACTCC ... ACGTTGGATGAAAATACTGGGACTCGAGGC rev ACGTTGGATGTGCTGTATCTATAGCCCTCC fwd ACGTTGGATGGGGCACCAATTAACTAAGGC rev ACGTTGGATGTGAGGGCATGGAAGGTTCAG fwd ACGTTGGATGAGTCGGTAGCAACACCAGGC rev ACGTTGGATGA...
Ngày tải lên: 12/08/2014, 16:20
Báo cáo khoa học: "Time Period Identification of Events in Text" pptx
... number of sentences including any N-best time-associated words We also show the number of sentences including explicit temporal expressions, and the number of sentences including NE-TIME tag (Sekine ... obtained by the proposed method The words are sorted in the descending order of the value of P(c | w) Although some consist of two or three words, their original forms in Japan...
Ngày tải lên: 31/03/2014, 01:20
Báo cáo khoa học: "Performance of different provenances and of the local population of the Monterey pine (Pinus radiata D Don) in northern Spain" pot
... collected, dried at one main point and the seeds then redistributed again The populations of California were composed of several subprovenances formed by stands based on ecological and environmental ... study is limited by the age of the trees and by the lack of different trial sites, further studies are necessary to ensure the obtained results The hypothesis tha...
Ngày tải lên: 08/08/2014, 19:21
Báo cáo y học: "Identification of bacteria on the surface of clinically infected and non-infected prosthetic hip joints removed during revision arthroplasties by 16S rRNA gene sequencing and by microbiological culture" doc
... study was to identify bacteria within the biofilms on the surface of clinically infected and non -infected prosthetic hip joints by using both 16S rRNA- based molecular detection methods and conventional ... rRNA gene sequencing of isolates from 10 prosthetic hip joints Species Table shows the isolates obtained from the 10 prosthetic hip...
Ngày tải lên: 09/08/2014, 10:20
Báo cáo y học: "Identification of progressors in osteoarthritis by combining biochemical and MRI-based markers" pptx
... quantification in clinical studies sors from early progressors Prognostic ability of key markers for separating healthy non -progressors from early progressors Early progressors were defined by whether ... observations in the analysis We perform this in two alternative ways in the analysis Firstly, we combine the two knee measurements into a single subject measurement by...
Ngày tải lên: 09/08/2014, 14:22
Báo cáo y học: " Decorin and TGF-β1 polymorphisms and development of COPD in a general population" ppt
... morphogenesis.[7 ]TGF-β1 has been shown to downregulate synthesis of decorin in fibroblasts and decorin can in turn inhibit TGF-β1. [8] Decorin may thus act as a negative feedback regulator of TGF-β1 mediated repair ... transplantation Transplantation 1998, 66:1014-1020 Imai K, Hiramatsu A, Fukushima D, Pierschbacher MD, Okada Y: Degradation of decorin by matrix me...
Ngày tải lên: 12/08/2014, 16:20
Báo cáo khoa học: "Metabolic and endocrine profiles and reproductive parameters in dairy cows under grazing conditions: effect of polymorphisms in somatotropic axis genes" doc
... al.: Metabolic and endocrine profiles and reproductive parameters in dairy cows under grazing conditions: effect of polymorphisms in somatotropic axis genes Acta Veterinaria Scandinavica 2011 53:35 ... Page of 10 Table F-tests of fixed effects included in the model for productive /reproductive parameters and metabolic/ endocrine variables and...
Ngày tải lên: 12/08/2014, 18:22
Identification of antioxidants in dark soy sauce
... List of Figures and Chart vi List of Symbols ix Chapter Introduction 1.1 A brief history of soy sauce 1.2 The methodology of preparation of soy sauce 1.3 The functional components of soy sauce ... 4.2 Content of maltol and its contribution to the TAA of dark soy sauce A considerable part of the TAA of the dark soy sauce was contained in MeOH-R a...
Ngày tải lên: 09/10/2015, 10:49
Báo cáo " Analysis and identification of multi-variate random pressure fields using covariance and spectral proper transformations " pdf
... events of the unsteady pressure fields Synthesis and identification of random pressure field Firstly, effects of basic and cumulative covariance modes on the synthesis of the unsteady pressure fields, ... of basic and cumulative spectral modes on spectral synthesis of pressure position Secondly, effects of basic and cumulative spectral pressure m...
Ngày tải lên: 05/03/2014, 14:20
Identification of serum proteomic biomarkers for early porcine reproductive and respiratory syndrome (PRRS) infection pptx
... doi:10.1186/1477-5956-10-48 Cite this article as: Genini et al.: Identification of serum proteomic biomarkers for early porcine reproductive and respiratory syndrome (PRRS) infection Proteome Science 2012 10:48 Submit ... Tong GZ: Origin of highly pathogenic porcine reproductive and respiratory syndrome virus, China Emerg Infect Dis 2010, 16:365–367 Z...
Ngày tải lên: 05/03/2014, 17:20
Impact of oral health on quality of life among the elderly population of Joaçaba, Santa Catarina, Brazil pptx
... about their health condition Therefore, the purpose of this study was to assess the impact of oral health on the quality of life of the elderly population in the city of Joaçaba, SC, Southern Brazil ... Grasel CE Impact of oral health on quality of life among the elderly population of Joaçaba, Santa Catarina, Brazil B...
Ngày tải lên: 22/03/2014, 14:20
Báo cáo khoa học: Mammalian transglutaminases Identification of substrates as a key to physiological function and physiopathological relevance pot
... intracellular signalling and apoptosis, as well as in neurodegenerative and autoimmune diseases Consequently, its function may depend on its subcellular and cellular localization and on access to proteins ... Esposito and I Caputo 132 Akagi A, Tajima S, Ishibashi A, Matsubara Y, Takehana M, Kobayashi S & Yamaguchi, N (2002) Type XVI collagen is expressed in factor XIIIa+ m...
Ngày tải lên: 30/03/2014, 15:20