chromelosporium sp a conidiophore b detail of conidiophores and conidia c

báo cáo khoa học: " Seroprevalence of HIV, hepatitis b, and hepatitis c among opioid drug users on methadone treatment in the netherlands" ppt

... receive such screening For HBV, this could be affected given that a specific group of drug users, such as IDUs and ODUs, should get vaccinated as part of the national hepatitis B vaccination campaign ... acquisition of data, and analysis and interpretation of data; and contributed to the manuscript MvdS and CB have been involved in drafting the manuscript or revising it critically for important ... HBV, and HCV infections are of vital importance to provide adequate treatment which can interrupt ongoing transmission and lead to a general gain in health benefit List of abbreviations EMCDDA:...

Báo cáo y học: " Mitogen-activated protein kinases and NFκB are involved in SP-A-enhanced responses of macrophages to " pdf

Danh mục: Báo cáo khoa học

... these pathways are activated by BCG alone and that opsonization of BCG with SP- A leads to enhanced activation of both pathways, contributing to increased intracellular BCG killing Materials and ... B/ S+HA Figure bone marrow inhibits BCGHerbimycin A macrophages and SP- A- BCG killing by rat Herbimycin A inhibits BCG- and SP- A- BCG killing by rat bone marrow macrophages RBMM were incubated with BCG ... decrease in cell viability 10 ** BCG B/ S B+ HA B/ S+HA Figure tion of nitric oxide Herbimycin A inhibits BCG- and SP- A- BCG-induced producHerbimycin A inhibits BCG- and SP- A- BCG-induced production...

Tài liệu Báo cáo khoa học: Enhanced thermostability of methyl parathion hydrolase from Ochrobactrum sp. M231 by rational engineering of a glycine to proline mutation pdf

Danh mục: Báo cáo khoa học

... 5¢-TAGAATTCGCTGCTCCACAA GTTAGAACT-3¢ Reverse: 5¢-TAGCGGCCGCTTACTTTGGGTTA ACGACGGA-3¢ 5¢-CCTGACGATTCTAAACCGTTCTTCAAGGGTGCC-3¢ 5¢-AAAGGTTTCTTCAAGCCGGCCATGGCTTCCCTT-3¢ 5¢-CCTGACGATTCTAAACCGTTCTTCAAGCCGG ... Gribenko AV, Patel MM, Liu J, McCallum SA, Wang C & Makhatadze GI (2009) Rational stabilization of enzymes by computational redesign of surface chargecharge interactions Proc Natl Acad Sci USA ... grade Construction of WT Ochr-MPH and mutants Genomic DNA of Ochrobactrum sp M231 was extracted using a bacterial DNA extraction kit (Tiangen Biotech, Beijing, China) according to the manufacturer’s...

Báo cáo khoa học: Coordination of three and four Cu(I) to the a- and b-domain of vertebrate Zn-metallothionein-1, respectively, induces signiﬁcant structural changes doc

Danh mục: Báo cáo khoa học

... individual a- and b- domains The individual a- and b- domains (KSCCSCCPVGCSKCA QGCVCKGAADKCTCCA and MDPNCSCSTGGSCTCT NaCl ⁄ CitACKNCKCTSCK) of murine MT-1 consisting of residues 31–60 and 1–30 of the ... indicated b- Domain Proton Asn (a) Asn (a) Asn (b) Cys (a) Cys (b) Asn 23 (b) a- Domain Lys (NH) Lys (a) Ser (b) Ser (HN) Cys (HN) Cys (a) Cys (b) Ser (b) Cys (a) Cys (a) Cys (a) Cys (b) Cys (b) Cys ... form a distorted chair The C- terminal a- domain is characterized by an adamantane-like four-metal cluster Solution structures of 113 Cd-substituted Cd7MT-2 from rabbit, rat and human are available...

Báo cáo khoa học: Identiﬁcation and characterization of B¢¢-subunits of protein phosphatase 2 A in Xenopus laevis oocytes and adult tissues Evidence for an independent N-terminal splice variant of PR130 and an extended human PR48 protein pot

Danh mục: Báo cáo khoa học

... 70034 ttacagGTTTCT ctgcagGCTGTG ttttagATTCAA ttgcagGTCTGT ttatagGTTGCT tttcagGATGTG aaccagGTTATT tttcagACCCTA atttagCTTCAT ctttagGGGAAA atctagCATTGA atgtagGCAAAA aatcagGATGTT tttcagCTTTGA gene ... TTGCAGgaga ACCACGgggt CTGCAGgcgg ACCACGgcgt CACACGacgt GACCAGgggt CTGAAGgatg CTCAGGgagt GGACGGgagt 21707 13715 253 458 440 501 2746 486 366 1142 67 4086 cttcGTTCAG ccccGCCTGC ttccAATCCT ccgcGACGTG ... TGAGCAAAGTCTTCAATG-3¢ and 5¢-GGAATTCAG TGGAAAAACTTTACAT-3¢ for XPR130, the primers 5¢-GTTCCTGAGCAAAGTCTTCAATG-3¢ and 5¢-GG AATTCAGTGGAAAAACTTTACAT-3¢ for XN73, and the primers 5¢-GGAATTCATGCCGACCACAACCGTT...

Báo cáo khoa học: Ternary complex formation of pVHL, elongin B and elongin C visualized in living cells by a ﬂuorescence resonance energy transfer–ﬂuorescence lifetime imaging microscopy technique docx

Danh mục: Báo cáo khoa học

... TTAACCCGGGATATCCAGGTCTTCCTCACTGATCA GCTTCTGTTCCTCCATGGTGGT-3¢, and 5¢-CTAGAC CACCATGGACTACAAAGACGATGACGATAAAGAT ATCCCGGGTTAACT-3¢ and 5¢-CTAGAGTTAACCCGG GATATCTTTATCGTCATCGTCTTTGTAGTCCATGG TGGT-3¢, respectively pBOS-HA-pVHL ... oligonucleotides, 5¢-CTAGAC CACCATGTACCCCTACGACGTGCCCGACTACGCCG ATATCCCGGGTTAACT-3¢ and 5¢-CTAGAGTTAACC CGGGATATCGGCGTAGTCGGGCACGTCGTAGGGG TACATGGTGGT-3¢, into the XbaI site of pBOS Vector pBOS-Myc ... pBOS-Myc and pBOSFlag were constructed similarly by using the synthesized oligonucleotides 5¢-CTAGACCA CCATGGAGGAACAGAAGCTGATCAGTGAGGAAG ACCTGGATATCCCGGGTTAACT-3¢ and 5¢-CTAGAG TTAACCCGGGATATCCAGGTCTTCCTCACTGATCA...

Báo cáo khoa học: Expressed as the sole Hsp90 of yeast, the a and b isoforms of human Hsp90 differ with regard to their capacities for activation of certain client proteins, whereas only Hsp90b generates sensitivity to the Hsp90 inhibitor radicicol pdf

Danh mục: Báo cáo khoa học

... pBDC [34] (Hsp9 0a, forward primer GCTTGAAGCAAGCCTCGATGCCT GAGGAAACCCAGACCCAA, reverse primer CAGT AGCTTCATCTTTTCGGTCTACTTCTTCCATGCGTGA; Hsp9 0b, forward primer GCTTGAAGCAAGCCTCGAT GCCTGAGGAAGTGCACCATGGA, ... was constructed by PCR ampliﬁcation of the Hsp9 0a ORF using the forward primer AAATAAGTCG ACATGCCTGAGGAAACCCAG (SalI site underlined; Hsp9 0a start codon in bold) and the reverse primer CTTC ATCTGCAGTTAGTCTACTTCTTCCAT ... GCCTGAGGAAGTGCACCATGGA, reverse primer CA GTAGCTTCATCTTTCGATCGACTTCTTCCATGCGA GA) The second PCR used a universal pair of primers [34,48] PJ69- 4a [48] was then transformed with the product of this second PCR...

Báo cáo khoa học: Characterization of the 5¢ untranslated region of a and b isoforms of the human thromboxane A2 receptor (TP) Differential promoter utilization by the TP isoforms doc

Danh mục: Báo cáo khoa học

... was ampliﬁed using the sense primer Kin110 (5¢-dGAGAGGTACCGTGCTGCTCTACTGC CCCACC-3¢, corresponding to nucleotides )3308 to )3287) and the antisense primer Kin111 (5¢-dAGAGAC GCGTCTGTAATCCAGCTACTCGGGAG-3¢, ... 5¢-dCAGCCGTCTCTCCTCCAGGGT-3¢ (+72 to +52, Exon 2); Kin3: 5¢-dTGTGGGCCGGAAACAGGGC-3¢ (+45 to +27, Exon 2); Kin6: 5¢-dGTGGCCCAACGG CAGTTC-3¢ (+3 to +20, Exon 2); Kin16: 5¢-dGAGAT GATGGCTCAGCTCCT-3¢ ... thymocytes [30] TXA2 has been implicated as a mediator of a number of vascular disorders including thrombosis, unstable angina, myocardial infarction, pregnancy-induced hypertension, bronchial asthma...

Báo cáo y học: "Successful outcome of a pregnancy in a woman with advanced cirrhosis due to hepatitis B surface antigenemia, delta super-infection and hepatitis C co-infection: a case report" pdf

Danh mục: Báo cáo khoa học

... esophageal transection and beta-blockers are the therapeutic options for such patients [2,3] Screening EGD was done in our case and prophylactic variceal band ligations were applied on two occasions Fortunately ... small esophageal varices and mild portal gastropathy The baby was given active and passive immunization against hepatitis B At the age of 18 months the baby's blood was tested for hepatitis B and ... evidence, such as the presence of esophageal varices, abdominal collateral veins, hypersplenism and ascites Endoscopic variceal band ligation or sclerotherapy, portosystemic shunting, esophageal...

báo cáo khoa học: " A linkage map for the B-genome of Arachis (Fabaceae) and its synteny to the A-genome" doc

Danh mục: Báo cáo khoa học

... food, being a valuable source of protein and oil [1,2] The genus Arachis (Leguminosae or Fabaceae) is native to South America and contains 80 described species assembled into nine taxonomical sections, ... development and analysis, and participated in drafting the manuscript Additional material Additional File Data of crossings between A ipaënsis (accession K30076) and A magna (K30097) The data provides ... Taxonomia del genero Arachis (Leguminosae) Bonplandia (Argentina) 1994, 8(1–4):1-186 Valls JFM, Simpson CE: New species of Arachis L (Leguminosae) from Brazil, Paraguay and Bolivia Bonplandia...

Báo cáo y học: "Coccidioides posadasii infection alters the expression of pulmonary surfactant proteins (SP)-A and SP-D" pps

Danh mục: Báo cáo khoa học

... Immunosorbent Assay (ELISA) for SP- A and SP- D The concentrations of SP- A and SP- D were measured in BALF samples as described earlier [20] The antibodies against SP- A and SP- D reacted with 34 kDa (SP- A) ... Acknowledgements Authors acknowledge the technical assistance of Adrian Donias and Amy Chein in animal studies We also thank Dr Rebecca A Cox (UTHSCSA, San Antonio, TX), Dr Richard J King (UTHSCSA, San Antonio, ... (CDN-lysate SP- A and (B) SP- D Binding of (A) and CDN-filtrate) to Coccidioidal antigens Binding of (A) SP- A and (B) SP- D to Coccidioidal antigens (CDN-lysate and CDN-filtrate) The binding of 1–10 µg/ml...

Báo cáo y học: "Analysis of N-terminal pro-B-type natriuretic peptide and cardiac index in multiple injured patients: a prospective cohort study" docx

Danh mục: Báo cáo khoa học

... inflammationinduced cardiac contractile dysfunction remains unclear Regarding the assessment of cardiac function, traditional approaches include Swan-Ganz catheterization or echocardiography [3] ... to be statistically significant For calculating the correlations between NT-proBNP values and MODS score as well as between NT-proBNP values and CI, bivariate analyses with Spearman correlation ... intravascular volume loss and therefore as an initial marker of bleeding Stewart and colleagues [4] recently analyzed BNP and transthoracic echocardiogram in trauma patients and found no correlation...

A STUDY IN THE SELECTIVE POLYMORPHISM OF a AND b GLYCINE IN PURE AND MIXED SOLVENT

Danh mục: Cao đẳng - Đại học

... Molecular Dynamics MI Morphologically Important BFDH Bravais-Friedel-Donnay-Harker rule BCF Burton-Cabrera-Frank theory PBC Periodic Bond Chain analysis ISA Interface Structure Analysis SCF Self-Consistent ... diffusion could be analyzed in a classical way; however, the quantification of the surface diffusion requires consideration of the interface structure along with the physical and chemical nature of ... computational tools and algorithms used to analyze molecular configurations and calculate appropriate averages and correlation functions Such tools must not only sample and reduce ‘noise’ in the data,...

Physiology Of A Marine Beggiatoa Strain And The Accompanying Organism Pseudovibrio Sp. – A Facultatively Oligotrophic Bacterium

Danh mục: Tổng hợp

... genus contains metabolically versatile and symbiotically interacting bacteria 53 Chapter − Isolation and cultivation of Pseudovibrio sp and other facultatively oligotrophic bacteria 55 4.1 Substrate ... metabolisms of bacteria Redox reactions always combine the reduction of an electron acceptor with the oxidation of an electron donor In nearly all cases, electron acceptor and donor are composed of different ... dissolved combined amino acids (DCAA) and monosaccharides The utilization of these substances can cover to 93% of the carbon demand of the bacteria and to 100% of the nitrogen demand (Fuhrman, 1987;...

Flashcard blueup – A bit of English on your journey!

Danh mục: Kỹ năng viết tiếng Anh

... vựng, chia thành 15 kh c thu c từ “TOEFL iBT Exam Vocabulary List” Michael Buckhoff B a TOEFL iBT B a TOEFL iBT Nếu b n b t đầu c ý định thi chứng TOEFL thẻ h c từ vựng blueup TOEFL dành cho b n ... trường c sản phẩm blueup TOEFL blueup TOEFL C c từ nhanh chóng c mặt thời gian tới Giới thiệu blueup IELTS B sản phẩm flashcard blueup IELTS bao gồm 1100 từ vựng, chia thành 11 kh c thu c từ “Cambridge ... “Cambridge Vocabulary for IELTS” Pauline Cullen B a IELTS B a IELTS2 blueup hy vọng với blueup IELTS giúp b n tạo tảng vững trư c tham gia kỳ thi IELST blueup triển khai IELTS IELTS Mua flashcard...

10
1,485
3

Báo cáo y học: "Eosinopenia is a reliable marker of sepsis on admission to medical intensive care units"

Danh mục: Y học thưởng thức

... itself, presumably by chemotactic substances released during acute inflammation The major chemotactic substances include C 5a and fibrin fragments that Available online http://ccforum.com/content/12/2/R59 ... Morocco Acta Anaesthesiol Scand 2007, 51:189-197 A ssaoui Y, Zeggwagh AA, Zekraoui A, Abidi K, Abouqal R: Validation of a behavioral pain scale in critically ill, sedated, and mechanically ventilated ... obtained according to the clinical circumstance and before antibiotics were given Empirical antibiotic treatment was based on the presumptive diagnosis and received on the day of bacteriological...

Báo cáo y học: "Comparative study of control selection in a national population -based case-control study: Estimating risk of smoking on cancer deaths in Chinese men"

Danh mục: Y học thưởng thức

... Med Sci 2009, equivalence in esophagus cancer, stomach cancer, liver cancer, pancreas cancer, lung cancer cancers, and cancers on the minor sites, whereas the equivalence is uncertain for bladder ... rare cancer death rates are too low to be stable; (2) a difference in the accuracy of certificated cause of death between urban and rural counties; (3) large fluctuations in Chinese social circumstances ... and cancer deaths, was not measured in this study, and the separate calculation of risk patterns in urban and rural areas was used as a surrogate analysis by socioeconomic status In conclusion,...

Báo cáo y học: " Laugh Yourself into a Healthier Person: A Cross Cultural Analysis of the Effects of Varying Levels of Laughter on Health"

Danh mục: Y học thưởng thức

... as a form of exercise and as an emotional response triggers bronchial asthma, and thus a potent stimulus Specifically, the physical aspect (exercise) of laughter was considered to cause exercise ... exercise associated bronchial asthma which is prevalent at a later age (18,19, 20) According to Gayrard P, 52.4% of 143 asthmatics stated their attacks of bronchial asthma were induced by laughing ... management of various medical conditions Methods The study was approved by the ethics board of research at Mahatma Gandhi Mission’s (MGM) Medical College, Aurangabad (AUR) Participants A total of 730...

The impact of technology on team functioning within a given organization

Danh mục: Quản trị kinh doanh

... experience Team work is useful because a lot of advantages: a combination of strengths, a range of opinion, divided responsibility, team spirit, administration and increase facility Actually, if ... work as a team can distribute and specialize work, which produce advantages for every member.It also means that “manager can spend more time with each person on a smaller team as necessary”.4 Besides, ... objectives and get a better decision Various factors lead to effective teamwork at Texas Instruments and the influences that threaten success: a Various factors lead to effective teamwork: According...

9
3,188
2

Tài liệu Activity 7.2: Determining the Impact of Technology on a Windows DNA Design docx

Danh mục: Tin học văn phòng

... Determining the Impact of Technology on a Windows DNA Design 51 Write your answers in the table below User Interface User Services Business Services Data Access Data Store Communication Operating Systems ... provided After completing the above steps, you will discuss your responses with the class The instructor will write the class consensus on a flip chart Use the space below for brainstorming Activity ... Services Development Tools Data Access Data Storage Security After completing the above steps, you will discuss your responses with the class The instructor will write the class consensus on a flipchart...

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008

chromelosporium sp a conidiophore b detail of conidiophores and conidia c antagonistic effect of in937rif on a chromelosporium spp colony