Tài liệu Báo cáo khoa học: Enhanced thermostability of methyl parathion hydrolase from Ochrobactrum sp. M231 by rational engineering of a glycine to proline mutation pdf

Enhanced thermostability of methyl parathion hydrolase from Ochrobactrum sp. M231 by rational engineering of a glycine to proline mutation Jian Tian, Ping Wang, Shan Gao, Xiaoyu Chu, Ningfeng Wu and Yunliu Fan Biotechnology Research Institute, Chinese Academy of Agricultural Sciences, Beijing, China Introduction Methyl parathion is an organophosphate pesticide that has been used extensively in agriculture [1–7]. It is an acetylcholinesterase inhibitor – a neurotoxin that can cause wide-scale environmental pollution [1,4,8,9]. Methyl parathion hydrolase (MPH; EC 3.1.8.1), iso- lated from the soil bacterium Ochrobactrum sp. M231 (Ochr-MPH), is a 33-kDa organophosphate hydrolase. Although it degrades methyl parathion efficiently, it has poor thermostability, which can affect the applica- tion of the enzyme [7]. Having previously cloned the mph gene from Ochrobactrum sp. M231 [7], we sought to increase the thermostability of this MPH using pro- tein engineering. The two main protein-engineering strategies that can be used to increase protein thermostability are rational design and random mutagenesis [10–12]. Of these two Keywords methyl parathion hydrolase; molecular dynamics; proline theory; thermostability Correspondence Ningfeng Wu, Biotechnology Research Institute, Chinese Academy of Agricultural Sciences, 12 Zhongguancun South Street, Beijing 100081, China Fax: +86 10 821 09844 Tel.: +86 10 821 09844 E-mail: wunf@caas.net.cn (Received 13 September 2010, revised 25 September 2010, accepted 27 September 2010) doi:10.1111/j.1742-4658.2010.07895.x Protein thermostability can be increased by some glycine to proline muta- tions in a target protein. However, not all glycine to proline mutations can improve protein thermostability, and this method is suitable only at care- fully selected mutation sites that can accommodate structural stabilization. In this study, homology modeling and molecular dynamics simulations were used to select appropriate glycine to proline mutations to improve protein thermostability, and the effect of the selected mutations was proved by the experiments. The structure of methyl parathion hydrolase (MPH) from Ochrobactrum sp. M231 (Ochr-MPH) was constructed by homology modeling, and molecular dynamics simulations were performed on the modeled structure. A profile of the root mean square fluctuations of Ochr- MPH was calculated at the nanosecond timescale, and an eight-amino acid loop region (residues 186–193) was identified as having high conforma- tional fluctuation. The two glycines nearest to this region were selected as mutation targets that might affect protein flexibility in the vicinity. The structures and conformational fluctuations of two single mutants (G194P and G198P) and one double mutant (G194P ⁄ G198P) were modeled and analyzed using molecular dynamics simulations. The results predicted that the mutant G194P had the decreased conformational fluctuation in the loop region and might increase the thermostability of Ochr-MPH. The thermostability and kinetic behavior of the wild-type and three mutant enzymes were measured. The results were consistent with the computa- tional predictions, and the mutant G194P was found to have higher ther- mostability than the wild-type enzyme. Abbreviations 3D, three dimensional; MDS, molecular dynamics simulations; MPH, methyl parathion hydrolase; Ochr-MPH, methyl parathion hydrolase from Ochrobactrum sp. M231; rmsd, root mean square deviation; rmsf, root mean square fluctuation; T 50 , the temperature at which the enzyme lost 50% of its activity; T m , the unfolding temperature measured using CD; WT, wild type. FEBS Journal 277 (2010) 4901–4908 ª 2010 The Authors Journal compilation ª 2010 FEBS 4901 methods, computer-assisted rational design is an inex- pensive and straightforward route to engineer improved protein thermostability, because site-directed mutagenesis techniques have been well developed [10,11,13,14]. However, many factors affect protein thermostability, and no clear-cut guarantees of success exist [11,12,15–17]. Glycine, the only amino acid that lacks a b-carbon, has the highest conformational entropy [18], while pro- line can adopt only a few configurations and has the lowest conformational entropy [19,20]. A glycine to proline mutation could therefore decrease the confor- mational entropy of a protein and lead to stabilization [21–25]. This ‘proline theory’ was proposed by Suzuki et al. [22,23] and has been used successfully to improve the thermostability of many enzymes [25–27]. How- ever, not all glycine to proline mutations can improve protein thermostability, and this method is suitable only at carefully selected mutation sites that can provide structural stabilization [13,19,25,27]. Using molecular dynamics simulations (MDS), pro- tein conformational changes can be studied over small time increments (in the ps range) [28]. By calculating the root mean square deviation (rmsd) and root mean square fluctuation (rmsf) values for backbone atoms, thermally sensitive or conformationally flexible regions of a protein can be identified [29]. In this study, the structure of Ochr-MPH was con- structed through homology modeling. MDS were per- formed on the modeled structure to examine the region with the greatest conformational fluctuation. The only two glycines near this region, G194 and G198, were selected as mutation targets. Structures of the hypothetical mutants, namely G194P, G198P and G194P ⁄ G198P, were modeled and analyzed using MDS to test the effect of the mutations; the mutant G194P was predicted to have increased thermostabil- ity. This prediction was also supported by experimen- tal data on the thermostability the wild-type (WT) and mutant proteins expressed in Escherichia coli. Results and Discussion Three-dimensional model of Ochr-MPH The three-dimensional (3D) structure of Ochr-MPH was modeled using the crystal structure of MPH (PDB ID: 1P9E) obtained from Pseudomonas sp. WBC3 as the template [6]. The resulting model for Ochr-MPH is shown in Fig. 1; it can be described as an ab ⁄ ba sand- wich typical of the metallo-hydrolase ⁄ oxidoreductase fold [6]. The final model of Ochr-MPH, as determined using discovery studio 2.5.5 software, possessed good stereochemical quality with only one residue (Asp112) located out of the generously allowed regions in the Ramachandran plot. MDS to predict the effect of mutations on protein stability MDS were performed on the modeled structure of Ochr-MPH using gromacs 4.05 [30]. The rmsd values of the backbone atoms for Ochr-MPH are shown in Fig. 2, for which the reference structure was the struc- ture obtained from the equilibration step performed immediately before the MDS run. The conformation of Ochr-MPH became stable during the MDS after 3000 ps (Fig. 2). rmsf values reflect fluctuation at individual residues – a higher rmsf value indicates less stability [31–33]. As shown in Fig. 3, residues 186-193 of Ochr-MPH gave the highest rmsf values. These residues are located at the protein surface, in a loop region, between a b-strand and a-helix (shown in Fig. 1). Two glycine residues, G194 and G198, lie just beyond the C-terminal end of this region. G194 and G198 were therefore cho- sen as target sites for the glycine to proline mutation. The 3D models of the three mutants (G194P, G194P ⁄ G198P and G198P) were constructed using the standard mutation protocol of the discovery studio Fig. 1. Ribbon plot of the three-dimensional structure of Ochr- MPH, using Pseud-MPH (PDB ID: 1P9E) as the template. Key resi- dues in the active site are shown in green, and the two Zn ions are shown in silver. Gly194 is shown in red, and Gly198 is shown in yellow. The region (residues 186–193) with greatest conformational fluctuation is shown in purple. Enhanced thermostability of methyl parathion hydrolase J. Tian et al. 4902 FEBS Journal 277 (2010) 4901–4908 ª 2010 The Authors Journal compilation ª 2010 FEBS software. MDS were executed for 5 ns on the three modeled structures (G194P, G194P ⁄ G198P and G198P) using Gromacs 4.05 [30]. The calculated rmsd and rmsf values are shown in Figs 2 and 3, respec- tively. Similarly to the WT Ochr-MPH, the conforma- tions of the three mutants became stable during the MDS after 3000 ps (Fig. 2). The average rmsd values over the final 2 ns were as follows: 0.43 ± 0.01 nm for WT Ochr-MPH, 0.31 ± 0.02 nm for the G194P mutant, 0.44 ± 0.03 nm for the G194P ⁄ G198P mutant, and 0.42 ± 0.02 nm for the G198P mutant. During the simulation, rmsf values of residues 186-193 for the mutant G194P were lowest among the WT and three mutants (Fig. 3), indicating that a more stable conformation was achieved for these residues. Kinetic characterization of WT and mutant enzymes The genes encoding the WT and mutant enzymes were cloned and expressed in E. coli. After purification, each of the expressed proteins migrated as a single band, of 33 kDa apparent molecular mass, on SDS ⁄ PAGE (Fig. 4). Kinetic parameters of WT and mutant enzymes were measured as described in the Materials and meth- ods, and the results are shown in Table 1. All mutants had methyl parathion hydrolase activity, but the mutant G194P had a higher overall catalytic efficiency (k cat ⁄ K m ) than the other mutants and the WT enzyme. The overall catalytic efficiency (k cat ⁄ K m ) of the mutant G198P was lower than that of the WT enzyme. The overall catalytic efficiency (k cat ⁄ K m ) of the double point mutant (G194P ⁄ G198P) was similar to that of the WT enzyme and between those of G194P and G198P. Thermostability of WT and mutant enzymes The thermostability of the WT and mutant enzymes was determined by measuring residual activity after incubation for 10 min at various temperatures (Fig. 5). The temperature at which the G194P mutant lost 50% of its activity (T 50 ) was approximately 67 °C, which is higher than that for the WT enzyme (62 °C), and for the G194P⁄ G198P (61 °C) and G198P (54 °C) mutants, as shown in Table 1, whereas the T 50 of G198P was lower than that of the WT enzyme. The T 50 of the double point mutant (G194P ⁄ G198P) was similar to that of the WT enzyme and between those of G194P and G198P. To further investigate the thermostability of the WT and mutant enzymes, the unfolding temperature (T m ) was measured using CD spectroscopy. The CD spectra Fig. 2. rmsd values during a 5.0-ns MDS for WT MPH and mutant enzymes (G194P, G194P ⁄ G198P and G198P). Fig. 3. rmsf values calculated over the last 2 ns time window for WT MPH and mutant enzymes (G194P, G194P ⁄ G198P and G198P). Fig. 4. SDS ⁄ PAGE analysis of the purified WT MPH and mutant enzymes (G194P, G194P ⁄ G198P and G198P). Lane 1, purified WT MPH; lane 2, purified G194P; lane 3, purified G194P ⁄ G198P; lane 4, purified G198P; and lane 5, protein marker. The positions of the molecular mass markers are shown on the right side of the picture. J. Tian et al. Enhanced thermostability of methyl parathion hydrolase FEBS Journal 277 (2010) 4901–4908 ª 2010 The Authors Journal compilation ª 2010 FEBS 4903 of the WT and mutant enzymes at 25 °C were measured from 190 to 240 nm at pH 7.4 and found to be identical. Then, the enzyme samples were heated from 20 to 86 °C and the CD signals of the enzyme were read at 222 nm using the MOS-450 (Bio-Logic, Grenoble, France). The T m values, as shown in Table 1, were determined at the unfolding curves (Fig. 6). The mutants of G194P and G194P ⁄ G198P showed T m values that were 3.3 °C and 0.6 °C higher, respectively, than that of the WT enzyme (Table 1). The T m of mutant G198P was 1.0 °C lower than that of the WT enzyme. These experimental results indicate that replacing G194 with proline enhances the thermal stability of Ochr-MPH; however, replacing G198 of Ochr-MPH with proline did not improve the thermostability. The thermostability of the double point mutant (G194P ⁄ G198P) was similar to that of the WT enzyme and between those of G194P and G198P. These experi- mental results are in agreement with the MDS results. The results suggest that determining regions of higher conformational fluctuation using MDS is a powerful method to guide selective mutation of glycine to pro- line to decrease conformational fluctuation, thereby increasing thermostability. Structure energy of WT and mutant enzymes The structure energies of WT and mutant enzymes were also calculated with the CHARMm force field [34] using the software discovery studio 2.5.5. The potential energy of the G194P mutant was 33.7 kcalÆmol )1 lower than that of the WT enzyme, which indicated that the structure of G194P was more stable than that of the WT enzyme, as shown in Table 2. The structural stabil- ity induced by the G194P mutant was mainly a result of the enhanced electrostatic interaction and van der Waals interactions, as the electrostatic and van der Waals energies of the G194P were lower than those of the WT enzyme (Table 2). As the structure of the G194P mutant become more stable than that of the WT enzyme, the rmsf values (calculated by the MDS) of the residues would be reduced, which is demonstrated in Fig. 3. As a result, the G194P mutant exhibited better thermostability than the WT enzyme. Table 1. Comparison of properties of the WT (Ochr-MPH) and mutant (G194P, G198P and G194P ⁄ G198P) enzymes. K m and k cat values were calculated by nonlinear regression analysis using GRAPHPAD PRISM. All values are expressed as mean ± SD, based on three separate experiments. Enzyme k cat (min )1 ) K m (lM) k cat ⁄ K m (lM )1 Æmin )1 ) T m (°C) T 50 (°C) Ochr-MPH 252.8 ± 12.64 76.25 ± 4.10 3.32 ± 0.34 67.0 62 G194P 454.70 ± 20.89 64.48 ± 3.41 7.05 ± 0.70 70.3 67 G198P 153.70 ± 6.30 92.70 ± 4.55 1.66 ± 0.15 66.0 54 G194P ⁄ G198P 288.80 ± 10.96 82.73 ± 4.16 3.49 ± 0.31 67.6 61 Fig. 5. Thermostability of WT and mutant (G194P, G194P ⁄ G198P and G198P) enzymes. The thermal stability of the enzymes was determined by monitoring residual enzymatic activity after incuba- tion for 10 min at various temperatures. Enzymatic activity was then assayed using the standard enzyme assay. Data points corre- spond to the mean values of three independent experiments. Fig. 6. Temperature-induced unfolding measured using CD spec- troscopy for WT MPH and mutant enzymes (G194P, G194P ⁄ G198P and G198P). Enhanced thermostability of methyl parathion hydrolase J. Tian et al. 4904 FEBS Journal 277 (2010) 4901–4908 ª 2010 The Authors Journal compilation ª 2010 FEBS Materials and methods Bacterial strains, plasmids, restriction enzymes and chemicals The bacterium Ochrobactrum sp. M231 was isolated from the soil at a pesticide factory in Tianjin, China, and stored in our laboratory [7]. The E. coli strains JM109 (Promega, Madison, WI, USA) and BL21 (DE3) (Nov- agen, Darmstadt, Germany) were used for recombinant plasmid amplification and protein expression, respectively. The vector pET-30a(+) (Novagen), which introduces a His6-tag (His-tagÔ; Novagen) at the N-terminus, was used for gene expression. All restriction enzymes were obtained from TaKaRa (Otsu, Japan). Isopropyl thio-b-d- galactoside, kanamycin and imidazole were purchased from Ameresco (Tully, NY, USA). All chemicals were of analytical grade. Construction of WT Ochr-MPH and mutants Genomic DNA of Ochrobactrum sp. M231 was extracted using a bacterial DNA extraction kit (Tiangen Biotech, Beijing, China) according to the manufacturer’s instruc- tions. The gene encoding MPH (GenBank accession no.: EU596456) was amplified from the genomic DNA using the PCR; the primers used in this PCR are shown in Table 3. The PCR product of the WT Ochr-MPH sequence was purified using a gel-extraction kit (Tiangen Biotech), digested with EcoRI and NotI, then ligated to the pET-30a(+) vector. Site-directed mutagenesis was per- formed using the overlap-extension PCR method [35] to generate the corresponding fragments for the following mutants: G194P, G198P and G194P ⁄ G198P. The primers used to construct mutant MPHs using the overlap-exten- sion method are shown in Table 3. PCR products of the mutants were also digested with EcoRI and NotI, and then cloned into pET-30a(+). DNA sequencing was performed to validate the insert genes at the State Key Laboratory of Crop Genetic Improvement, Chinese Academy of Agricul- tural Sciences (Beijing, China). The correct plasmids for the WT and mutant enzymes were then transformed into E. coli BL21 (DE3) for expression [36]. Purification and quantification of recombinant WT Ochr-MPH and mutants The N-terminus of each resulting recombinant protein was fused to a His6-tag that enabled purification using a Ni-ni- trilotriacetic acid His-bindÔ resin column (Novagen), according to the manufacturer’s instructions. As the obtained protein exhibited high concentrations of imidaz- ole, the protein was desalted with 50 mm Tris buffer (pH 8.0) to determine the kinetic parameters and with 10 mm NaCl ⁄ P i (pH 7.4) to determine the protein thermostability. The purified proteins were stored at )20 °C in aliquots until use. The purity of the proteins was analyzed by SDS ⁄ PAGE followed by staining with Coomassie Brilliant Blue (R250; Amersham Pharmacia Biotech, St Albans, UK) [36]. The concentrations of the purified proteins were determined using the Bio-Rad Protein Assay Kit (Bio-Rad, Hercules, CA, USA). Standard enzyme assay MPH activity was determined by measuring the release of the product, p-nitrophenol, from the substrate, methyl parathion [5,8]. The assay mixture (150 lL) contained 2 lL of 2 mgÆmL )1 methyl parathion, 50 lL of purified protein Table 2. The potential energy, van der Waals energy and electrostatic energy of the WT (Ochr-MPH) and mutant (G194P, G198P and G194P ⁄ G198P) enzymes. Calculation is based on the force field CHARMm. Values are in kcalÆmol )1 . Potential energy van der Waals energy Electrostatic energy Value a Difference b Value Difference Value Difference Ochr-MPH )16509.5 0.0 )2367.7 0.0 )11126.0 0.0 G194P )16543.2 )33.7 )2381.6 )13.9 )11388.9 )262.9 G194P ⁄ G198P )16477.8 31.7 )2394.3 )26.6 )11448.0 )322.0 G198P )16419.9 89.6 )2362.8 4.9 )11303.7 )177.7 a The corresponding energy value; b The energy difference between the protein and the WT MPH. Table 3. PCR primers for the wild-type (Ochr-MPH) and mutant (G194P, G198P and G194P ⁄ G198P) enzymes. Enzyme Primer sequence Wild-type MPH a Forward: 5¢-TAGAATTCGCTGCTCCACAA GTTAGAACT-3¢ Reverse: 5¢-TA GCGGCCGCTTACTTTGGGTTA ACGACGGA-3¢ Mutant MPH b G194P 5¢-CCTGACGATTCTAAACCGTTCTTCAAGGGTGCC-3¢ G198P 5¢-AAAGGTTTCTTCAAG CCGGCCATGGCTTCCCTT-3¢ G194P ⁄ G198P 5¢-CCTGACGATTCTAAA CCGTTCTTCAAGCCGG CCATGGCTTCCCTT-3¢ a The restriction sites EcoRI and NotI, introduced in the forward and reverse primers, respectively, are underlined. b The oligonu- cleotide sequence for the forward primer only is shown, and muta- tion sites are indicated by underlined sequences. J. Tian et al. Enhanced thermostability of methyl parathion hydrolase FEBS Journal 277 (2010) 4901–4908 ª 2010 The Authors Journal compilation ª 2010 FEBS 4905 (40 lgÆmL )1 ) and 98 lLof50mm Tris buffer, pH 8.0. The reactions were incubated at 37 °C for 6 min. The absor- bance of the liberated p-nitrophenol was measured at 405 nm. One unit of activity was defined as the amount of enzyme required to liberate 1 lmol of p-nitrophenol per minute at 37 °C. Determination of kinetic parameters Purified enzymes were diluted with 50 mm Tris buffer, pH 8.0, to a final concentration of 12 lgÆmL )1 . The MPH assay was performed at 37 °C using nine different concentrations of methyl parathion, ranging from 1 to 160 lm. Each test was carried out with at least three replicates. The K m and k cat val- ues were calculated by nonlinear regression using graphpad prism 5.0 (GraphPad Software Inc., La Jolla, CA, USA). Thermostability assay of WT and mutant enzymes All of the purified enzymes were diluted to 120 lgÆmL )1 with 50 mm Tris buffer (pH 8.0). The diluted enzymes were incubated at various temperatures, from 45 to 75 °C, for 10 min. Immediately after heating, the enzymes were placed on ice for 30 min. The residual MPH activity was measured using the assay described above, and at least three samples were run in parallel. CD spectrometry CD measurements of the WT and mutant enzymes were performed using a MOS-450 CD spectrometer (Bio-Logic, France) equipped with a TCU-250 Peltier-type temperature- control system. Spectra were recorded from 190 to 240 nm using a 1-mm cell and a bandwidth of 1 nm. The unfolding curves were measured at 222 nm, from 20 to 86 °C, using the temperature scan mode with a gradient of 1 °CÆmin )1 . The measurements were performed in 10 mm NaCl ⁄ P i (pH 7.4) using a protein concentration of 3 lm. Homology modeling of Ochr-MPH The tertiary structures of Ochr-MPH and the mutants (G194P, G198P and G194P ⁄ G198P) were modeled using MODELER, a component of the discovery studio soft- ware suite v2.5.5 (Accelrys Software Inc., San Diego, CA, USA). The X-ray crystallographic structure of MPH (PDB ID: 1P9E) obtained from Pseudomonas sp. WBC3 Pseud- MPH [6] was used as the template, as it had the highest sequence identity (98%) with the candidate sequence (Ochr- MPH). To ensure that the modeled structure was realistic, the values for the w and u angles of their Ramachandran plots were checked using the discovery studio software suite. MDS MDS were performed using Gromacs v4.0.5 [30], imple- menting the Gromos 96.1 (53A6) force field [37]. The ini- tial structure was solvated with a simple point-charge model of water in a box with a volume of 90 · 90 · 90 A ˚ 3 . A sufficient number of Cl ) ions were added to neutralize the positive charges in the system. The system was then subjected to a steepest descent energy minimization, and the 30-ps MDS was performed at 300 K, with the heavy atoms and Ca atoms fixed. Finally, a 5-ns MDS was performed on the whole system at 300 K. All bond lengths were constrained using the LINCS algo- rithm [38]. The cut-off value for van der Waals interac- tions was set at 1.0 nm, and electrostatic interactions were calculated using a particle mesh Ewald algorithm [39]. The time step of the simulation was set at 2 fs, and the coordi- nates were saved for analysis every 1 ps. Post-processing and analysis were performed using standard Gromacs tools and customized Perl scripts. Structure energy calculations The structures of the WT and mutant enzymes were minimized using the discovery studio 2.5.5 software with the ‘Minimization protocol’. The minimization algorithms of the Steepest Descent and Conjugate Gradient methods were used with a Generalized Born implicit solvent model [40]. The run steps of each mini- mization were set at 5000 steps. Then, the potential energy, van der Waals energy and electrostatic energy for the structures of the WT and mutant enzymes were determined with the discovery studio 2.5.5 software using the calculate energy protocol. Acknowledgements This work was supported by grants from National High Technology Research and Development Program of China (863 Program, 2007AA100605). References 1 Yang C, Freudl R, Qiao C & Mulchandani A (2010) Cotranslocation of methyl parathion hydrolase to the periplasm and of organophosphorus hydrolase to the cell surface of Escherichia coli by the Tat pathway and ice nucleation protein display system. Appl Environ Microbiol 76, 434–440. 2 Wang X, Wu N, Guo J, Chu X, Tian J, Yao B & Fan Y (2008) Phytodegradation of organophosphorus com- pounds by transgenic plants expressing a bacterial orga- nophosphorus hydrolase. Biochem Biophys Res Commun 365, 453–458. Enhanced thermostability of methyl parathion hydrolase J. Tian et al. 4906 FEBS Journal 277 (2010) 4901–4908 ª 2010 The Authors Journal compilation ª 2010 FEBS 3 Yu H, Yan X, Shen W, Hong Q, Zhang J, Shen Y & Li S (2009) Expression of methyl parathion hydrolase in Pichia pastoris. Curr Microbiol 59, 573– 578. 4 Yang C, Freudl R & Qiao C (2009) Export of methyl parathion hydrolase to the periplasm by the twin-argi- nine translocation pathway in Escherichia coli. J Agric Food Chem 57, 8901–8905. 5 Chu X, Wu N, Deng M, Tian J, Yao B & Fan Y (2006) Expression of organophosphorus hydrolase OPHC2 in Pichia pastoris: purification and characteriza- tion. Protein Expr Purif 49, 9–14. 6 Dong Y, Bartlam M, Sun L, Zhou Y, Zhang Z, Zhang C, Rao Z & Zhang X (2005) Crystal structure of methyl parathion hydrolase from Pseudomonas sp. WBC-3. J Mol Biol 353, 655–663. 7 Xiao W, Chu X, Tian J, Guo J & Wu N (2008) Cloning of a Methyl Parathion Hydrolase Gene from Ochrobactrum sp. J Agric Sci Technol (In Chinese) 10, 99–102. 8 Chu XY, Tian J, Wu NF & Fan YL (2010) An intra- molecular disulfide bond is required for the thermo- stability of methyl parathion hydrolase, OPHC2. Appl Microbiol Biotechnol 88 , 125–131. 9 Yang J, Yang C, Jiang H & Qiao C (2008) Overexpres- sion of methyl parathion hydrolase and its application in detoxification of organophosphates. Biodegradation 19, 831–839. 10 Choudhury D, Biswas S, Roy S & Dattagupta JK(2010) Improving thermostability of papain through structure- based protein engineering. Protein Eng Des Sel 23, 457–467. 11 Gribenko AV, Patel MM, Liu J, McCallum SA, Wang C & Makhatadze GI (2009) Rational stabilization of enzymes by computational redesign of surface charge- charge interactions. Proc Natl Acad Sci USA 106, 2601– 2606. 12 Tian J, Wu N, Chu X & Fan Y (2010) Predicting changes in protein thermostability brought about by single- or multi-site mutations. BMC Bioinformatics 11, 370. 13 Talakad JC, Wilderman PR, Davydov DR, Kumar S & Halpert JR (2010) Rational engineering of cytochromes P450 2B6 and 2B11 for enhanced stability: Insights into structural importance of residue 334. Arch Biochem Biophys 494, 151–158. 14 Han ZL, Han SY, Zheng SP & Lin Y (2009) Enhancing thermostability of a Rhizomucor miehei lipase by engi- neering a disulfide bond and displaying on the yeast cell surface. Appl Microbiol Biotechnol 85, 117–126. 15 Potapov V, Cohen M & Schreiber G (2009) Assessing computational methods for predicting protein stability upon mutation: good on average but not in the details. Protein Eng Des Sel 22, 553–560. 16 Bae E, Bannen RM & Phillips GN Jr (2008) Bioinfor- matic method for protein thermal stabilization by structural entropy optimization. Proc Natl Acad Sci USA 105, 9594–9597. 17 Lonquety M, Lacroix Z, Papandreou N & Chomilier J (2009) SPROUTS: a database for the evaluation of pro- tein stability upon point mutation. Nucleic Acids Res 37, D374–379. 18 Feng Y, Huang S, Zhang W, Zeng Z, Zou X, Zhong L, Peng J & Jing G (2004) The effects of amino acid replacements of glycine 20 on conformational stability and catalysis of staphylococcal nuclease. Biochimie 86, 893–901. 19 Trevino SR, Schaefer S, Scholtz JM & Pace CN (2007) Increasing protein conformational stability by optimiz- ing beta-turn sequence. J Mol Biol 373, 211–218. 20 Prajapati RS, Das M, Sreeramulu S, Sirajuddin M, Srinivasan S, Krishnamurthy V, Ranjani R, Ramakrish- nan C & Varadarajan R (2007) Thermodynamic effects of proline introduction on protein stability. Proteins 66, 480–491. 21 Vieille C & Zeikus GJ (2001) Hyperthermophilic enzymes: sources, uses, and molecular mechanisms for thermostability. Microbiol Mol Biol Rev 65, 1–43. 22 Watanabe K, Chishiro K, Kitamura K & Suzuki Y (1991) Proline residues responsible for thermostability occur with high frequency in the loop regions of an extremely thermostable oligo-1,6-glucosidase from Bacillus thermoglucosidasius KP1006. J Biol Chem 266, 24287–24294. 23 Suzuki Y, Hatagaki K & Oda H (1991) A hyperthermo- stable pullulanase produced by an extreme thermophile, Bacillus flavocaldarius KP 1228, and evidence for the proline theory of increasing protein thermostability. Appl Microbiol Biotechnol 34, 707–714. 24 Watanabe K, Kitamura K & Suzuki Y (1996) Analysis of the critical sites for protein thermostabilization by proline substitution in oligo-1,6-glucosidase from Bacil- lus coagulans ATCC 7050 and the evolutionary consid- eration of proline residues. Appl Environ Microbiol 62, 2066–2073. 25 Schultz DA, Friedman AM, White MA & Fox RO (2005) The crystal structure of the cis-proline to glycine variant (P114G) of ribonuclease A. Protein Sci 14, 2862–2870. 26 Goihberg E, Dym O, Tel-Or S, Levin I, Peretz M & Burstein Y (2007) A single proline substitution is critical for the thermostabilization of Clostridium beijerinckii alcohol dehydrogenase. Proteins 66, 196–204. 27 Zhou C, Xue Y & Ma Y (2010) Enhancing the thermo- stability of a-glucosidase from Thermoanaerobacter tengcongensis MB4 by single proline substitution. J Biosci Bioeng 110, 12–17. 28 Purmonen M, Valjakka J, Takkinen K, Laitinen T & Rouvinen J (2007) Molecular dynamics studies on the thermostability of family 11 xylanases. Protein Eng Des Sel 20, 551–559. J. Tian et al. Enhanced thermostability of methyl parathion hydrolase FEBS Journal 277 (2010) 4901–4908 ª 2010 The Authors Journal compilation ª 2010 FEBS 4907 29 Liu J, Yu H & Shen Z (2008) Insights into thermal sta- bility of thermophilic nitrile hydratases by molecular dynamics simulation. J Mol Graph Model 27, 529–535. 30 Van Der Spoel D, Lindahl E, Hess B, Groenhof G, Mark AE & Berendsen HJ (2005) GROMACS: fast, flexible, and free. J Comput Chem 26, 1701–1718. 31 Fujiwara R, Nakajima M, Yamamoto T, Nagao H & Yokoi T (2009) In silico and in vitro approaches to elu- cidate the thermal stability of human UDP-glucurono- syltransferase (UGT) 1A9. Drug Metab Pharmacokinet 24, 235–244. 32 Yan MC, Sha Y, Wang J, Xiong XQ, Ren JH & Cheng MS (2008) Molecular dynamics simulations of HIV-1 protease monomer: Assembly of N-terminus and C-terminus into beta-sheet in water solution. Proteins 70, 731–738. 33 Sun H, Jiang YJ, Yu QS, Luo CC & Zou JW (2008) Effect of mutation K85R on GSK-3beta: Molecular dynamics simulation. Biochem Biophys Res Commun 377, 962–965. 34 Brooks BR, Brooks CL III, Mackerell AD Jr, Nilsson L, Petrella RJ, Roux B, Won Y, Archontis G, Bartels C, Boresch S et al. (2009) CHARMM: the biomolecular simulation program. J Comput Chem 30, 1545–1614. 35 Ho SN, Hunt HD, Horton RM, Pullen JK & Pease LR (1989) Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene 77, 51–59. 36 Sambrook J & Russell DW (2001) Molecular Cloning: a Laboratory Manual, 3rd edn. Cold Spring Harbor Lab- oratory, Cold Spring Harbor. 37 Scott WRP, Hunenberger PH, Tironi IG, Mark AE, Billeter SR, Fennen J, Torda AE, Huber T, Kruger P & van Gunsteren WF (1999) The GROMOS Biomolecular Simulation Program Package. J Phys Chem A 103, 3596–3607. 38 Hess B, Bekker H, Berendsen HJC & Fraaije JGEM (1997) LINCS: A linear constraint solver for molecular simulations. J Comput Chem 18, 1463–1472. 39 Essmann U, Perera L, Berkowitz ML, Darden T, Lee H & Pedersen LG (1995) A smooth particle mesh Ewald method. J Chem Phys 103, 8577–8593. 40 Chen J, Brooks CL III & Khandogin J (2008) Recent advances in implicit solvent-based methods for biomo- lecular simulations. Curr Opin Struct Biol 18, 140–148. Enhanced thermostability of methyl parathion hydrolase J. Tian et al. 4908 FEBS Journal 277 (2010) 4901–4908 ª 2010 The Authors Journal compilation ª 2010 FEBS . Enhanced thermostability of methyl parathion hydrolase from Ochrobactrum sp. M231 by rational engineering of a glycine to proline mutation Jian Tian,. Mulchandani A (2010) Cotranslocation of methyl parathion hydrolase to the periplasm and of organophosphorus hydrolase to the cell surface of Escherichia coli