Tài liệu Báo cáo khoa học: Enhanced thermostability of methyl parathion hydrolase from Ochrobactrum sp M231 by rational engineering of a glycine to proline mutation pdf

Tài liệu Báo cáo khoa học: Enhanced thermostability of methyl parathion hydrolase from Ochrobactrum sp. M231 by rational engineering of a glycine to proline mutation pdf

Tài liệu Báo cáo khoa học: Enhanced thermostability of methyl parathion hydrolase from Ochrobactrum sp. M231 by rational engineering of a glycine to proline mutation pdf

... Enhanced thermostability of methyl parathion hydrolase from Ochrobactrum sp. M231 by rational engineering of a glycine to proline mutation Jian Tian, Ping Wang, Shan Gao, Xiaoyu Chu, ... MPH a Forward: 5¢-TAGAATTCGCTGCTCCACAA GTTAGAACT-3¢ Reverse: 5¢-TA GCGGCCGCTTACTTTGGGTTA ACGACGGA-3¢ Mutant MPH b G194P 5¢-CCTGACGATTCTAAACCGTTCTTCAAGGGTGCC-3¢ G198P 5¢-...

Ngày tải lên: 15/02/2014, 01:20

8 740 0
Tài liệu Báo cáo khoa học: "Enhanced word decomposition by calibrating the decision threshold of probabilistic models and using a model ensemble" pdf

Tài liệu Báo cáo khoa học: "Enhanced word decomposition by calibrating the decision threshold of probabilistic models and using a model ensemble" pdf

... terms of training set size. We want to remind the reader that our two algorithms are aimed at small datasets. We randomly split each dataset into 10 subsets where each subset was a test set and ... 2006). They used a natural language tagger which was trained on the output of ParaMor and Morfes- sor. The goal was to mimic each algorithm since ParaMor is rule-based and there is no a...

Ngày tải lên: 20/02/2014, 04:20

9 558 0
Tài liệu Báo cáo khoa học: Enhanced expression of Mcm proteins in cancer cells derived from uterine cervix docx

Tài liệu Báo cáo khoa học: Enhanced expression of Mcm proteins in cancer cells derived from uterine cervix docx

... Kimura 3 , Kouichi Yamada 4 and Si-Young Song 1 1 Mitsubishi Kagaku Institute of Life Sciences, Machida, Tokyo; 2 Department of Pathology, Kitasato University School of Medicine, Sagamihara, Kanagawa; 3 Department ... Mcm2 cDNA, 5¢-AGACGAGATAGAGCTGACTG-3¢ as a forward primer and 5¢-CACCACGTACCTTGTGCTTG-3¢ as a reverse primer were used. Primers for the amplification of the human gly...

Ngày tải lên: 20/02/2014, 23:20

13 487 0
Tài liệu Báo cáo khoa học: RMI1 deficiency in mice protects from diet and genetic-induced obesity pptx

Tài liệu Báo cáo khoa học: RMI1 deficiency in mice protects from diet and genetic-induced obesity pptx

... obesity Akira Suwa 1 , Masayasu Yoshino 2 , Chihiro Yamazaki 3 , Masanori Naitou 2 , Rie Fujikawa 3 , Shun-ichiro Matsumoto 2 , Takeshi Kurama 1 , Teruhiko Shimokawa 1 and Ichiro Aramori 2 1 Pharmacology ... Pharmacology Research Labs, Astellas Pharma Inc., Tsukuba, Ibaraki, Japan 2 Molecular Medicine Labs, Astellas Pharma Inc., Tsukuba, Ibaraki, Japan 3 Trans Genic Inc., Chuo-ku, Tokyo, Japa...

Ngày tải lên: 16/02/2014, 09:20

10 694 0
Tài liệu Báo cáo khoa học: Emerging pathways in genetic Parkinson’s disease: Autosomal-recessive genes in Parkinson’s disease – a common pathway? docx

Tài liệu Báo cáo khoa học: Emerging pathways in genetic Parkinson’s disease: Autosomal-recessive genes in Parkinson’s disease – a common pathway? docx

... disease. Lancet Neurol 7, 97–109. 4 Hayashi S, Wakabayashi K, Ishikawa A, Nagai H, Sai- to M, Maruyama M, Takahashi T, Ozawa T, Tsuji S & Takahashi H (2000) An autopsy case of autosomal- recessive ... Drosophila gain- of- function mutants has shown that DJ-1 was a nega- tive regulator of PTEN [83], and an impairment of phosphatidylinositol 3-kinase ⁄ Akt signalling has been ob...

Ngày tải lên: 18/02/2014, 14:20

9 776 0
Tài liệu Báo cáo khoa học: Activated Rac1, but not the tumorigenic variant Rac1b, is ubiquitinated on Lys 147 through a JNK-regulated process docx

Tài liệu Báo cáo khoa học: Activated Rac1, but not the tumorigenic variant Rac1b, is ubiquitinated on Lys 147 through a JNK-regulated process docx

... November 2007) doi:10.1111/j.1742-4658.2007.06209.x Ubiquitination and proteasomal degradation have recently emerged as an additional level of regulation of activated forms of Rho GTPases. To char- acterize this novel regulatory pathway and to gain ... combination of expression plasmids of HA–Rac1L61, HA– Rac1bWT, HA–Rac1bL61 and 6His–myc–Ub as indicated. Proteasomal degradation...

Ngày tải lên: 18/02/2014, 16:20

11 470 0
Tài liệu Báo cáo khoa học: Octaketide-producing type III polyketide synthase from Hypericum perforatum is expressed in dark glands accumulating hypericins pdf

Tài liệu Báo cáo khoa học: Octaketide-producing type III polyketide synthase from Hypericum perforatum is expressed in dark glands accumulating hypericins pdf

... (AB018074) 100 100 100 100 100 100 100 99 94 90 57 54 51 87 100 98 100 100 0,1 Fabaceae Gymnosperms CHSs plants fungi bacteria Fabaceae Gymnosperms FabaceaeFabaceae GymnospermsGymnosperms CHSsCHSs Functionally CHSs plants fungi bacteria plants fungi bacteria Fig. ... Hydrangea macrophylla CTAS (AB011468) Hydrangea macrophylla STCS (AF456445) Ruta graveolens ACS (AJ297788) Gerbera hybrida 2...

Ngày tải lên: 18/02/2014, 18:20

14 451 0
Tài liệu Báo cáo khoa học: The bacterium, nontypeable Haemophilus influenzae, enhances host antiviral response by inducing Toll-like receptor 7 expression ppt

Tài liệu Báo cáo khoa học: The bacterium, nontypeable Haemophilus influenzae, enhances host antiviral response by inducing Toll-like receptor 7 expression ppt

... Imgenex and Santa Cruz Biotechnology (Santa Cruz, CA, USA). An antibody against p65 was purchased from Santa Cruz Biotechnology. Monoclonal antibody against b-actin was purchased from Sigma (St ... Activation of NF- kappa B by nontypeable Hemophilus influenzae is medi- ated by toll-like receptor 2-TAK1-dependent NIK-IKK alpha ⁄ beta-I kappa B alpha and MKK3 ⁄ 6-p38 MAP kinase signali...

Ngày tải lên: 19/02/2014, 00:20

14 366 0
Tài liệu Báo cáo khoa học: Exposure of IgG to an acidic environment results in molecular modifications and in enhanced protective activity in sepsis doc

Tài liệu Báo cáo khoa học: Exposure of IgG to an acidic environment results in molecular modifications and in enhanced protective activity in sepsis doc

... [34]. Statistical analysis Statistical analyses were performed using graphpad prism, version 4.00 (GraphPad Software, San Diego, CA, USA). Statistical analyses of the ELISA data and the areas under the ... (1995) Invariance and restriction toward a limited set of self- antigens characterize neonatal IgM antibody repertoires and prevail in autoreactive repertoires of healthy adults. Pr...

Ngày tải lên: 16/02/2014, 15:20

12 620 0
Tài liệu Báo cáo khoa học: Autolytic activity of human calpain 7 is enhanced by ESCRT-III-related protein IST1 through MIT–MIM interaction pptx

Tài liệu Báo cáo khoa học: Autolytic activity of human calpain 7 is enhanced by ESCRT-III-related protein IST1 through MIT–MIM interaction pptx

... calpain 7 contains a C2-like domain, it lacks a penta-EF-hand domain and is classified as an atypical calpain. As one of the significant structural features, mammalian calpain 7 possesses a tandem ... (Chiba, Japan), using a pair of primers (forward, 5¢-CTA GAATT CAACAGCACAGCATGCTGG-3¢; reverse, 5¢-AGAGAA TTCTGCCTGGTTTAAGAGACC-3¢; restriction sites underlined). The amplified cDNA fra...

Ngày tải lên: 18/02/2014, 04:20

15 505 0
w