cd8 t cell depletion or cd4 t cell de pletion on the efficacy of gene gun administration of non coating egfr dna vaccine
Báo cáo sinh học: "Retroviral vectors encoding ADA regulatory locus control region provide enhanced T-cell-specific transgene expression" potx
... expression Furthermore, together with studies on the human β-globin LCR, the vector constructs presented herein shed light on the possibility of generating a global model construct for the creation of ... for the first time the incorporation of key cis-regulatory sequences from the human ADA gene [24] into a retroviral vector for the treatment of ADA-SCID (Additional file 1) These vectors contain ... 5'GAGATATCAGTAAAAGAGGTGAGGGCCTG3' and 5'GAGATATCGGCAGATCTGGAAGAGCAGGT3' for introns 7-8; and 5'GAGATATCTTCAGCCTCTGCAGGTA GGTT3' and 5'GAGATATCTTCTGCCCTGCTCGTTGGTT3' for intron 11 PCR products were digested with EcoRV...
- 12
- 210
- 0
Báo cáo y học: ""Shock and kill" effects of class I-selective histone deacetylase inhibitors in combination with the glutathione synthesis inhibitor buthionine sulfoximine in cell line models for HIV-1 quiescence" doc
... hypothesized that glutathione depletion might create an intracellular environment that facilitates HIV-1 activation by HDACIs To test this hypothesis, we evaluated the HIV-1 activating effects of ... glutathione [26,28] The depletion of reduced glutathione has been linked to activation of viral replication [29], whereas the administration of this cofactor results in antiretroviral effects [26] ... HDACI-insensitive cells into the responding cell population (Figure 5) These results are derived from the A1 Jurkat cell clone, which has an integrated GFP/Tat construct under control of the HIV-1 LTR,...
- 10
- 418
- 0
Tài liệu Báo cáo khoa học: Down-regulation of heme oxygenase-2 is associated with the increased expression of heme oxygenase-1 in human cell lines docx
... lane contains 15 lg total RNA The bottom panel shows the expression of 18S rRNA as an internal control Note that the blot was exposed to the film for the longest time (1 min) to detect the low ... of HO-1 or HO-2 expression To explore the biological implication of the knockdown experiments and to evaluate the relative contribution of HO-1 and HO-2 to the total amount of heme degradation, ... facilitate the binding of Nrf2, instead of Bach1, to the MARE to activate the MARE-dependent promoter, as reported for the mouse HO-1 gene [47] However, in contrast with the mouse HO-1 gene, the...
- 14
- 487
- 0
Báo cáo khoa học: Fast set-up of doxycycline-inducible protein expression in human cell lines with a single plasmid based on Epstein– Barr virus replication and the simple tetracycline repressor ppt
... 0.6 0.8 the on- state (this amounts to stimulation by a factor of 9.7) Thus, the background in the off-state was much lower with pEBTetD than with pEBTet However, in contrast to expression of membrane ... With seven cDNAs coding for transport proteins, northern blot analysis of 293 cells transfected with the respective pEBTet plasmids consistently revealed strong transcription in the on- state ... turns on expression: the inducer binds to the repressor, which then dissociates from the operator From the lack of interaction of the unmodified TetR with mammalian transcription factors, a steady...
- 8
- 331
- 0
Báo cáo sinh học: "Combination therapy with vemurafenib (PLX4032/RG7204) and metformin in melanoma cell lines with distinct driver mutations" pdf
... combination inhibited phosphorylation of AKT The phosphorylation of AKT was independent from the driver mutation (BRAFV600E, NRASQ61, or wild type), or the sensitivity to single agents or the combination ... independent of the sensitivity to metformin observed in proliferation assays (Figure 2c), suggesting that metformin may have antitumor effects independent of the cell cycle The combination of vemurafenib ... shown The black line represents the data obtained with vemurafenib treatment, the blue line with metformin, and the red line with combination treatment b) Combination index for the combination of...
- 13
- 518
- 0
Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx
... TGAGTTACACGTTCAGTCAGCAATATG Real-time TCTTGGTCTTTAGTTCTTATCATCTTGAGC Real-time AAGATTCTCAGCTACATAATGCACACC Real-time ATGCTCATCAGTAGATTCTGCTCAC Real-time ACGCTTCTTCTTTGCGACTG Real-time CACCATATCCCGCTTGAGTT ... dG Adapter dT Adapter primer AGTGAGATGGATACAGGTGCTAAAC TCTGGACCTCAGACATGAACTTACT TGTCAGTCCTCTTTAATGCT AATGGTATCCTGTTTGGCTCAG GGTTGTAATTGTACACGGTAGTC CGGTAGTCAGGAAATCAATGCC CCATGTCTGCAGATGGTCGAGG ... GGACTGACATTGCTCCAGAGC GCTTCAGTGACTCAGAAATTGG GTCCAGAATATTCAGCCTTTCACC CTCCCTCAAACAAACCAGAGTC CACTGGATGAGACAGGAAGTT CTTCTCCAGGACAGTCCAAAGAGTC CTGGATTGAAGCGCCCTCGGTTAATC GCTGCCTTTGTTATTTGTAAGCTTCAG...
- 20
- 689
- 0
Báo cáo Y học: GPI-microdomains (membrane rafts) and signaling of the multi-chain interleukin-2 receptor in human lymphoma/leukemia T cell lines doc
... shows that pretreatment of the cells with cholesterol-extracting agent, MbCD, largely suppressed the extent of phosphorylation, nearly uniformly in the pattern Effect of cholesterol depletion on ... Effect of cholesterol depletion on tyrosine phosphorylation/activation of STAT3/STAT5 The bars display means of flow cytometric fluorescence histograms of Kit225K6 T cells stained with FITC–anti-(rabbit ... donor– acceptor distance and the donor/acceptor ratio When the two fluorescent labels are confined to two distinct membrane proteins, the dependence of FRET efficiency on the donor/ acceptor ratio should...
- 10
- 499
- 0
Báo cáo khoa học: The subcellular localization of vaccinia-related kinase-2 (VRK2) isoforms determines their different effect on p53 stability in tumour cell lines pdf
... coactivator p300 also interacts with the p53 transactivation domain and contributes to p53 stabilization and activation To test the possibility that phosphorylated p53 might bind to this transcriptional ... nuclei The VRK2 gene generates by alternative splicing two different isoforms that differ in their C-terminus The detection of two subcellular locations for the known VRK2 protein suggested that these ... consequences of Thr18 phosphorylation are p53 stabilization and the activation of p53-dependent gene transcription [15] Phosphorylation of Thr18 has been detected in cells treated with taxol and some other...
- 18
- 333
- 0
Easy PHP websites with the zend framework (w jason gilmore) (2011)(t)
... tier: the controller The Controller The third part of the MVC triumvirate is the controller The controller is responsible for processing events, whether initiated by the user or some other actor, ... in the controller See the last chapter for more information about the init() method Disabling the Layout To prevent the layout from rendering, call the disableLayout() helper at the top of the ... name="submit" value="Contact Us!" /> The form's action points to the About controller's contact method, meaning the form data will be made available to this action once the form has been submitted...
- 236
- 391
- 1
Báo cáo y học: " DNA methylation patterns associate with genetic and gene expression variation in HapMap cell lines" ppt
... transcription factor binding sites, histone-modifications, and with respect to distance to the probe We extended the model to fit the methylation data, where the reference point was the location of the ... [40], consistent with the expectation that the absence of methylation is important for transcription factor binding Genome-wide association of DNA methylation with SNP genotypes We next assessed ... fraction of genes However, in the re-analyses of the eQTL data taking into account DNA methylation, in only 10% of eQTLs was the genetic effect of the SNP on expression affected by controlling for...
- 13
- 396
- 0
báo cáo khoa học: "Co-existence of acute myeloid leukemia with multilineage dysplasia and Epstein-Barr virus-associated T-cell lymphoproliferative disorder in a patient with rheumatoid arthritis: a case report" docx
... suppression of the formation of IgM in B cells, the formation of matrix metalloproteinase-3, and the differentiation of osteoclasts [9,10] The bone marrow karyotyping revealed an abnormal karyotype of chromosome ... reported that RA itself is not a risk factor of LPD [25] It remains unclear whether the co-existence of the three conditions are coincidental or there could be an intrinsic mechanism Conclusion The ... journal http://www.jhoonline.org/content/2/1/27 10 11 12 13 14 15 16 17 Competing interests The authors declare that they have no competing interests 18 Authors' contributions 19 MT, KS and JT assembled,...
- 6
- 314
- 0
Báo cáo y học: "Systems biology-defined NF-κB regulons, interacting signal pathways and networks are implicated in the malignant phenotype of head and neck cancer cell lines differing in p53 status" pps
... 5'-biotinCCCTGAGGGGATGGGCCATCAGTTGCAAATCGTGGAATTTCCTCTGACAT-3' for the RELA binding site; CDKN1A, 5'biotin-ACTGAGCCTTCCTCACATCCTCCTTCTTCAGGCTTGGGCTTTCCACCTTT-3' for the RELA binding site, 5'-biotinAGGTGAATTCCTCTGAAAGCTGACTGCCCCTATTTGGGACTCCCCAGTCT-3 ... these cell lines have led to the demonstration and confirmation of important molecular findings made with them in tumor tissue and serum specimens These include the demonstration of alterations ... 1) To determine the functional classification of the NF-κB target genes, we performed Gene Ontology annotation Among the top Gene Ontology categories, epidermal development, cell differentiation,...
- 22
- 434
- 0
THE REGULATORY ROLE OF MATRIX METALLOPROTEINASES IN T CELL ACTIVATION
... results in the expression of genes important for T cell activation including the production of IL-2 In contrast, NFAT activity in the absence of AP-1 activation induces a pattern of gene expression ... Signal transducer and activator of transcription STAT-6 Signal transducer and activator of transcription T- bet T- box expressed in T cells TCR T cell receptor Thy1.1 Thymus cell antigen 1, theta Thy1.2 ... signal-regulated kinase (Erk1) and Erk2 Erk kinase activity results in the activation of the transcription factor Elk1, which contributes to the activation of the activator protein-1 (AP-1) (Jun/Fos) transcription...
- 202
- 322
- 0
Role of hodgkin and reed sternberg cell derived lymphotoxin alpha in t cell recruitment into the microenvironment of hodgkin lymphoma lesions
... binding to endothelium is dependent on the site of the endothelial cells and the nature of the cytokines or stimulatory factor For example TNF-α induced ICAM-1 and VCAM-1 expression on the activated ... endothelial barrier under the influence of promigratory factor Chemokines also act as the chemotatic factors that attract the bound leukocytes to transmigrate across the endothelium into the interstitium ... naïve T cells, memory T cells and effector T cells A more detailed classification of T cells based on their functions can divide T cells into T helper cells, cytotoxic T cells and regulatory T cells...
- 204
- 400
- 0
The accessory roles of lipopolysaccharide activated murine b cells in t cell polarization
... CD4+ T cell subsets, and Chapter Introduction 22 determines their effector functions The influence of cytokines in the differentiation of CD4+ T cell subsets and the effect of CD4+ T cell subsets ... Stimulation of transfectant cell lines with TLR4/MD-2, but not TLR4 alone by LPS, results in the activation of the nuclear factor κB (NFκB) reporter gene Furthermore, cells with TLR4 alone or TLR4 ... question from the B cell perspective The first part of the study focused on the investigation of the immunomodulatory effects of LPS alone on the murine splenic B cells Results indicated that LPS...
- 250
- 384
- 0
Tài liệu Báo cáo khoa học: Separation of a cholesterol-enriched microdomain involved in T-cell signal transduction doc
... contents recovered in raft fractions depend on detergent concentrations We examined the effect of Triton 5457 Two raft subsets in T- cells Fig Protein partitioning under different detergent conditions ... unlikely that these intracellular organelles contaminate the raft fractions However, judging from the observation that the PS ⁄ PI profile of the BCh-unbound subpopulation is similar to that of the ... are recruited to the BCh-bound subpopulation after TCR stimulation These results suggest that the so-called raft fractions consist of heterogeneous membrane groups, and that the cholesterol-enriched...
- 10
- 588
- 0
Báo cáo khoa học: Internalization of cystatin C in human cell lines docx
... cystatin C for up to h The cystatin C content of the cell extract (representing intracellular cystatin C) was quantified by ELISA and the cystatin C level was correlated to the protein content of the ... incubated for 24 h with or without the addition of lM cystatin C to the medium After lysate preparation, centrifugation and heat denaturation of the endogenous cysteine proteinases, the cysteine ... showed that the cystatin C content of the cells increased rapidly during the first and then continued to accumulate for at least h, which was the final time-point of these experiments (Fig 5A) Repeated...
- 12
- 389
- 0
Báo cáo khoa học: Superoxide radical-scavenging effects from polymorphonuclear leukocytes and toxicity in human cell lines of newly synthesized organic selenium compounds potx
... p47phox, translocates from the cytosol to the cell membrane upon activation To examine the effects of selenoureas and selenoamides on O2– production from PMNs, we investigated the translocation of the ... observed the translocation of p47phox only in adhered PMNs Even at the relatively high concentration of 100 lm, We demonstrated the antioxidative effects and cytotoxicity of four newly synthesized organic ... Finland) The concentration of the oxidant in the samples was calculated using the standard curve, which was made by adding known concentrations of the authentic H2O2 instead of the samples Visualization...
- 9
- 331
- 0
báo cáo hóa học:" Preclinical evaluation of dasatinib, a potent Src kinase inhibitor, in melanoma cell lines" pptx
... crucial to maximise the potential clinical benefits of dasatinib treatment for melanoma Competing interests The authors declare that they have no competing interests Authors' contributions AJE contributed ... Concentrations of temozolomide are represented as a ratio of the dasatinib concentration Error bars represent the standard deviation of triplicate experiments Page of 11 (page number not for citation ... http://www.translational-medicine.com/content/6/1/53 bition of growth at concentrations up to μM The Student's t test was used to compare temozolomide IC50s alone and in combination with dasatinib,...
- 11
- 476
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến dòng điện stato i1 fi p2 thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008