Báo cáo khoa học: The subcellular localization of vaccinia-related kinase-2 (VRK2) isoforms determines their different effect on p53 stability in tumour cell lines pdf

The subcellular localization of vaccinia-related kinase-2 (VRK2) isoforms determines their different effect on p53 stability in tumour cell lines Sandra Blanco, Lucia Klimcakova, Francisco M Vega and Pedro A Lazo ´ ´ ´ Instituto de Biologıa Molecular y Celular del Cancer, Consejo Superior de Investigaciones Cientıficas (CSIC), Universidad de Salamanca, Spain Keywords p53; phosphorylation; Ser-Thr kinase; VRK2 Correspondence ´ P A Lazo, IBMCC-Centro de Investigacion ´ del Cancer, CSIC-Universidad de Salamanca, Campus Miguel de Unamuno, E-37007 Salamanca, Spain Fax: +34 923 294 795 Tel: +34 923 294 804 E-mail: plazozbi@usal.es Database Sequence VRK2B has been submitted to the GenBank database under the accession number AJ512204 (Received 30 January 2006, revised 29 March 2006, accepted 31 March 2006) doi:10.1111/j.1742-4658.2006.05256.x VRK is a new kinase family of unknown function Endogenous human vacinia-related kinase (VRK2) protein is present in both the nucleus and the cytosol, which is a consequence of alternative splicing of two VRK2 messages coding for proteins of 508 and 397 amino acids, respectively VRK2A has a C-terminal hydrophobic region that anchors the protein to membranes in the endoplasmic reticulum (ER) and mitochondria, and it colocalizes with calreticulin, calnexin and mitotracker; whereas VRK2B is detected in both the cytoplasm and the nucleus VRK2A is expressed in all cell types, whereas VRK2B is expressed in cell lines in which VRK1 is cytoplasmic Both VRK2 isoforms have an identical catalytic N-terminal domain and phosphorylate p53 in vitro uniquely in Thr18 Phosphorylation of the p53 protein in response to cellular stresses results in its stabilization by modulating its binding to other proteins However, p53 phosphorylation also occurs in the absence of stress Only overexpression of the nuclear VRK2B isoform induces p53 stabilization by post-translational modification, largely due to Thr18 phosphorylation VRK2B may play a role in controlling the binding specificity of the N-terminal transactivation domain of p53 Indeed, the p53 phosphorylated by VRK2B shows a reduction in ubiquitination by Mdm2 and an increase in acetylation by p300 Endogenous p53 is also phosphorylated in Thr18 by VRK2B, promoting its stabilization and transcriptional activation in A549 cells The relative phosphorylation of Thr18 by VRK2B is similar in magnitude to that induced by taxol, which might use a different signalling pathway In this context, VRK2B kinase might functionally replace nuclear VRK1 Therefore, these kinases might be components of a new signalling pathway that is likely to play a role in normal cell proliferation In the human kinome the vaccinia-related kinase (VRK) protein family has been identified as a distinct subfamily that diverged early in evolution from the branch leading to the casein kinase I (CKI) group [1] This branch has 13 different proteins grouped into three subfamilies, VRK, TTBK and CKI [1] Nevertheless, in lower eukaryotes there is only one homologue gene; thus in Caenorhabditis elegans, the homologue gene is 2D213 [2] and it is CG6386 in Drosophila [3] The unique family homologues in Schizosaccharomyces pombe and Saccharomyces cerevisiae are the Hhp1 and Hrr25 genes, respectively [4], and both implicated in the response to genotoxic damage [5,6] The catalytic domain of VRK proteins shares homology with the vaccinia virus early gene, B1R [7], which is required for viral DNA replication [8–10] In Abbreviations ER, endoplasmic reticulum; VRK2, vaccinia-related kinase FEBS Journal 273 (2006) 2487–2504 ª 2006 The Authors Journal compilation ª 2006 FEBS 2487 Differential stabilization of p53 by VRK2 isoforms S Blanco et al mammals, the VRK family has three members The kinase domain of the VRK proteins shows relatively weak conservation [1], but is catalytically active for VRK1 [11–14] and VRK2, although not for VRK3 [13] VRK1 has a nuclear localization signal and is detected in the nucleus in some cell lines and in transfected cells [11,13], but it is also present in the cytosol in other cell lines [15], particularly in some types of adenocarcinoma (unpublished results); however, the regulation and coordination of the subcellular localization of different VRK proteins are unknown The VRK1 protein is able to phosphorylate several transcription factors such as p53 [11,15], c-Jun16, and ATF2 [17] VRK1 and VRK2 share 61% identity in their catalytic domains, with no conservation in other parts of the protein, suggesting functional differences between the two kinases that have yet to be characterized It has been postulated that this protein family might play a role in proliferation because they are highly expressed in early haematopoietic development in murine embryos [18], in tissues containing proliferative cells and in tumour cells [7] VRK1 is expressed at very high levels in retinal neurons and its expression decreases dramatically the first day after birth [19], it also correlates with proliferation markers in head and neck squamous carcinomas [20] In chronic myelogenous leukaemia, expression of VRK1 can differentiate those who will respond to imatinib treatment from those who will not [21] In B cells, analysis by quantitative MS indicates that it is downregulated when Myc expression is induced [22] VRK1 is also regulated in response to peroxixome proliferators in murine hepatocytes [23] VRK1 expression is activated in E2F and inhibited by p16 and in nonphosphorylated retinoblastomas [24] The data available on VRK2 are much more limited VRK2 is downregulated in human mononuclear B cells during the innate immune response to bacteria [25], and upregulated in T cells by CD3 ligation and if costimulated by CD28 [26] VRK1 contributes to p53 stability via two mechanisms, one of which is dependent on Thr18 phosphorylation It also appears to be implicated in the control of normal proliferation in the absence of cellular stress, and its inactivation by specific RNA interference blocks cell division [15], consistent with observations in C elegans, where it is embryonic lethal In adult C elegans there is a slowdown in growth suggesting problems in cell-cycle progression [2] The p53 protein plays a major role in controlling the cell response to many types of cellular stress [27,28], and its intracellular levels appear to determine the susceptibility of a cell to tumour development [29,30] Regulation of p53 protein levels and transcriptional activity are therefore 2488 critical to allow for both normal cell division and tumour suppression, while retaining the capacity for rapid induction in response to genotoxic stress [31,32] Thus, its levels are tightly regulated, mainly by phosphorylation [33] Several kinases are implicated in the stability of p53 by targeting at least seven different residues in its N-terminal transactivation domain [34,35], each modulated by different types of stimulation [36–41] Therefore, there are functional differences regarding p53 stability or transcriptional activity depending on the residue phosphorylated [42,43] Phosphorylation of human p53 at Ser15 or Ser20 (equivalent to murine Ser18 and Ser23) promotes p300 recruitment and therefore its acetylation by p300 [43–45], but p53 can also be stabilized in the absence of phosphorylation of these two residues [46] Moreover, phosphorylation of murine Ser18 (human Ser15) is not necessary for p53 tumour suppression [47] Cells also need to have a basic mechanism that maintains a basal level of p53 in a state of readiness and able to respond to any stress that may arise in normal life, when most cells are in interphase [15] More recently, phosphorylation of p53 in Thr18 (Thr21 in murine p53) has acquired more relevance [48], because it is implicated in both the p53–Mdm2 interaction and p300 recruitment This residue is phosphorylated by casein kinase I delta only when it has previously been phosphorylated at Ser15 [49,50], but this kinase is cytosolic in interphase [51]; Thr18 is uniquely phosphorylated by the nuclear VRK1 protein [11,15] Phosphorylation at Thr18 reduces binding to the p53-negative regulator Mdm2, and promotes its interaction with the cofactor p300 Mdm2 catalyses the ubiquitination of p53 and its subsequent proteolytic degradation [52–54] p300 acetylates p53 at its C-terminus, promoting its transcriptional activation [55–58] The functional consequences of Thr18 phosphorylation are p53 stabilization and the activation of p53-dependent gene transcription [15] Phosphorylation of Thr18 has been detected in cells treated with taxol and some other drugs [33,59], as well as in cellular senescence [60], suggesting that several signalling pathways are involved We identified that VRK2 has different subcellular localizations corresponding to expression of two isoforms by the human VRK2 gene Their expression varies depending on the cell type Both isoforms have similar properties regarding their phosphorylation substrates and the specific phosphorylation of p53 in vitro The nuclear VRK2B isoform might be functionally redundant with VRK1, and seems to be expressed in cells in which VRK1 is localized in the cytoplasm In FEBS Journal 273 (2006) 2487–2504 ª 2006 The Authors Journal compilation ª 2006 FEBS S Blanco et al cells lacking nuclear VRK1 this nuclear isoform might regulate p53 mainly by phosphorylation Results Localization of the endogenous human VRK2 protein First we determined the subcellular localization of the endogenous VRK2 protein For this, we used a specific rabbit polyclonal antibody against full-length VRK2 protein We analysed the localization of VRK2 in two cell lines, WSI, derived from normal skin fibroblasts, and MCF7 cells from a breast carcinoma In both cell lines there was strong staining in both the cytosol and nucleus, and there was a particulate aspect, suggesting that VRK2 might be associated with some organelle (Fig 1A,B) To further refine the subcellular distribution, three additional markers were included; the endoplasmic reticulum (ER) was identified by detecting calnexin (Fig 1A), mitochondria were detected with mitotracker (Fig 1B), and nuclei were detected with DAPI staining (Fig 1A,B) Confocal microscopy analysis showed that a significant fraction of the endogenous protein was membrane bound both to the ER and, to a lesser extent, to mitochondria, as detected by the overlapping signals The data suggested that Differential stabilization of p53 by VRK2 isoforms endogenous VRK2 protein could exist in two forms, membrane bound, as detected in the ER and mitochondria, or free as detected in both cytosol and nuclei The VRK2 gene generates by alternative splicing two different isoforms that differ in their C-terminus The detection of two subcellular locations for the known VRK2 protein suggested that these might be due to differences in the expression of the unique human VRK2 gene To test this possibility, VRK2 cDNA from HeLa cells was cloned by RT-PCR Two cDNA sequences of 1833 and 1877 nucleotides were isolated Comparison of these sequences with the human VRK2 gene shows that they were generated by alternative splicing Isoform B had an additional exon of 44 nucleotides, designated new exon 13 that changed the reading frame and included an early termination codon Exon 13 is located 8280 base pairs downstream of exon 12 and 4542 base pairs upstream of exon 14, former exon 13, in the genomic sequence of the VRK2 gene (Fig 2A) The resulting VRK2 proteins, A and B, have 508 and 397 amino acids, respectively They differ in the C-terminus In isoform A, this region (residues 395–508) contains a hydrophobic sequence (residues Fig Subcellular localization of the endogenous human VRK2 protein in MCF7 and WSI cell lines VRK2-specific detection was determined with a rabbit polyclonal antibody DAPI staining, used to identify the nuclei, is also shown The ER was identified with a monoclonal antibody specific for calnexin (A) Mitochondria were detected using the MitoTracker Red CMXRos reagent (B) Bars ¼ 50 lm FEBS Journal 273 (2006) 2487–2504 ª 2006 The Authors Journal compilation ª 2006 FEBS 2489 Differential stabilization of p53 by VRK2 isoforms S Blanco et al Fig Generation of two VRK2 messages by alternative splicing (A) Detection of the new exon identified in the message coding for the VRK2B isoform The DNA sequences correspond to the genomic sequence (Ensembl genomic location: AC068193.7.1.170059), and the cDNA for VRK2A (AB000450) and VRK2B (AJ512204) (B) Alignment of the VRK2A and VRK2B protein sequence to show the divergent C-terminus, the location of catalytic region and other specific features The arrow indicates where the reading frame changed as a consequence of alternative splicing 487–506) In isoform B, this region is replaced by three amino acids (VEA), however, the catalytic domain at the N-terminus is identical (Fig 2B) Differential expression of VRK2A and VRK2B proteins in tumour cell lines To demonstrate that the two messages identified code for real proteins, we determined their presence in a panel of tumour cell lines using western blot analysis, with a polyclonal antibody raised against full-length VRK2 protein (isoform A), but that recognizes the N-terminal region common to both isoforms (not shown) The VRK2A protein was detected in all cell 2490 lines, but VRK2B protein was more abundant in some cell lines, such as C4-I, HeLa, MCF7 or the colon carcinoma WiDr, and detected in smaller amounts in the remaining carcinoma cell lines (Fig 3A) In lymphoma cell lines, only isoform A was detected To identify the mobility of each protein, protein extract of MCF7 cells was run in parallel with the purified VRK2A and VRK2B proteins expressed as glutathione S-transferase (GST)–fusion proteins and digested with thrombin We observed identical mobility in the endogenous proteins with the cloned and purified isoforms (Fig 3B) The relative concentration of mRNA was also determined by real-time quantitative PCR in the H1299 and FEBS Journal 273 (2006) 2487–2504 ª 2006 The Authors Journal compilation ª 2006 FEBS S Blanco et al Differential stabilization of p53 by VRK2 isoforms Fig Expression of two VRK2 isoforms (A) Detection of VRK2 proteins in several cell lines that were determined by immunoblotting of whole-cell extracts Whole extract from each cell line was fractionated in an SDS-polyacrylamide gel and transferred to a poly(vinylidene difluoride) membrane The blot was developed with a specific polyclonal antibody that detects both VRK2 isoforms The cell lines proceed from different types of tumours as indicated in the figure and include carcinomas of different types (squamous and adenocarcinomas), sarcomas and T and B lymphomas (B) The mobility of endogenous VRK2A and VRK2B proteins from MCF7 cell extracts was compared with bacterially expressed and purified GST–VRK2A and GST–VRK2B proteins that were digested with thrombin The VRK2 isoforms were detected in the western blot with a rabbit VRK2-specific polyclonal antibody (C) Quantitative detection by real time RT-PCR of total VRK2 (isoform A plus B) messages (solid lines) or specific VRK2B message (dotted lines) in the H1299 (blue) and MCF7 (pink) cell lines (D) Localization of endogenous VRK1 and VRK2 proteins in three adenocarcinoma cell lines VRK1 was detected with a mouse monoclonal antibody specific for human VRK1 Human VRK2 was detected with a rabbit polyclonal antibody Bar ¼ 50 lm MCF7 cell lines In this experiment, total and specific VRK2B messages were detected In both cases there was always more VRK2A than VRK2B mRNA, and the two cell lines appeared to have similar levels of each message (Fig 3C) The nuclear localization of VRK2 suggests that it might be redundant, with VRK1 reported to be exclusively nuclear in transfection experiments [11,13,15] However, the nuclear localization of VRK1 is dependent on the cell type, in lymphomas, sarcomas and squamous carcinomas it is nuclear, but in some adenocarcinomas it is cytosolic (manuscript in preparation) Therefore, the localization of endogenous VRK1 and VRK2 proteins was simultaneously determined by confocal microscopy in MCF7 cells from a breast adenocarcinoma, A549 cells from lung adenocarcinoma and HeLa cells from a cervical adenocarcinoma Immunofluorescence showed that VRK1 is cytosolic with a particulate aspect in these three cell lines, whereas VRK2 is located in both the cytoplasm and is clearly detected in the nucleus (Fig 3D) In MCF7 and HeLa cells the strong staining in the nucleus coincides with the more abundant expression of VRK2B detected by western blot FEBS Journal 273 (2006) 2487–2504 ª 2006 The Authors Journal compilation ª 2006 FEBS 2491 Differential stabilization of p53 by VRK2 isoforms S Blanco et al The two VRK2 isoforms have a different subcellular localization Substrate specificity of VRK2 isoforms and p53 phosphorylation To identify and confirm the subcellular localization of both VRK2 isoforms the cDNA of each isoform was cloned in pCEFL–HA vector that contains an HA epitope tag (because there is no monoclonal antibody specific for each isoform), resulting in clones pCEFL– HA–VRK2A and pCEFL–HA–VRK2B The presence of a hydrophobic tail in VRK2A suggests that this isoform might be associated with membranes Cos1 cells were transfected with each of the constructs and the location of the transfected protein was determined with an anti-HA serum Isoform VRK2A was localized to the membrane of the ER and nuclear envelope, as shown by its colocalization with calreticulin (Fig 4A) Isoform VRK2B, lacking the transmembrane domain, presented a diffuse pattern throughout the cytoplasm and some was even detected in the nucleus and outside the nucleolus Because of this nuclear presence we tested whether VRK2B shares a subcellular location with a known target of the related VRK1 protein, such as the p53 tumour-suppressor protein [11,12] For this, H1299 (p53– ⁄ –) cells were cotransfected with either of the VRK2 isoforms and pCB6 + p53 VRK2B, but not VRK2A, and p53 proteins were detected in the nucleus, with some overlap in their fluorescence, and outside the nucleolus (Fig 4B) Despite the C-terminal domain differences, the catalytic domains are identical in both VRK2 isoforms To determine if there was any difference in substrate specificity between the two isoforms, a panel of substrates commonly used to characterize Ser-Thr kinases related to casein kinase I were used [1,11] Both isoforms phosphorylated casein, histone 2B and myelin basic protein in a similar manner, but did not phosphorylate histone (not shown) Furthermore, the two VRK2 isoforms had a strong autophosphorylation activity in vitro when tested as GST–VRK2 fusion proteins (Fig 5A) To identify substrates of the VRK2 kinase that are of biological relevance we analysed the effect on the phosphorylation of p53 in its N-terminus, transactivation domain, because it is a known substrate of its related kinase VRK1 [11] For this we used several GST–p53 (murine) fusion proteins containing individual or combined substitutions of Ser or Thr residues [61,62] There was a loss of radioactive signal whenever the Thr18Ala substitution was introduced by itself or in combination with Ser15Ile or Ser20Ala VRK2A and VRK2B have an identical in vitro phosphorylation pattern (Fig 5A), and Thr18 appears to be the main residue phosphorylated, as detected by a loss of Fig Subcellular localization of VRK2A and VRK2B proteins Cos1 or H1299 cell lines were transfected with either constructs of VRK2A or -B tagged with the HA epitope and expressed in a pCEFL vector Expression of VRK2 isoforms was detected with a monoclonal antibody specific for the HA epitope (A) Colocalization of HA–VRK2A with calreticulin, a marker for the ER, was detected with an anti-calreticulin serum in Cos1 cells Nuclei were identified with DAPI (B) Colocalization in the nucleus of H1299 cells of transfected HA–VRK2B and p53 The HA–VRK2B protein was detected with an antibody against the HA epitope tag The p53 protein was detected with a mix of DO1 and Pab1801 monoclonal antibodies Bar ¼ 50 lm 2492 FEBS Journal 273 (2006) 2487–2504 ª 2006 The Authors Journal compilation ª 2006 FEBS S Blanco et al Differential stabilization of p53 by VRK2 isoforms Fig Phosphorylation of p53 in vitro by VRK2A and VRK2B (A) Phosphorylation of GST–p53 (murine) fusion proteins with different individual amino acid substitutions by the VRK2A (upper) and VRK2B (lower) isoforms The GST–p53 substrates used were FP221, residues 1–85; FP279, residues 11–65; FP267, residues 1–64 Fusion proteins were made with the murine p53, but the numbering is that of the human p53 protein in this conserved region Individual Ser or Thr substitutions are indicated (B) Phosphoamino acid analysis of phosphorylated GST–p53, the staining with ninhydrin and the radioactivity incorporation are shown (C) Phosphorylation of human p53 by VRK2B Four human GST–p53 constructs spanning different regions of p53 were used as substrates of VRK2B On the left is shown the detection of the proteins with Coomassie Brilliant Blue staining and to the right is shown the incorporation of radioactivity (D) Interaction between VRK2B and p53 H1299 cells were transfected with plasmids pGST–VRK2B or kinase-dead pGST–VRK2B(K169E) and pCB6 + p53 or pCB6 + p53T18A in the combinations indicated in the figure and their correct expression was checked in the cell lysate prepared 48 h after transfection (upper) The lysate was mixed with glutathione–Sepharose beads for 4–12 h at °C with and the beads were pulled-down by centrifugation The proteins brought down with the beads were analysed in an immunoblot with specific antibodies (lower) (E) Lack of Hdm2 phosphorylation by the VRK2B isoform As substrates VRK2B kinase two different Hdm2 proteins were used; a full-length protein with a His tag and a GST fusion protein of the Hdm2 amino terminus (residues 1–188) In the left panel is shown the Coomassie Brilliant Blue staining and in the right-hand panel is shown the incorporation of radioactivity FEBS Journal 273 (2006) 2487–2504 ª 2006 The Authors Journal compilation ª 2006 FEBS 2493 Differential stabilization of p53 by VRK2 isoforms S Blanco et al phosphate incorporation Similar results were obtained using a construct spanning p53 residues 1–85, 1–64 or 11–63 Phosphorylated GST–p53 was used to determine the incorporation of radioactivity in a phosphoamino acid analysis Incorporation was seen only in threonine residues, which is unique in the common region (Fig 5B) Next, the phosphorylation of human p53 was studied using either a full-length protein or partial constructs Phosphorylation was detected only in constructs within the N-terminal p53 region, as expected (Fig 5C), and no incorporation was detected associated with constructs spanning residues 90–390 In kinase reactions the interaction between the kinase and substrate is very short However, it is sometimes possible to detect stable intermediate complexes between a kinase and its substrate if the reaction cannot be performed Therefore, to address the possibility that VRK2B might form a complex with p53 an experiment using different proteins, either wild-type or mutated, was designed H1299 cells were transfected with pGST–VRK2B mammalian expression constructs, both the wild-type and the inactive kinase (pGST– VRK2B–K169E), which express a catalytically inactive form of VRK2B because it lacks the lysine essential for kinase activity As a substrate we used p53 or its nonphosphorylatable p53T18A variant Expression of the different proteins was confirmed in whole-cell lysates (Fig 5D, upper), and these lysates were used for a pull-down of GST–VRK2B-associated proteins identified by immunoblot analysis Formation of a stable complex was detected when an inactive kinase VRK2B(K169E) was used, independent of the p53 status, either wild-type or mutated p53T18A No stable complex could be formed between an active VRK2B and a nonphosphorylatable p53 The inability of an inactive kinase to transfer the phosphate resulted in the formation and detection of a stable intermediate VRK2B(K169E)–p53 complex (Fig 5D, lower) Because the N-terminus of p53 interacts with Mdm2, the potential phosphorylation of Hdm2 (human Mdm2) was studied using either full-length protein or its N-terminus (residues 1–188), which is the region of interaction with p53, but we did not detect any phosphorylation by VRK2A or VRK2B isoforms (Fig 5E; VRK2A not shown) VRK2B but not VRK2A induces the accumulation of p53 The p53–Mdm2 interaction promotes p53 ubiquitination and degradation via the proteasome pathway Phosphorylation of p53 at its N-terminus frequently 2494 results in disruption of this interaction and consequently in its stabilization [63] Therefore, we determined using western blot analysis whether the phosphorylation of p53 by VRK2B or VRK2A also resulted in its stabilization H1299 (p53– ⁄ –) cells were transfected with pCB6 + p53 and increasing amounts of pCEFL–HA–VRK2A or pCEFL–HA–VRK2B VRK2B, but not VRK2A, induced an accumulation of p53, which was higher as the amount of transfected VRK2B was increased (Fig 6) To confirm that both Fig Stabilization of transfected p53 induced by VRK2B H1299 (p53– ⁄ –) lung carcinoma cells were transfected with 25 ng of pCB6 + p53, and varying amounts (0, 2, and lg) of plasmids expressing pCEF–-HA–VRK2A, pCEF–-HA–VRK2B or the kinase dead pCEF–-HA–VRK2B(K169E) Detection of total p53 from in whole-cell lysate extracts was carried out with a mix of DO1 and Pab1801 antibodies At the bottom is shown the quantification of p53 normalized with b-actin depending on the kinase isoform used in the assay as the mean of two independent experiments Western blots were performed using the specific antibodies indicated in Experimental procedures FEBS Journal 273 (2006) 2487–2504 ª 2006 The Authors Journal compilation ª 2006 FEBS S Blanco et al Differential stabilization of p53 by VRK2 isoforms HA-tagged VRK2 isoforms expressed in culture were active, an in vitro kinase assay with the immunoprecipitated protein was performed (data not shown) Therefore, p53 in vivo is one target of VRK2B, probably because they colocalize in the same compartment However, VRK2A, which is in the cytosol in a membrane-bound form, is not able to induce p53 accumulation To confirm that this was dependent on the activity of VRK2B, we used a construct pCEFL–HA– VRK2B(K169E) that expresses a catalytically kinase dead form of VRK2B because it lacks the lysine essential for kinase activity Indeed, this inactive mutant of VRK2B did not induce accumulation of p53 (Fig 6) The stabilization of p53 by VRK2B is a post-translational effect To determine whether the effect induced by VRK2B on the p53 levels is a consequence of post-translational modification, an experiment was performed in the presence of the protein synthesis inhibitor cycloheximide H1299 cells were transfected with pCB6 + p53 or a combination of pCB6 + p53 and pCEFL–HA– VRK2A or pCEFL–HA–VRK2B, 36 h later cycloheximide was added and the levels of p53 were determined by immunoblots at different time points The amount of protein was normalized to the level of b-actin In the absence of VRK2B, p53 was degraded almost immediately, as expected, whereas its levels were stable for more than h in the presence of VRK2B (Fig 7) A similar experiment was performed with VRK2A; this isoform did not protect p53 from degradation VRK2B stabilizes endogenous p53 and activates its transcriptional activity Next we determined whether VRK2B could also stabilize the endogenous p53 protein For this assay the A549 cell line (p53+ ⁄ +) was used After transfection with VRK2B, cells were treated with cycloheximide, and the level of endogenous p53 protein was determined at different times The stability of endogenous p53 (half-life) was less than 20 minutes in the absence of VRK2B, but in its presence, the stability of p53 was significantly increased (Fig 8A) A consequence of this stabilization by VRK2B is that p53 might be transcriptionally active To determine whether the VRK2 proteins affected transcription, A549 cells were transfected with a p53 synthetic reporter, plasmid p53–Luc, which contains several p53-response elements VRK2B, but not VRK2A, activated this promoter (Fig 8B) In order to verify whether VRK2B affected the transcription of a p53 target gene we used the pMdm2–Luc Fig Stability of p53 by VRK2B is a post-translational effect H1299 cells (p53– ⁄ –) were transfected with 50 ng of pCB6 + p53, without (upper) or with (middle) lg of pCEF–-HA–VRK2B, 36 h after transfection cycloheximide (CHX) was added to the culture at a final concentration of 60 lgỈmL)1 and the levels of p53 were determined at different time points by immunoblot analysis Cell lysates were analysed by western blot The p53 protein was detected with a mix of DO1 and Pab1801 antibodies, and HA–VRK2B was detected with anti-HA serum At the bottom it is also shown the relative level of p53 normalized with the b-actin level at each time point C represents a control for transfection with an empty vector without p53 reporter containing the Mdm2 promoter VRK2B also activated the transcription of Mdm2 (Fig 8B) Next, A549 cells were transfected with increasing amounts of pCEFL–HA–VRK2B, and the luciferase activity of the p53–Luc reporter was determined As VRK2B increased, so did endogenous p53-dependent transcription (Fig 8C) p53 phosphorylation by VRK2B differs from that induced by adriamycin or taxol We showed that VRK2B phosphorylates p53 in vivo at Thr18 First it was confirmed that transfected p53 was phosphorylated at Thr18 by VRK2B in H1299 cells (p53– ⁄ –) When the cells were transfected with VRK2B, there was an increase in p53 phosphorylation as shown by western blot analysis (Fig 9A, upper) However, because only a fraction of the cells were transfected and the p53-Thr18 phospho-specific antibody is not very sensitive, the specific signal is difficult to detect in whole-cell extracts To improve detection, p53 was FEBS Journal 273 (2006) 2487–2504 ª 2006 The Authors Journal compilation ª 2006 FEBS 2495 Differential stabilization of p53 by VRK2 isoforms S Blanco et al Fig Stabilization of endogenous p53 and activation of p53dependent transcription (A) Stabilization of endogenous p53 by the VRK2B isoform in A549 (p53+ ⁄ +) lung carcinoma cell line A549 cells were transfected with lg of pCEF–-HA–VRK2B and 36 h after transfection cycloheximide was added to the culture The amount of endogenous p53 protein at different time points was determined with a mix of DO1 and Pab1801 antibodies and HA–VRK2B was determined with anti-HA serum (Upper) Levels of p53 in the absence of VRK2B, (lower) levels of p53 in the presence of VRK2B (B) Activation of endogenous p53-dependent transcriptional activity by VRK2B A549 cells were cotransfected with or without VRK2 isoforms and a p53 synthetic reporter plasmid (p53– Luc, containing p53 response elements) or a specific gene promoter (Mdm2–Luc,containing Mdm2 promoter) pBASIC and pSV40Control reporters were used, respectively, as negative and positive controls of the luciferase assay Reporter luciferase activity was normalized for transfection levels with Renilla luciferasa (pRL-tk) (C) Dependence of transcriptional activation on the dose of transfected VRK2B A549 cells were transfected with increasing amounts of pCEF–-HA–VRK2B and 0.5 lg of p53–Luc reporter construct, and 0.3 lg of pRL-tk Luc Luciferase activity was determined 48 h after transfection and normalized with Renilla luciferase activity Data from at least three independent experiments were analysed with Student’s t-test *P < 0.05; **P < 0.005 VRK2B In the same experiment the phosphorylation of Ser15 was also determined However, the relative phosphorylation of Thr18 was higher in the presence of VRK2B than in the presence of adriamycin, and was similar to that induced by taxol (Fig 9B, middle) VRK2B induced relatively higher phosphorylation of Thr18 with respect to Ser15 phosphorylation, while in the presence of taxol or adriamycin, both residues were phosphorylated equally (Fig 9B, lower), suggesting that VRK2B did not require previous phosphorylation on Ser15 The higher absolute signal in drug-treated cells is due to the fact that all cells responded, whereas only a fraction were transfected with the VRK construct concentrated by immunoprecipitation, and phosphorylation at Thr18 was determined using a phosphorspecific antibody Inclusion of VRK2B increased the phosphorylation of transfected p53 in Thr18 by approximately fourfold, as shown in Fig 9A (lower) The next step was to determine the phosphorylation of endogenous p53 protein in A549 cells (p53+ ⁄ +) in the presence of overexpressed VRK2B; as a positive control for phosphorylation, cells were treated with either adriamycin or taxol All, overexpression of VRK2B or drugs induced Thr18 phosphorylation as detected using a phosphor-specific antibody (Fig 9B) Thr18 phosphorylation was dependent on the dose of 2496 VRK2B reduces p53 ubiquitination and promotes its acetylation by p300 Phosphorylation of p53 at its N-terminal region modulates its affinity for different binding proteins Therefore, a consequence of p53 phosphorylation at Thr18 might be to change its binding characteristics to Mdm2 [58,64,65] Based on the phosphorylated residue by VRK2B, the expected effect would be a reduction in the p53–Mdm2 interaction [54], and consequently a decrease in its ubiquitination In H1299 cells, transfection of VRK2B clearly reduces the ubiquitination of p53 by exogenous Mdm2 (Fig 10A), indicating that the phosphorylation induced by VRK2B might alter FEBS Journal 273 (2006) 2487–2504 ª 2006 The Authors Journal compilation ª 2006 FEBS S Blanco et al Differential stabilization of p53 by VRK2 isoforms Fig In vivo phosphorylation of p53 Thr18 by VRK2B (A) Phosphorylation of transfected p53 in H1299 cells (p53– ⁄ –) by VRK2B H1299 cells were transfected with 0.1 lg of pCB6 + p53 and lg of pCEF–-HA–VRK2B Thirty-six hours after transfection the cells were lysed for western blot analysis (upper) or immunoprecipitation of p53 followed by western blot (lower) The quantification of the relative phosphorylation of p53 is shown (B) Phosphorylation of endogenous p53 in Thr18 by VRK2B in A549 cells (p53+ ⁄ +) As positive control treatment with adriamycin (0.5 lgỈmL)1 for h) or taxol (100 nM for 12 h) are included VRK2B phosphorylates p53 in Thr18 in a dose-dependent manner Adryamicin and taxol treatments also increase Thr18 phosphorylation The middle graph shows relative Thr18 phosphorylation, and the lower graph shows Thr18 phosphorylation with respect to Ser15 phosphorylation the interaction of p53 and Mdm2, therefore causing p53 accumulation The coactivator p300 also interacts with the p53 transactivation domain and contributes to p53 stabilization and activation To test the possibility that phosphorylated p53 might bind to this transcriptional coactivator, H1299 cells were transfected with different combinations of VRK2B (pCEFL–HA–VRK2B), p53 (pCB6 + p53) and p300 (pHA-p300) expression constructs The effect on p53 protein levels and degree of acetylation was determined by immunoblot analysis, with an antibody specific for acetylation in Lys373 and Lys382 of whole-cell extracts Indeed, it was observed that VRK2B facilitates p53 acetylation (Fig 10B) The p53 protein was also concentrated by immunoprecipitation to improve detection of its acetylation In the absence of p300, the acetylation of p53 was enhanced slightly by VRK2B, and was particularly noticeable when cotransfected with pCMV-p300-HA (Fig 10C), indicating that p53 stabilized by VRK2B was acetylated de novo Discussion Alternative splicing of the human VRK2 gene generates two isoforms with a common kinase domain and a different C-terminus, which determines their subcel- lular location VRK2A localizes to the ER, whereas VRK2B variant, in contrast to those previously detected by RT-PCR [13], is detected in both the cytoplasm and nucleus, outside the nucleolus, despite lacking a known NLS VRK2A is highly expressed in different cell lines, whereas VRK2B expression is more restricted and appears to be coordinated by an unknown mechanism Because different cell types present different proportions of both isoforms, and the substrate specificities of both VRK2 isoforms and their relative VRK1 [11,16,17] are similar in vitro, we postulate that the biological effects mediated by these kinases might be determined by their subcellular localization and the proteins present in the corresponding compartment, and by their C-terminal domain, which mediates interactions with different proteins Their regulation is likely to be controlled by the different C-terminus, which determines their interaction with other regulatory proteins not yet identified, but whose future identification will contribute to the unravelling of the signalling pathway to which these kinases belong For instance, VRK2B and VRK1 are localized in the nucleus but differ in their last 90 amino acids in the C-terminus Stabilization of p53 is part of the response to cellular stress, and is usually mediated by phosphorylations carried out by a large number of kinases that target FEBS Journal 273 (2006) 2487–2504 ª 2006 The Authors Journal compilation ª 2006 FEBS 2497 Differential stabilization of p53 by VRK2 isoforms S Blanco et al Fig 10 Effect of VRK2B on ubiquitination and acetylation of p53 (A) Reduced ubiquitination of p53 by Mdm2 in the presence of VRK2B H1299 cells (p53– ⁄ –) were cotransfected with 0.5 lg of pCB6 + p53, 0.5 lg of BRR12-His-ubiquitin, 1.5 lg of pCOC-Mdm2-X2 and 2.5 lg of pCEF–-HA–VRK2B Transfections were performed with the JetPEI reagent 36 h after transfection lM lactacystin (a proteasome inhibitor) was added to the culture and 12 h later the cells were lysed with RIPA buffer for analysis by western blot Single p53 and ubiquitinated p53 were detected with a mix of DO1 and Pab1801 antibodies, HA–VRK2B was detected with anti-HA monoclonal serum and for Mdm2 detection we used anti-SMP14 monoclonal serum The bar graph represents the mean of three independent experiments with its SD *P < 0.02 (B) Increased acetylation of p53 by p300 in the presence of VRK2B H1299 cells were transfected with the indicated constructs and whole cell extracts were immunoblotted with specific antibodies as indicated (C) Identification of p53 acetylation promoted by VRK2B H1299 cells were transfected with the plasmids indicated and p53 was immunoprecipitated with a mix of DO1 and Pab240 antibodies The cells were treated with lM of Trichostatin A from Streptomyces sp (TSA), a deacetylase inhibitor Cells were lysed in the acetylation-precipitation buffer with TSA, and p53 was immunoprecipitated with a mix of DO1 and Pab240 antibodies The acetylation of p53 in residues Lys373 and Lys382 was determined with a specific antibody as indicated in Experimental procedures The constructs used in transfections were pCB6 + p53, p-CEFL-HA–VRK2B and pCMV-p300-HA The bar graph represents the mean of two independent experiments with its SD and *P < 0.05 (D) H1299 cells were transfected with plasmid encoding wild-type p53 or different substitution as indicated, with or without pCEF–-HA–VRK2B Detection of total p53 from in whole-cell lysate extracts was carried out with a mix of DO1 and Pab1801 antibodies several different residues, mainly located in the p53 N-terminus, and generates a complex pattern of phosphorylation [33] Furthermore, the p53 N-terminus mediates the interaction using many regulatory molecules such as acetyl transferases [58] and ubiquitin ligases, for example, its downregulator Mdm2 [66] The specificity of the interactions can be modulated by phosphorylation at different residues, of which Ser15 and Ser20 are the best characterized, and result in p53 stabilization [41] However, stabilization can also occur in the absence of Ser15 or Ser20 phosphorylation [46], in this case, Thr18 phosphorylation is the other likely mechanism for p53 stabilization Thr18 phosphoryla2498 tion is mediated by some kinases, of these casein kinase delta requires the previous phosphorylation of Ser15 [50] and is cytosolic in interphase [51], whereas VRK1 or VRK2B phosphorylate Thr18 directly and are nuclear proteins [11] Thr18 phosphorylation contributes to p53 stabilization The other VRK2A, which has a different subcellular location and does not colocalize with p53, is not able to induce stabilization Cytosolic VRK2A is therefore more like casein kinase delta as both phosphorylate Thr18 in vitro [50] Therefore, a different subcellular location and different modulation of a common kinase domain may determine different biological activities Phosphorylation of FEBS Journal 273 (2006) 2487–2504 ª 2006 The Authors Journal compilation ª 2006 FEBS S Blanco et al Thr18 has been observed in vivo in cells treated with taxol [59,67] and in senescent fibroblast [60] However, the phosphorylation at Thr18 induced by taxol or adriamycin is also accompanied by the phosphorylation of Ser15, probably via activation of stressresponse pathways; this is not the case for VRK2B, which is probably mediated via a different signalling pathway or cooperates with some of these stressresponse pathways It has also been postulated that Thr18 phosphorylation might play a role in normal growth [15], and this may be the reason for its detection in cellular senescence [60] Phosphorylation of the N-terminus might be a regulatory mechanism for a docking site in p53, particularly in Thr18, which affects the interaction with either Mdm2 [54] or p300 [58,64,68] The consequence of p53T18 phosphorylation is a disruption of p53 interaction with Mdm2, because this residue is essential for maintaining the structure of the p53-binding region [53,54,69], by reducing p53 ubiquitination it contributes to its stabilization and promotes other protein interactions [15] The coactivator p300 binds to p53 in the same region as Mdm2, and promotes its stabilization and transactivation by acetylation [70] In the case of Thr18 phosphorylation by VRK2B, there is an increase in p53 stability and transactivation, as expected, if improved binding to p300 and disruption of the Mdm2 interaction were promoted by this phosphorylation [55,58] The effects observed regarding phosphorylation of human p53 in Thr18 are consistent with similar findings reported for the role of the equivalent residue in murine p53, Thr21 [48], and it has also been reported that Thr18 phosphorylation by VRK1 stabilizes p53 and promotes its binding to Mdm4 and p300 [15] Although p53 can be phosphorylated at several residues by many kinases, the precise functional consequences resulting from different combinations of phosphorylated residues are not well known It has been proposed that the nuclear kinase VRK1 has a role in the regulation of p53 in the cellular response to suboptimal stress during interphase [15], which is the normal physiological situation Phosphorylation of Thr18 is likely to be a component of a p53 cycle that is necessary to maintain basal levels of p53, these levels are needed if normal proliferation is to be able to respond to severe stress signals [15] However, in adenocarcinoma tumour cell lines, VRK1 is localized in the cytoplasm, therefore it may not regulate p53 In this situation, the VRK2B isoform is expressed and is located in the nucleus where it might functionally replace VRK1 in this suboptimal protective role, given the similarity of their effect on p53 This indicates two novel levels of regulation of VRK Differential stabilization of p53 by VRK2 isoforms proteins, one is the coordination of their expression, VRK2B is formed when VRK1 is cytosolic, but not when is nuclear; and the other is how VRK2B is transported to the nucleus because it lacks a nuclear localization signal, that is present in the C-terminus of VRK1 [11] The effect of VRK2B on p53 Thr18 phosphorylation is functionally redundant with the effect of VRK1 [15] regarding p53 VRK2B can therefore functionally replace VRK1 in those cells where the latter is cytosolic, although they are likely to be regulated differently, because they differ in their C-terminus This function would suggest that there should be some redundancy in these genes, and this would explain why the murine knockout of VRK2 is viable [71,72] The VRK family of Ser-Thr kinases represents the beginning of novel signalling pathways that operate in many cell types and that are beginning to be unravelled Experimental procedures RNA extraction, RT-PCR, cloning and mutagenesis Total RNA from H1299, HeLa and MCF7 was isolated using RNAeasy Mini Kit (Qiagen, Hilden, Germany) RNA was analysed and quantified using a Bioanalyser 2100 nano-lab chip from Agilent Technologies (Waldbronn, Germany) cDNA was synthesized as previously reported [11] Different primers were designed to generate full-length VRK2 (nucleotides 130–1657; GenBank accession number AB000450) based on human VRK2 [7] VRK2A: 5¢CCCGGATCCATGCCACCAAAAAGAAATGAAAAAT ACAAACTTCC-3¢ (nucleotides 130–165), this primer has the initiation codon and a BamH1 cloning site VRK2X: 5¢GGGTCTAGAGGAATTTTGGTATCATCTTCAGAG-3¢ (nucleotides 1652–1675 antisense strand), with an XbaI cloning site and the termination codon VRK2S: 5¢-GGGGTC GACGGAATTTTGGTATCATCTTCAGAG-3¢ (nucleotides 1652–1675 antisense strand), with a SalI cloning site and the termination codon Human full-length VRK2 was made with primers VRK2A and VRK2X or VRK2S from HeLa RNA for cloning in pGEX4T-1 (Amersham Biosciences, Little Chalfont, UK) For expression in eukaryotic cells, the VRK2A and VRK2B full-length cDNA were subcloned in vector pCEFL–HA or pCEFL–GST with restriction sites BamHI–NotI, using primers VRK2A, VRK2Not1.A: 5¢-GGGCGGCCGCGGAATTTTGGTATC ATCTTCAGAG-3¢ and VRK2TN.1: 5¢-GCGGCCGCCTA AGCTTCTACCTGAGCTGCTTC-3¢ To detect the new exon in VRK2 transcripts two pairs of flanking primers were designed Forward primer VRK2TA: 5¢-AGTGAGG AAGCGCTGAGTCCT-3¢, and reverse primer: VRK2TB: 5¢-CAAGAGTCTCAAGAACCTTTG-3¢ which amplify fragments of nucleotides 135–179 specific for isoform A FEBS Journal 273 (2006) 2487–2504 ª 2006 The Authors Journal compilation ª 2006 FEBS 2499 Differential stabilization of p53 by VRK2 isoforms S Blanco et al and B messages, respectively, and forward primer VRK2TC: 5¢-GCAGCTCAGGTAGAAGCTTAGG-3¢, and reverse primer: VRK2TD: 5¢-CGTGCTGACTGTGGAAG TGT-3¢ specific for isoform B One hundred nanograms of total RNA was used in a one-step RT real-time PCR amplification reaction using the ‘Quantitec SYBR Green RT-PCR kit’ from Quiagen in an iCycler (Bio-Rad, Hercules, CA) The reaction was analysed using icycler software (Bio-Rad) The VRK2B cDNA sequence has GenBank accession number AJ512204 An inactive or kinase-dead (KD) VRK2 mutation was made by site-specific mutagenesis introducing the K169E substitution in mammalian expression constructs and in GST fusion proteins Sitedirected mutagenesis was performed with the Quick-Change Mutagenesis kit from Stratagene (San Diego, CA) Plasmids and fusion proteins The GST–p53 constructs containing the N-terminus of murine p53 and its mutants were a gift of D Meek (Dundee University, UK) [61,62] The human GST–p53 fusion proteins, 1–390 (full-length), 90–290 and 290–390 were from T Kouzaridis (Cancer Research UK, Cambridge, UK) Fulllength human pHdm2-his and N-terminus of pGST–Hdm2 (residues 1–188) were from A Levine (Rockfeller University, New York) GST-fusion proteins were expressed in BL21DE3 cells and purified using glutathione–Sepharose (Amersham) as previously reported [11] His-tagged proteins were expressed in, purified with TALON Metal Affinity Resin (BD Biosciences, Erembodegem, Belgium) and eluted with 100 nm imidazol (Merck, Darmstadt, Germany) Mammalian expression plasmids containing human p53 wild-type cDNA, pCB6 + p53, and pCOC-Mdm2-X2 were from K Vousden (Beatson Institute, UK) and plasmid pCMVb-p300HA was from R Eckner (University of Zurich) The ubiquitin tagged with a His epitope for mammalian expression (clone BRR12-His-ubiquitin) was from S Lain and D Lane (Dundee University, UK) Plasmid pMdm2–Luc was a gift from B Vogelstein The p53-cis reporter plasmid (p53–Luc) with the luciferase gene was from Stratagene (La Jolla, CA) Ser-Thr kinase activity assay Kinase activity was determined by assaying protein phosphorylation in a mixture containing 20 mm Tris ⁄ HCl, pH 7.5, mm MgCl2, 0.5 mm dithiothreitol, 150 mm KCl and lm (5 lCi) [32P]ATP[cP] (Amersham) with lg of GST–VRK2 protein and 10 lg of another protein as substrate when indicated The reaction was routinely performed for 30 at 30 °C [11] The phosphorylated products were analysed in an SDS-polyacrylamide gel and the incorporation of radioactivity was determined either by autoradiography or in a Molecular Imager FX (Bio-Rad) Phosphoamino acid analysis was performed as previously described [16,17] 2500 Acid hydrolysis and phosphoamino acid analysis An in vitro kinase assay was performed with GST–VRK2B and GST–p53 (FP267) as substrates The phosphorylated proteins were fractionated by SDS ⁄ PAGE and transferred onto an Immobilon-P filter (Millipore, Bedford, MA), radioactive bands corresponding to GST–p53 were excised and the protein was eluted The eluted protein was hydrolysed with 200 lL of n HCl at 110 °C for h The sample was freeze-dried and resuspended in a mixture containing lL of a stock solution at mgỈmL)1 of P-Ser, P-Thr and P-Tyr as reference markers, lL of 1% bromophenol blue and lL of formic acid ⁄ acetic acid ⁄ water (1:3.1:35 v ⁄ v ⁄ v) pH 1.9 The mixture was applied to a cellulose chromatoplaque (Merck) and subjected to flat-bed electrophoresis in a Multiphor II system (Amersham Biosciences) at 1.5 kV for 90 After air drying, the radioactivity on the chromatoplaque was exposed to X-ray film Phosphoamino acid markers were detected by staining with a 0.25% ninhydrin solution in acetone Cell lines, transfections and luciferase reporter assay Cell lines 293T, C4-I, HeLa, Siha, SW756, Cal51, H9528, A498, HepG2, Cos1, Colo 320, HCT116, OSA, RMS13, NIH 3T3 and WiDr were grown in DMEM; and cell lines Jukat, JY, HPBALL, Jijoye, HL60, H1299, A549 and MCF7 were grown in RPMI both supplemented with 10% fetal bovine serum, glutamine, penicillin, and streptomycin in a humidified 5% CO2 atmosphere For H1299 and A549 cells, 0.5 · 106 cells were plated in 60 mm dishes, or · 106 in 100 mm diameter dishes After 24 h the cells were transfected with the indicated amounts of plasmids and JetPEI reagent (PolyTransfection, Illkirch, France) according to the manufacturer’s recommendations Empty vector pGEX4T1 was used as carrier In the experiments determining p53 accumulation were used 25 ng of pCB6 + p53 and increasing amounts of pCEF–-HA– VRK2A or pCEF–-HA–VRK2B Cycloheximide (60 lg mL)1) was added 36 h after transfection Adriamycin (Sigma, St Luis, MO) was added to a final concentration of 0.5 lg mL)1 and Taxol was used at 100 nm For the ubiquitination assay 0.5 · 106 H1299 cells were seeded in 60 mm dishes and transfected with 0,5 lg of pCB6 + p53, 0,5 lg of BRR12-His-ubiquitin, 1,5 lg of pCOC-Mdm2-X2 and 2,5 lg de pCEF–-HA–VRK2B with 10 lL of JetPEI reagent and 36 h after transfection, the proteasome inhibitor lactacystin (Sigma) was used at lm For the acetylation assay · 106 H1299 cells were plated in 100 mm diameter dishes and were transfected with 0,1 lg of pCB6 + p53, lg of pCMV-p300-HA and lg de pCEF–-HA–VRK2B with 20 lL of JetPEI reagent; lm Trichostatin A was added to the culture h before harvesting cells For transcription assay experiments, FEBS Journal 273 (2006) 2487–2504 ª 2006 The Authors Journal compilation ª 2006 FEBS S Blanco et al 0.5 · 106 A549 cells were seeded in 60 mm dishes and 24 h later were transfected in triplicate with JetPEI reagent and 0.5 lg of p53–Luc as luciferase reporter, and increasing amounts of pCEF–-HA–VRK2A or pCEF–-HA–VRK2B and as internal control for transfection we used 0.3 lg of pRenilla-tk (pRL-tk) reporter plasmid from Promega (Madison, WI) Cells were lysed 48 h after transfection and luciferase activity was determined with Dual-luciferase Reporter Assay System (Promega) in a luminometer Minilumat LB9506 (Berthold, Bad Wildbad, Germany) Immunofluorescence Cells were seeded in 60 mm dishes, grown on a coverslip and transfected as indicated in specific experiments with pCEF–-HA–VRK2A and -B and also pCB6 + p53 in the H1299 cell line using the calcium phosphate precipitation method; 48 h post transfection the slides were collected and fixed with 3% paraformaldehyde for 30 at room temperature, treated with 10 mm glycine for 10 at room temperature and then permeabilized with 0.2% Triton X100 for 30 at room temperature The cells were blocked with 1% bovine serum albumin (BSA) in NaCl ⁄ Pi for 30 at room temperature followed by double immunostaining with the corresponding antibodies Finally, cells were stained with DAPI (Sigma) 1:1000 in NaCl ⁄ Pi for 10 at room temperature, washed with NaCl ⁄ Pi, and slides were mounted with Gelvatol (Monsanto) The analysis was performed with a Zeiss LSM510 confocal microscope Differential stabilization of p53 by VRK2 isoforms beads were washed three times with lysis buffer and analysed by SDS ⁄ PAGE To detect endogenous VRK2 a rabbit polyclonal antibody which recognized both isoforms was prepared by immunizing rabbit with human VRK2A GST-fusion protein VRK1 was detected with a mouse monoclonal antibody, clone 1F6, prepared against the human VRK1 protein The monoclonal antibody specific for the HA epitope was from Covance (San Francisco, CA) The polyclonal antibody specific for calreticulin was from Calbiochem (La Jolla, CA) and monoclonal anti(calnexin AF18) was from Santa Cruz p53 protein was detected with a mix of DO1 antibody (Santa Cruz) and Pab1801 (Santa Cruz) used at 1:500 and 1:1000, respectively To detect the phosphorylation of p53 in Thr18 and in Ser15 rabbit polyclonal antibody, P-p53 (Thr18)-R, and a monoclonal P-p53 (Ser15)-R from Santa Cruz were used A rabbit antiserum from Upstate Biotechnology (Lake Placid, NY) detecting specifically acetylated p53 in Lys373 and 382 was used SMP14 monoclonal antibody (Santa Cruz) was used to detect the Mdm2 protein The monoclonal anti-(bactin) was from Sigma Mitochondria were detected using the MitoTracker Red CMXRos reagent (Molecular Probes, Eugene, OR) The secondary antibodies used from Amersham were an anti-(mouse-Cy2) (Fluorolink Cy2), anti(rabbit-Cy3) (Fluorolink Cy3) and anti-(rabbit-Cy2) (Fluorolink Cy2) for immunofluorescence, or an anti(mouse-HRP) or anti-(rabbit-HRP) for western blots Luminescence in western blot was developed with an ECL kit (Amersham Biosciences) Acknowledgements Western blot analysis, immunoprecipitation, pull-down assays and antibodies Cells were harvested 48 h post transfection and lysed with RIPA buffer (150 mm NaCl, 1,5 mm Mg Cl2, 10 mm NaF, 100% glycerol, mm EDTA, 1% Triton X-100, 0,1% SDS, 50 mm Hepes pH 7,4, protease and phosphatase inhibitors) or in acetylation immunoprecipitation buffer (50 mm Hepes, pH 7.8, 200 mm NaCl, 1% Triton X-100, 10 mm EDTA, mm dithiothreitol, lm trichostatin A and protease and phosphatase inhibitors) Fifty micrograms of total protein lysate were analysed in a 10% SDS-polyacrylamide gel Cell lysates were subjected to p53 immunoprecipitation with monoclonal antibodies DO1 and pab240 (Santa Cruz Biotchnology, Santa Cruz, CA) at °C overnight, followed by adsorption to c-Bind (Amersham Biosciences) and analysed in a 7.5% SDS-polyacrylamide gel For GST pulldown assays cells were lysed with a buffer containing buffer 20 mm Tris ⁄ HCl pH 7.4, 137 mm NaCl, mm EDTA, 25 mm b-glycerophosphate, mm pyrophosphate, 10% (v ⁄ v) glycerol and 1% Triton X-100 plus protease inhibitors GST pull-downs were performed by incubating mg of total cell extract with glutathione–Sepharose 4B beads (Amersham Pharmacia Biotech) for 12 h at °C Sepharose ´ The technical assistance by Virginia Gascon is greatly appreciated SB, LK and FMV were supported by fel´ lowships from Ministerio de Educacion y Ciencia, EU ´ ´ Marie Curie Training Center, and Fundacion Ramon ´ Areces and Fundacion Cientı´ fica AECC, respectively This work was supported by grants from Ministerio ´ de Educacion y Ciencia (SAF2004-02900), Fondo de ´ ´ Investigacion Sanitaria (FIS-PI02-0585), Fundacion de ´ ´ ´ Investigacion Medica MM, Junta de Castilla y Leon ´ (SAN ⁄ SA04 ⁄ 05 and CSI05A05), and Fundacion Mem´ oria Samuel Solorzano Barruso References Manning G, Whyte DB, Martinez R, Hunter T & Sudarsanam S (2002) The protein kinase complement of the human genome Science 298, 1912–1934 Kamath RS, Fraser AG, Dong Y, Poulin G, Durbin R, Gotta M, Kanapin A, Le Bot N, Moreno S, Sohrmann M et al (2003) Systematic functional analysis of the Caenorhabditis elegans genome using RNAi Nature 421, 231–237 FEBS Journal 273 (2006) 2487–2504 ª 2006 The Authors Journal compilation ª 2006 FEBS 2501 Differential stabilization of p53 by VRK2 isoforms S Blanco et al Morrison DK, Murakami MS & Cleghon V (2000) Protein kinases and phosphatases in the Drosophila genome J Cell Biol 150, F57–F62 Dhillon N & Hoekstra MF (1994) Characterization of two protein kinases from Schizosaccharomyces pombe involved in the regulation of DNA repair EMBO J 13, 2777–2788 Hoekstra MF, Liskay RM, Ou AC, DeMaggio AJ, Burbee DG & Heffron F (1991) HRR25, a putative protein kinase from budding yeast: association with repair of damaged DNA Science 253, 1031–1034 Ho Y, Mason S, Kobayashi R, Hoekstra M & Andrews B (1997) Role of the casein kinase I isoform, Hrr25, and the cell cycle-regulatory transcription factor, SBF, in the transcriptional response to DNA damage in Saccharomyces cerevisiae Proc Natl Acad Sci USA 94, 581–586 Nezu J, Oku A, Jones MH & Shimane M (1997) Identification of two novel human putative serine ⁄ threonine kinases, VRK1 and VRK2, with structural similarity to vaccinia virus B1R kinase Genomics 45, 327–331 Lin S, Chen W & Broyles SS (1992) The vaccinia virus B1R gene product is a serine ⁄ threonine protein kinase J Virol 66, 2717–2723 Banham AH & Smith GL (1992) Vaccinia virus B1R encodes a 34-kDa serine ⁄ threonine protein kinase that localizes in cytoplasmic factories and is packaged into virions Virology 191, 803–812 10 Rempel RE & Traktman P (1992) Vaccinia virus B1 kinase: phenotypic analysis of temperature-sensitive mutants and enzymatic characterization of recombinant proteins J Virol 66, 4413–4426 11 Lopez-Borges S & Lazo PA (2000) The human vacciniarelated kinase (VRK1) phosphorylates threonine-18 within the mdm-2 binding site of the p53 tumour suppressor protein Oncogene 19, 3656–3664 12 Barcia R, Lopez-Borges S, Vega FM & Lazo PA (2002) Kinetic properties of p53 phosphorylation by the human vaccinia-related kinase Arch Biochem Biophys 399, 1–5 13 Nichols RJ & Traktman P (2004) Characterization of three paralogous members of the mammalian vaccinia related kinase family J Biol Chem 279, 7934–7946 14 Lazo PA, Vega FM & Sevilla A (2005) Vaccinia-related kinase-1 AfCS-Nature Molecule Pages 10.1038/ mp.a003025.003001 15 Vega FM, Sevilla A & Lazo PA (2004) p53 stabilization and accumulation induced by human vaccinia-related kinase Mol Cell Biol 24, 10366–10380 16 Sevilla A, Santos CR, Barcia R, Vega FM & Lazo PA (2004) c-Jun phosphorylation by the human vacciniarelated kinase (VRK1) and its cooperation with the N-terminal kinase of c-Jun (JNK) Oncogene 23, 8950– 8958 17 Sevilla A, Santos CR, Vega FM & Lazo PA (2004) Human vaccinia-related kinase (VRK1) activates the 2502 18 19 20 21 22 23 24 25 26 27 28 29 ATF2 transcriptional activity by novel phosphorylation on Thr-73 and Ser-62 and cooperates with JNK J Biol Chem 279, 27458–27465 Vega FM, Gonzalo P, Gaspar ML & Lazo PA (2003) Expression of the VRK (vaccinia-related kinase) gene family of p53 regulators in murine hematopoietic development FEBS Lett 544, 176–180 Dorrell MI, Aguilar E, Weber C & Friedlander M (2004) Global gene expression analysis of the developing postnatal mouse retina Invest Ophthalmol Vis Sci 45, 1009–1019 Santos CR, Rodriguez-Pinilla M, Vega FM, RodriguezPeralto JL, Blanco S, Sevilla A, Valbuena A, Hernandez T, van Wijnen AJ, Li F et al (2006) VRK1 signaling pathway in the context of the proliferation phenotype in head and neck squamous cell carcinoma Mol Cancer Res 4, 177–185 McLean LA, Gathmann I, Capdeville R, Polymeropoulos MH & Dressman M (2004) Pharmacogenomic analysis of cytogenetic response in chronic myeloid leukemia patients treated with imatinib Clin Cancer Res 10, 155–165 Shiio Y, Eisenman RN, Yi EC, Donohoe S, Goodlett DR & Aebersold R (2003) Quantitative proteomic analysis of chromatin-associated factors J Am Soc Mass Spectrom 14, 696–703 Tien ES, Gray JP, Peters JM & Vanden Heuvel JP (2003) Comprehensive gene expression analysis of peroxisome proliferator-treated immortalized hepatocytes: identification of peroxisome proliferator-activated receptor {alpha}-dependent growth regulatory genes Cancer Res 63, 5767–5780 Vernell R, Helin K & Muller H (2003) Identification of target genes of the p16INK4A-pRB-E2F pathway J Biol Chem 278, 46124–46137 Boldrick JC, Alizadeh AA, Diehn M, Dudoit S, Liu CL, Belcher CE, Botstein D, Staudt LM, Brown PO & Relman DA (2002) Stereotyped and specific gene expression programs in human innate immune responses to bacteria Proc Natl Acad Sci USA 99, 972–977 Diehn M, Alizadeh AA, Rando OJ, Liu CL, Stankunas K, Botstein D, Crabtree GR & Brown PO (2002) Genomic expression programs and the integration of the CD28 costimulatory signal in T cell activation Proc Natl Acad Sci USA 99, 11796–11801 Prives C & Hall PA (1999) The p53 pathway J Pathol 187, 112–126 Vousden KH & Lu X (2002) Live or let die: the cell’s response to p53 Nat Rev Cancer 2, 594–604 Garcia-Cao I, Garcia-Cao M, Martin-Caballero J, Criado LM, Klatt P, Flores JM, Weill JC, Blasco MA & Serrano M (2002) ‘Super p53’ mice exhibit enhanced DNA damage response, are tumor resistant and age normally EMBO J 21, 6225–6235 FEBS Journal 273 (2006) 2487–2504 ª 2006 The Authors Journal compilation ª 2006 FEBS S Blanco et al 30 Hemann MT, Fridman JS, Zilfou JT, Hernando E, Paddison PJ, Cordon-Cardo C, Hannon GJ & Lowe SW (2003) An epi-allelic series of p53 hypomorphs created by stable RNAi produces distinct tumor phenotypes in vivo Nat Genet 33, 396–400 31 Alarcon-Vargas D & Ronai Z (2002) p53-Mdm2 – the affair that never ends Carcinogenesis 23, 541–547 32 Woods DB & Vousden KH (2001) Regulation of p53 function Exp Cell Res 264, 56–66 33 Saito S, Yamaguchi H, Higashimoto Y, Chao C, Xu Y, Fornace AJ Jr, Appella E & Anderson CW (2003) Phosphorylation site interdependence of human p53 posttranslational modifications in response to stress J Biol Chem 278, 37536–37544 34 Meek DW (1998) Multisite phosphorylation and the integration of stress signals at p53 Cell Signal 10, 159– 166 35 Bode AM & Dong Z (2004) Post-translational modification of p53 in tumorigenesis Nat Rev Cancer 4, 793– 805 36 Siliciano JD, Canman CE, Taya Y, Sakaguchi K, Appella E & Kastan MB (1997) DNA damage induces phosphorylation of the amino terminus of p53 Genes Dev 11, 3471–3481 37 de Rozieres S, Maya R, Oren M & Lozano G (2000) The loss of mdm2 induces p53-mediated apoptosis Oncogene 19, 1691–1697 38 Ljungman M (2000) Dial 9-1-1 for p53: mechanisms of p53 activation by cellular stress Neoplasia 2, 208–225 39 Appella E & Anderson CW (2001) Post-translational modifications and activation of p53 by genotoxic stresses Eur J Biochem 268, 2764–2772 40 Brooks CL & Gu W (2003) Ubiquitination, phosphorylation and acetylation: the molecular basis for p53 regulation Curr Opin Cell Biol 15, 164–171 41 Ashcroft M, Taya Y & Vousden KH (2000) Stress signals utilize multiple pathways to stabilize p53 Mol Cell Biol 20, 3224–3233 42 Dumaz N, Milne DM, Jardine LJ & Meek DW (2001) Critical roles for the serine 20, but not the serine 15, phosphorylation site and for the polyproline domain in regulating p53 turnover Biochem J 359, 459–464 43 Dumaz N & Meek DW (1999) Serine 15 phosphorylation stimulates p53 transactivation but does not directly influence interaction with HDM2 EMBO J 18, 7002– 7010 44 Lambert PF, Kashanchi F, Radonovich MF, Shiekhattar R & Brady JN (1998) Phosphorylation of p53 serine 15 increases interaction with CBP J Biol Chem 273, 33048–33053 45 Shieh SY, Ahn J, Tamai K, Taya Y & Prives C (2000) The human homologs of checkpoint kinases Chk1 and Cds1 (Chk2) phosphorylate p53 at multiple DNA damage-inducible sites Genes Dev 14, 289–300 Differential stabilization of p53 by VRK2 isoforms 46 Jackson MW, Agarwal MK, Agarwal ML, Agarwal A, Stanhope-Baker P, Williams BR & Stark GR (2004) Limited role of N-terminal phosphoserine residues in the activation of transcription by p53 Oncogene 23, 4477–4487 47 Sluss HK, Armata H, Gallant J & Jones SN (2004) Phosphorylation of serine 18 regulates distinct p53 functions in mice Mol Cell Biol 24, 976–984 48 Knights CD, Liu Y, Appella E & Kulesz-Martin M (2003) Defective p53 post-translational modification required for wild type p53 inactivation in malignant epithelial cells with mdm2 gene amplification J Biol Chem 278, 52890–52900 49 Sakaguchi K, Saito S, Higashimoto Y, Roy S, Anderson CW & Appella E (2000) Damage-mediated phosphorylation of human p53 threonine 18 through a cascade mediated by a casein 1-like kinase Effect on mdm2 binding J Biol Chem 275, 9278–9283 50 Dumaz N, Milne DM & Meek DW (1999) Protein kinase CK1 is a p53-threonine 18 kinase which requires prior phosphorylation of serine 15 FEBS Lett 463, 312–316 51 Stoter M, Bamberger AM, Aslan B, Kurth M, Speidel D, Loning T, Frank HG, Kaufmann P, Lohler J, Henne-Bruns D et al (2005) Inhibition of casein kinase I delta alters mitotic spindle formation and induces apoptosis in trophoblast cells Oncogene 24, 7964– 7975 52 Chen J, Marechal V & Levine AJ (1993) Mapping of the p53 and mdm-2 interaction domains Mol Cell Biol 13, 4107–4114 53 Schon O, Friedler A, Bycroft M, Freund S & Fersht A (2002) Molecular mechanism of the interaction between MDM2 and p53 J Mol Biol 323, 491–501 54 Jabbur JR, Tabor AD, Cheng X, Wang H, Uesugi M, Lozano G & Zhang W (2002) Mdm-2 binding and TAF (II) 31 recruitment is regulated by hydrogen bond disruption between the p53 residues Thr18 and Asp21 Oncogene 21, 7100–7113 55 Yuan ZM, Huang Y, Ishiko T, Nakada S, Utsugisawa T, Shioya H, Utsugisawa Y, Yokoyama K, Weichselbaum R, Shi Y et al (1999) Role for p300 in stabilization of p53 in the response to DNA damage J Biol Chem 274, 1883–1886 56 Grossman SR (2001) p300 ⁄ CBP ⁄ p53 interaction and regulation of the p53 response Eur J Biochem 268, 2773–2778 57 Ito A, Lai CH, Zhao X, Saito S, Hamilton MH, Appella E & Yao TP (2001) p300 ⁄ CBP-mediated p53 acetylation is commonly induced by p53-activating agents and inhibited by MDM2 EMBO J 20, 1331– 1340 58 Dornan D, Shimizu H, Perkins ND & Hupp TR (2003) DNA-dependent acetylation of p53 by the transcription coactivator p300 J Biol Chem 278, 13431–13441 FEBS Journal 273 (2006) 2487–2504 ª 2006 The Authors Journal compilation ª 2006 FEBS 2503 Differential stabilization of p53 by VRK2 isoforms S Blanco et al 59 Damia G, Filiberti L, Vikhanskaya F, Carrassa L, Taya Y, D’Incalci M & Broggini M (2001) Cisplatinum and taxol induce different patterns of p53 phosphorylation Neoplasia 3, 10–16 60 Webley K, Bond JA, Jones CJ, Blaydes JP, Craig A, Hupp T & Wynford-Thomas D (2000) Posttranslational modifications of p53 in replicative senescence overlapping but distinct from those induced by dna damage Mol Cell Biol 20, 2803–2808 61 Milne DM, Palmer RH, Campbell DG & Meek DW (1992) Phosphorylation of the p53 tumour-suppressor protein at the three N-terminal sites by a novel casein kinase I-like enzyme Oncogene 7, 1361–1369 62 Milne DM, Campbell DG, Caudwell FB & Meek DW (1994) Phosphorylation of tumor suppressor protein p53 by mitogen-activated protein kinase J Biol Chem 269, 9253–9260 63 Ashcroft M, Kubbutat MH & Vousden KH (1999) Regulation of p53 function and stability by phosphorylation Mol Cell Biol 19, 1751–1758 64 Dornan D & Hupp TR (2001) Inhibition of p53-dependent transcription by BOX-I phospho-peptide mimetics that bind to p300 EMBO Report 2, 139–144 65 Ferguson M, Luciani MG, Finlan L, Rankin EM, Ibbotson S, Fersht A & Hupp TR (2004) The development of a CDK2-docking site peptide that inhibits p53 and sensitizes cells to death Cell Cycle 3, 80–89 2504 66 Kubbutat MHG, Jones SN & Vousden KH (1997) Regulation of p53 stability by mdm2 Nature 387, 299–303 67 Stewart ZA, Tang LJ & Pietenpol JA (2001) Increased p53 phosphorylation after microtubule disruption is mediated in a microtubule inhibitor- and cell-specific manner Oncogene 20, 113–124 68 Pospisilova S, Brazda V, Kucharikova K, Luciani MG, Hupp TR, Skladal P, Palecek E & Vojtesek B (2004) Activation of the DNA-binding ability of latent p53 protein by protein kinase C is abolished by protein kinase CK2 Biochem J 378, 939–947 69 Kussie PH, Gorina S, Marechal V, Elenbaas B, Moreau J, Levine AJ & Pavletich NP (1996) Structure of the MDM2 oncoprotein bound to the p53 tumor suppressor transactivation domain Science 274, 948–953 70 Li M, Luo J, Brooks CL & Gu W (2002) Acetylation of p53 inhibits its ubiquitination by Mdm2 J Biol Chem 277, 50607–50611 71 Agoulnik AI, Lu B, Zhu Q, Truong C, Ty MT, Arango N, Chada KK & Bishop CE (2002) A novel gene, Pog, is necessary for primordial germ cell proliferation in the mouse and underlies the germ cell deficient mutation, gcd Hum Mol Genet 11, 3047–3053 72 Lu B & Bishop CE (2003) Late onset of spermatogenesis and gain of fertility in POG-deficient mice indicate that POG is not necessary for the proliferation of spermatogonia Biol Reprod 69, 161–168 FEBS Journal 273 (2006) 2487–2504 ª 2006 The Authors Journal compilation ª 2006 FEBS ... expression of VRK2A and VRK2B proteins in tumour cell lines To demonstrate that the two messages identified code for real proteins, we determined their presence in a panel of tumour cell lines using... specificity of VRK2 isoforms and p53 phosphorylation To identify and confirm the subcellular localization of both VRK2 isoforms the cDNA of each isoform was cloned in pCEFL–HA vector that contains an... the biological effects mediated by these kinases might be determined by their subcellular localization and the proteins present in the corresponding compartment, and by their C-terminal domain,