binding and uptake of hiv by dendritic cells and transfer to t lymphocytes

Báo cáo y học: "Differential induction of inflammatory cytokines by dendritic cells treated with novel TLR-agonist and cytokine based cocktails: targeting dendritic cells in autoimmunity" potx

... level in the periphery of the patient, prior to chemoattraction of these cells from the circulation into the site of inflammation The treatment in our in vitro model with cocktails containing Th1 ... to maturation stimuli at the inflammatory site, likely through stimulation with inflammatory chemokines and cytokines and/ or combined with TLR agonists present at the site, DCs migrate to the ... Immature DCs are developed from monocytes using conventional methods The treatment with a drug candidate in our setting correlates to the potential treatment at the monocyte or steady state immature...

12
377
0

Dendritic cells respond differently to live and killed bacteria molecular mechanisms of pathogen recognition by dendritic cells and implications for vaccine development

Danh mục: Cao đẳng - Đại học

... proliferation and the generation of antibodies (for B cells) and the generation of armed effector T cells such as cytotoxic T cells and helper T cells (Th) (for T cells) Some of these B and T cells will ... dendritic cells, cells that phagocytose and kill the pathogens Among the innate immune cells, dendritic cells are the most potent activators of adaptive immunity 1.3.1 Dendritic cells Dendritic ... infection indirectly and is activated by the cleavage product of Spatzle Activation of Toll results in the recruitment of adaptor Tube and protein kinase Pelle to the membrane, leading to the...

158
246
0

Investigation of interleukin 1b synthesis and secretion by dendritic cells interplay between toll like receptor and FCG receptor

Danh mục: Tổng hợp

... interaction induces phosphorylation of TAB2 and TAK1, resulting in the 23 translocation of both complexes into the cytosol TAK1 is then activated in the cytoplasm by the ubiquitination system ... Altogether, these changes culminate in the complete functional transition from potent Ag uptake to potent Ag presentation Figure 1.2 Maturation of DCs The left side of the scheme shows the factors ... isolation is based on adhesion to plastic surface (Bennett and Breit, 1994) The advantage of this method is that it is inexpensive and relatively easy to perform The purity of cells isolated by this...

173
251
0

Báo cáo khoa học: Uptake of bilirubin into HepG2 cells assayed by thermal lens spectroscopy Function of bilitranslocase doc

Danh mục: Báo cáo khoa học

... the activity of a membrane carrier Bilirubin uptake into HepG2 cells: effect of a protein-modifying reagent We attempted to disrupt the integrity of the bilirubin carrier by means of the protein-modifying ... not disturb the transport of bilirubin from its surface binding site, which is targeted by antibody A, into the hepatocyte This lack of inhibition is an exception, as the hepatocellular uptake ... PMSF contrasts with the only partial (no more than 30%) inhibition of electrogenic BSP uptake by the latter This is in line with the earliest prediction, that the occupation of the bilitranslocase...

14
369
0

báo cáo hóa học:" Highly efficient transduction of human plasmacytoid dendritic cells without phenotypic and functional maturation" docx

Danh mục: Hóa học - Dầu khí

... immunogenicity of the vector preparations and the specificity and safety of promoters used in gene therapy protocols Competing interests The authors declare that they have no competing interests Authors' ... results indi- cate that the LV transduction does not alter the phenotype of pDC or their capacity to mature Functional properties of transduced pDC We evaluated the ability of different transduced ... evaluated the capacity of the HLA-A0201 expressing pDC to activate a CD8+ T cell clone after transduction with a LV coding for the MART-1 peptide under the control of the PGK promoter The transduced...

12
374
0

Báo cáo y học: "Identification of proteases employed by dendritic cells in the processing of protein purified derivative (PPD)" pdf

Danh mục: Báo cáo khoa học

... [3-6,12] Thus, it will be interesting to compare DC from different tissues and in different states of maturation for their protease profiles and susceptibilities to pepstatin A treatment We believe that ... family of protease activities Finally, pepstatin A, but not other protease inhibitors, abrogated almost completely the ability of XS52 DC to digest native PPD into an antigenic product, suggesting ... whereas it did not affect the presentation of PPD fragments; b) pepstatin A pretreatment inhibited cathepsin D/E activity selectively among the DC-associated protease activities; and c) all tested...

9
292
0

Báo cáo y học: " A novel trifunctional IgG-like bispecific antibody to inhibit HIV-1 infection and enhance lysis of HIV by targeting activation of complement" ppsx

Danh mục: Báo cáo khoa học

... (antigp120 × anti-C3d)-Fc will inhibit the complement inhibitors (fH and CD59) binding to HIV that may enhance CoML More importantly, this targeted complement activator is able to bind to sites ... addition to inhibition of MAC formation by CD59, the degradation of C3b by factor I and factor H reduces amplification Whereas inhibition of complement activity is the desired outcome in the vast ... for HIV gp120 and the other for the C3d It is expected not only to target block HIV- gp120 and C3d on the surface of HIV, but also can enhance complement activation through the complement-activating...

4
242
0

Báo cáo khoa học: "A novel approach to inhibit HIV-1 infection and enhance lysis of HIV by a targeted activator of complement" docx

Danh mục: Báo cáo khoa học

... innovative approach to find a novel targeted activator of complement for the elimination of HIV Presentation of the hypothesis Interaction of HIV with the complement system HIV infection leads to the ... critical for efficient B cell-mediated transmission of complement-opsonized HIV to T cells [26] Complement receptor type on target and bystander cells Complement activation by the presence of HIV ... factor (DAF) and protectin (CD59), and the soluble factor H(fH) that can down-regulate complement activation at several stages of cascade and protect host cells from complement-mediated damage The...

4
287
0

Báo cáo khoa học: " A novel approach to inhibit HIV-1 infection and enhance lysis of HIV by a targeted activator of complement" doc

Danh mục: Báo cáo khoa học

... innovative approach to find a novel targeted activator of complement for the elimination of HIV Presentation of the hypothesis Interaction of HIV with the complement system HIV infection leads to the ... critical for efficient B cell-mediated transmission of complement-opsonized HIV to T cells [26] Complement receptor type on target and bystander cells Complement activation by the presence of HIV ... factor (DAF) and protectin (CD59), and the soluble factor H(fH) that can down-regulate complement activation at several stages of cascade and protect host cells from complement-mediated damage The...

4
271
0

Báo cáo y học: "Thymic plasmacytoid dendritic cells are susceptible to productive HIV-1 infection and efficiently transfer R5 HIV-1 to thymocytes in vitro" pdf

Danh mục: Báo cáo khoa học

... infects thymocytes by demonstrating that thymic pDC were able to transfer productive R5 HIV- 1 infection to both CD3hi and CD3lo thymocytes The efficient transfer of R5 HIV- 1 by thymic pDC to Evans ... unlikely to significantly transfer HIV- 1 to thymocytes as these cells were included together with the thymic mDC, that did not transfer virus Instead, thymic M-DC8+ DC may contribute to the establishment ... mature functional CD4 + T cells in vitro [37,38] Given the high susceptibility of thymic pDC to productive R5 HIV- 1 infection, and their ability to transfer this infection to both immature and...

12
348
0

Aerobic Uptake of Cholesterol by Ergosterol Auxotrophic Strains in Candidaglabrata & Random and Site-Directed Mutagenesis of ERG25 in Saccharomyces cerevisiae

Danh mục: Y khoa - Dược

... ATGTTAGTCCttgccgatttcggcctattg Forward C.g ERG7 CATAAGTTTATAAATTTGTATATTGAAAAATTGGAAGTGCAACGGTGTTGT AAAGCAATAggcgggtgtcggggctggc Reverse C.g ERG7 AGTTTAAAAAAATTTTCGTTCGTAGCGCGGTATATAATATTATGCAGTGTA TATAGGAAAttgccgatttcggcctattg ... GGTTAATTCTGTTTGTTATTGAAAAAAACAAAATCAAATGAAAGCGAGT TAGTGAAAAAAAAGTATAGTGATATGTAGTCCGttgccgatttcggcctattg Forward C.g ERG27 TCATGAAATCAACTGCTACAACTTCAATATCAGGTAATAAACAGGATAT TAACAATCATTggcgggtgtcggggctggc ... TCAGCGTATATCCCGTATACGAGCCAGACAGCAATATTGTTTGAAGTAGG TTTTGACCATTGATTATTGGAAGAAAATGttgccgatttcggcctattg Forward C.g ERG25 ACTTGATAAGATAAGAATTTGGTAAACAGGATATCTATTCTTCTTTCTCA CATTTAGAGCCTTAGACAAAACAACAAGCCggcgggtgtcggggctggc Reverse...

101
140
0

CD8 t cell mediated induction of interleukin 12p70 production by dendritic cells

Danh mục: Thạc sĩ - Cao học

... 2008) Stimulation of epithelial cells via PRRs results in the production of thymic stromal lymphopoietin (TSLP) that directly activates DCs to prime CD4 T cells to differentiate into Th2 cells ... samples of the solution for pH adjustment The solution was autoclaved with the cap loosely but firmly screwed to the bottle to minimize evaporation at this stage The solution was allowed to cool to ... co-stimulatory signals, for instance CD28 stimulation by CD80/86 that is essential for optimal T cell proliferation and activation Signal three represents factors that determine the character of the T...

197
186
0

THE ROLE OF DMSO IN THE REGULATION OF IMMUNE RESPONSES BY DENDRITIC CELLS

Danh mục: Cao đẳng - Đại học

... Surfactant protein SR Scavenger receptor STAT - protein Signal Transducers and Activators of Transcription protein TAP Transport associated protein TBS Tris-buffered saline TCR T cell receptor TCR ... affect each other The immune system is able to detect and recognize a wide variety of foreign pathogens through various receptors The important task therefore is to differentiate these foreign pathogens ... production of pro-inflammatory and anti-inflammatory cytokines and chemokines, induction of apoptosis, and production of molecules required for effective antigen presentation to activate the adaptive...

166
529
0

MethadoneMaintenance Treatment Promotes Referral and Uptake of HIV Testing and Counselling Services amongst Drug Users and Their Partners

Danh mục: Luận văn báo cáo - ngoại ngữ

... 49] This study contributes to the literature by demonstrating that enrollment in MMT may empower patients to be catalysts for accelerating the expansion of HIV testing amongst at risk populations ... use, and duration of MMT treatment HTC uptake, willingness to pay and referral Outcomes of interest included the number of HTC events, patients’ willingness to pay (WTP) for a HTC service, and ... providing HTC integrated with MMT sites appeared to facilitate HTC uptake and interest in referring to peers to HTC among drug using populations HTC uptake Most of the respondents (94.2%) reported ever...

16
193
0

Tài liệu Báo cáo khoa học: Metabolic control of mitochondrial properties by adenine nucleotide translocator determines palmitoyl-CoA effects Implications for a mechanism linking obesity and type 2 diabetes pdf

Danh mục: Báo cáo khoa học

... that changes in the ATPtotal ⁄ ADPtotal ratio reﬂect changes in the ATPout ⁄ ADPout ratio Palmitoyl-CoA caused a signiﬁcant concentration-dependent decrease in the ATPtotal ⁄ ADPtotal ratio and ... relevant total adenylate concentration (2 mm) We determined how palmitoyl-CoA (5 and 10 lm) affects the ATPtotal ⁄ ADPtotal ratio and [AMP]total in actively phosphorylating (state 3) mitochondria ... opposite Palmitoyl-CoA tended to increase the positive control of the ATPin ⁄ ADPin ratio by ATP synthesis and the negative control by the proton leak The negative control of the ATPin ⁄ ADPin ratio...

15
546
0

Báo cáo sinh học: " Role of HIV-1 subtype C envelope V3 to V5 regions in viral entry, coreceptor utilization and replication efficiency in primary T-lymphocytes and monocyte-derived macrophages" docx

Danh mục: Hóa học - Dầu khí

... N-HTEN N-HTEN SS SF I SN SS I SN SS I V3 PGRAFVTIGK .Y .T. E Q YAT.D Q YAT.D Q YAT.D QT.YAT.D QT.YAT.D QT.YAT.D QT.YAT.E QT.YAT.E S.QT.Y .T. E S.QT.Y .T. E QT.YAT.D QT.YAT.D Q YAT.E Q YAT.E QT.YAT.D ... efficiencies of R5 phenotype of the chimeras correlated with advanced disease status of the patients (Table 1) Taken together, the increased replication capabilities of HIV- 1 subtype C in T- lymphocytes and ... penicillin-streptomycin to about 80% confluency The cells were then split and counted and plated in a 6-well plate at 105 cells/ well in DMEM with 10% FBS without antibiotics The cells were transfected the...

12
408
0

Báo cáo hóa học: " Role of HIV-1 subtype C envelope V3 to V5 regions in viral entry, coreceptor utilization and replication " docx

Danh mục: Hóa học - Dầu khí

... N-HTEN N-HTEN SS SF I SN SS I SN SS I V3 PGRAFVTIGK .Y .T. E Q YAT.D Q YAT.D Q YAT.D QT.YAT.D QT.YAT.D QT.YAT.D QT.YAT.E QT.YAT.E S.QT.Y .T. E S.QT.Y .T. E QT.YAT.D QT.YAT.D Q YAT.E Q YAT.E QT.YAT.D ... efficiencies of R5 phenotype of the chimeras correlated with advanced disease status of the patients (Table 1) Taken together, the increased replication capabilities of HIV- 1 subtype C in T- lymphocytes and ... penicillin-streptomycin to about 80% confluency The cells were then split and counted and plated in a 6-well plate at 105 cells/ well in DMEM with 10% FBS without antibiotics The cells were transfected the...

12
684
0

báo cáo khoa học: "Trichoderma viride cellulase induces resistance to the antibiotic pore-forming peptide alamethicin associated with changes in the plasma membrane lipid composition of tobacco BY-2 cells" potx

Danh mục: Báo cáo khoa học

... soil situation where fungus and plant grow together and influence each other The objective of the present investigation was to investigate if different treatments of plant cells known to induce ... indicates that the cellulase elicits the resistance during the first part of the incubation and that no further stimulus is required, but that it takes a certain time for the response to develop ... led to altered membrane Page of 13 properties, the plant root will have built up its resistance to alamethicin This renders the plant root insensitive to alamethicin at concentrations that might...

13
293
0

Báo cáo y học: " Expression of Nef from unintegrated HIV-1 DNA downregulates cell surface CXCR4 and CCR5 on T-lymphocytes" docx

Danh mục: Báo cáo khoa học

... translation of Nef and Tat was shown to increase the activation state of resting Tlymphocytes, thereby rendering them more amenable to productive infection [13] The expression of early gene products ... software To test for statistically significant differences between groups, unpaired two-tailed t- tests were performed with confidence intervals set at 95% Abbreviations INSTI: Integrase strand ... virus typically 7% of the total population studied Infected cells were measured by flow cytometry for cell surface expression of CD4, CXCR4 and CCR5 A pattern of downregulation, similar to that of...

10
268
0

Báo cáo y học: "The evolution of HIV-1 reverse transcriptase in route to acquisition of Q151M multi-drug resistance is complex and involves mutations in multiple domains" ppt

Danh mục: Báo cáo khoa học

... (5’-GCTAGCTACTATTTCTTTTGCTACT-3’), followed by a nested PCR with primers 1870+ (5’GAGTTTTGGCTGAGGCAATGAG-3’) and 4295- (5’CTTTCATGCTCTTCTTGAGCCT-3’) Positive PCR products were identified by agarose ... Susceptibility to second-line NRTI ABC exhibited by patient-derived full-length RTs (D) Susceptibility to second-line NRTI ddI exhibited by patient-derived full-length RTs (E) Susceptibility to TDF ... important for improving the Q151M-containing virus’ replicative fitness and is thus important for the development of the Q151M pathway It will be interesting to elucidate the particular mutations...

11
350
0

binding and uptake of hiv by dendritic cells and transfer to t lymphocytes implications for pathogenesis