THE ROLE OF DMSO IN THE REGULATION OF IMMUNE RESPONSES BY DENDRITIC CELLS

THE ROLE OF DMSO IN THE REGULATION OF IMMUNE RESPONSES BY DENDRITIC CELLS ELAINE LAI MIN CHERN (B.Sc (Hons), NUS) A THESIS SUBMITTED FOR THE DEGREE OF MASTER OF SCIENCE DEPARTMENT OF MICROBIOLOGY NATIONAL UNIVERSITY OF SINGPAPORE 2010 ACKNOWLEDGEMENTS I would like to express my heartfelt gratitude to Assoc. Prof. Lu Jinhua for his dedicated supervision and encouragement throughout the project. His advice and concerns beyond academic and research were and will be always treasured. I would also like to take this opportunity to thank my friends and colleagues in the laboratory for their help, support and friendship during the course of my research. Special thanks to Boon King for the primers used in real time PCR. My gratitude also goes to the staffs at the National University Hospital Blood Bank and Blood Donation Centre for their help in buffy coat preparations. Lastly, I am ever grateful to my parents and husband, Jack Sheng for their care and support given unconditionally throughout my Master studies. I TABLE OF CONTENTS Acknowledgements I Table of Contents II Summary VII List of Tables VIII List of Figures IX List of Abbreviations XI Chapter 1 Introduction 1.1 The Immune System 1 1.2 Innate Immunity 1.2.1 Overview of Innate Immunity 4 1.2.2 Myeloid Cells Form a Major Arm of Innate Immunity 5 1.2.2.1 Monocytes 6 1.2.2.2 Monocytes Differentiation 8 1.2.2.3 Macrophages 10 1.2.2.4 Dendritic Cells 17 1.2.2.5 Heterogeneity of Dendritic Cells Subsets 18 1.2.2.6 DC Maturation and Migration 23 1.2.2.7 DCs in antigen uptake, processing and presentation 26 1.2.2.8 In vitro Human DC Differentiation Models 29 1.2.3 Pattern Recognition Receptors 30 1.2.3.1 Phagocytic Receptors 31 1.2.3.2 Toll-Like Receptors (TLRs) 33 II 1.2.3.2.1 TLRs and their ligands 35 1.2.3.2.2 TLR signaling 42 1.3 Adaptive Immunity 1.3.1 Overview of Adaptive Immunity 44 1.3.2 Th1 Immunity 48 1.3.2.1 Effectors of Th1 Immunity 49 1.3.3 Th2 Immunity 50 1.3.3.1 Effectors of Th2 Immunity 50 1.3.4 Th17 Immunity 51 1.3.4.1 Effectors of Th17 Immunity 52 1.4 Dendritic Cells in Th1, Th2 and Th17 Induction 52 1.5 Dimethyl Sulfoxide (DMSO) 57 1.6 Aims of Study 60 Chapter 2 Materials and Methods 2.1 Materials 62 2.1.1 Bacteria Culture and Preparation 62 2.2 Buffers and Media 62 2.3 Cell Culture Techniques 63 2.3.1 Isolation of Human Peripheral Blood Monocytes 63 2.3.2 Isolation of CD4+ T Cells 64 2.3.3 Monocyte Differentiation – Macrophage and DC Culture 64 2.3.4 Cell Lines Culture 65 2.3.4.1 THP-1 65 2.3.4.2 Human Embryonic Kidney 293T Cells (HEK293T) 65 III 2.3.4.3 Cryopreservation of Cell Lines 66 2.3.4.4 Thawing of cryopreserved cells 66 2.3.5 Priming and Activation of Monocyte, Macrophage and DC 66 2.3.6 Generation of anti-CD3/anti-CD28 coated beads 67 2.3.7 Mixed Leukocyte Reaction 68 2.4 Immuno-Detection of Proteins 68 2.4.1 Western Blotting 68 2.4.2 Protein Stripping from Western Blot 69 2.4.3 Flow Cytometry Analysis 69 2.4.3.1 Detection of Surface Proteins 69 2.4.3.2 Detection of Intracellular Proteins 70 2.4.3.3 Detection of Intracellular Cytokines 70 2.4.4 Cytokine Assay – ELISA 71 2.5 Protein Chemistry and Electrophoresis Techniques 72 2.5.1 SDS-Polyacrylamide Gel Electrophoresis 72 2.5.2 Coomassie Brilliant Blue Staining 73 2.5.3 Silver Staining 73 2.5.4 Quantification of Protein Concentration – Bradford Assay 74 2.6 Molecular Biology Techniques 74 2.6.1 Polymerase Chain Reaction 74 2.6.2 Real-time PCR 76 2.6.3 Isolation of Total RNA 77 2.6.4 Quantification of RNA 77 2.6.5 Reverse Transcription and cDNA Systhesis 77 2.6.6 DNA Agarose Gel Electrophoresis 78 IV 2.7 Histone Study Techniques 79 2.7.1 Cell Lysis 79 2.7.2 Acid Extraction of Histones 79 2.7.3 SDS-Isolation of Histone Proteins 80 2.8 Cell Death Assessment – LDH Assay 80 2.9 Statistical Analysis 81 Chapter 3 Results 3.1 Overview 82 3.2 Monocytes differentiate into Macrophages and DCs 83 3.3 DMSO Effect on Cytokine production by Macrophages and DCs 86 3.4 Time and Concentration Dependent Effect on DMSO on DCs 89 3.5 DMSO Treatment Effect on Cell Survival 93 3.6 DMSO Effect on Cytokine Production by GM-DC is reversible 95 3.7 DMSO Effect on GM-DC Maturation 97 3.8 DMSO does not affect the morphology of DCs 99 3.9 DMSO Enhances Th1 Type Immune Response induced by GM-DC 101 3.10 DMSO Effect on Histone Expression and Histone Modifications on DCs 106 3.11 DMSO Effect on CD4+ T Cell 109 3.12 DMSO Effect on Cytokine Production by CD4+ T Cells in MLR 111 3.13 DMSO Effect on Cytokine Production by CD4+ T Cells in Intracellular Cytokine Production 115 Chapter 4 Discussion V 4.1 DMSO primes APCs towards a Type I Immune Response 117 4.2 DMSO effect is concentration dependent 119 4.3 DMSO does not affect cell survival 120 4.4 DMSO does not affect cell morphology and DC maturation 121 4.5 DMSO Effect on cells is reversible 122 4.6 DMSO primes GM-DC to favour a Th1 Type of Immune Response 123 4.7 DMSO and Histone modifications 125 4.8 Conclusion and Future work 126 References 128 VI SUMMARY Dimethyl sulfoxide (DMSO) is a common agent for cryo-preservation despite its known toxicity. Dendritic cells (DCs) are potent in antigen uptake when immature, but become potent antigen presenting cells (APCs) upon maturation. Macrophages (MFs) are professional phagocytes. DMSO primed macrophages and DCs displayed differential cytokine production when stimulated with IFN-γ/LPS. DMSO primed DCs showed significant up-regulation of IL-12 and down-regulation of IL-10 production upon IFNγ/LPS stimulation. IL-23 production by DCs was also up-regulated by DMSO priming. Macrophage displayed a more tolerogenic profile and was not as responsive in response to DMSO priming unless GM-CSF was used to differentiate macrophages derived from monocytes. Cellular viability, morphology, antigen and maturation markers were not affected by DMSO priming. This study investigates the regulation of immune responses by DMSO primed DCs and how DMSO affects DCs in the cytokine production, morphology, and the ability to activate naive T cells to mount an adaptive response. VII LIST OF TABLES 1.1 Comparison of Innate and Adaptive Immunity 3 1.2 Comparison of DC subsets 22 1.3 Phagocytic receptors for microbes 33 1.4 TLRs 41 2.1 Reagents for SDS-PAGE 72 2.2 Primers used in PCR 76 VIII LIST OF FIGURES 1.1 The mononuclear-phagocyte system 8 1.2 Monocyte Differentiation into Macrophage and DCs 9 1.3 The ontogeny of Monocyte and Macrophage 11 1.4 Factors regulating the activation of various macrophages 16 1.5 The development, differentiation and maturation process of DCs 21 1.6 DC Maturation 25 1.7 Receptor and signaling interactions during phagocytosis 32 1.8 Signaling pathways for TLRs 43 1.9 Major pathways in the regulation of T cells development with the Th2 phenotype. 1.10 56 The role of cytokines in differentiation and effector functions of Th1, Th2 and Th17 cells. 56 3.1 Phenotypic markers on monocytes, macrophages and DCs 85 3.2 Figure 3.2 DMSO enhances LPS-elicited IL-12p70 production but suppresses LPS-elicited IL-10 production 3.3 DMSO increased IL-12p70 production by GM-DCs in a dose- and timedependent manner 3.4 88 90 DMSO inhibits IL-10 production by GM-DCs in a dose- and time-dependent manner 92 3.5 Determination of DMSO toxicity by LDH release assay 94 3.6 DMSO effect on cytokine by GM-DCS is lost upon removal of DMSO 96 3.7 DMSO does not alter expression of cell surface markers 98 3.8 DMSO does not affect GM-DC morphology 100 IX 3.9 Real-time PCR detection of cytokine mRNA in DMSO-primed GM-DCs 103 3.10 DMSO regulation of DC cytokine production 3.11 Western blot analysis of DMSO- and IFN-g/LPS-induced histone H3 104 methylation, acetylation and phosphorylation in GM-DCs 108 3.12 Direct DMSO Effect on T Cell Activation 110 3.13 DMSO Effect on T Cells Activation 113 3.14 DMSO Effect on T Cells Activation (Re-stimulation) 114 3.15 DMSO effect on IFN-γ and IL-17 production by CD4+ T cells (Intracellular cytokine staining) 116 X LIST OF ABBREVIATIONS Nucleotides containing adenine, thymine, cytosine, and guanine and abbreviated as A, T, C, and G respectively. Other abbreviations employed are listed as below in alphabetical order. Ab Antibodies Ag Antigen APCs Antigen presenting cells ATP Adenosine triphosphate BCR B cell receptor BSA Bovine serum albumin CD Cluster differentiation CHO Chinese Hamster Ovary CLA Cutaneous lymphocyte-associated CMV Cytomegalovirus CR Complement receptor CRP C reactive protein Da Dalton DC Dendritic cell DC-LAMP DC-lysosome-associated membrane protein DMEM Dulbecco’s Modified Eagle Medium DMSO Dimethyl sulfoxide DNA Deoxyribonucleic acid dNTP Deoxyribonucleic triphosphate XI DTT Dithiothreitol EDTA Ethylenediaminetetraacetic acid ERK Extracellular-signal-regulated kinase FITC Fluorescein isothiocyanate g Gram GATA Trans-acting T-cell-specific transcription factor GM-CSF Granulocyte macrophage colony-stimulating factor HEK Human embryonic kidney HI Heat-inactivated hr hour IFN Interferon Ig Immunoglobulin IL Interleukin im Immature IRAK IL-1 Receptor Associated Kinase IRF Interferon regulatory factor JNK C Jun N-terminal Kinase KDa Kilodalton LBP LPS binding protein LDH Lactate dehydrogenase LPS Lipopolysaccharide LTA Lipotechoic acid M Molar MAPK Mitogen activated protein kinase MBL Mannose binding lectin XII M-CSF Macrophage colony-stimulating factor MF Macrophage MHC Major Histocompatibility Complex min Minute ml milileter MLR Mixed lymphocyte reaction MMLV Moloney murine leukemia virus MR Mannose receptor mRNA Messenger RNA MyD88 Myeloid differentiation primary response gene 88 NF-κB Nuclear factor-kappa B ng nanogram NK Natural killer nm Nanometer NOD nucleotide-binding oligomerization domain NP-40 (octylphenoxy)-polyethoxyethanol OD Optical density OSA 2’-5’-oligoadenylate synthase PAGE Polyacrylamide gel electrophoresis PAMPs Pathogen-associated molecular patterns PBMCs Peripheral blood mononuclear cells PBS Phosphate buffered saline PCR Polymerase chain reaction PE Phycoerythrin PFA Paraformaldehyde XIII PGE Prostaglandin E PGN Peptidoglycan PKR Protein kinase receptor PRRs Pattern recognition receptors PVDF Polyvinylidene fluoride RNA Ribonucleic acid RT-PCR Reverse transcriptase-PCR SAP Serum amyloid protein SDS Sodium dodecyl sulphate SLE Systemic lupus erythematosus SP Surfactant protein SR Scavenger receptor STAT - protein Signal Transducers and Activators of Transcription protein TAP Transport associated protein TBS Tris-buffered saline TCR T cell receptor TCR T cell receptor TEMED N,N,N’,N’-tetramethylethylenediamine TGF-β Transforming growth factor beta Th T helper THP 1 Human acute monocytic leukemia cell line TIR Toll-interleukin 1 receptor (TIR) TIRAP TIR domain-containing adapter protein TLRs Toll-like receptors XIV TNF Tumour necrosis factor TRAM TRIF related adaptor molecule Treg Regulatory T cells TRIF TIR-domain-containing adapter-inducing interferon-β µl microliter µM micromolar XV CHAPTER 1 INTRODUCTION 1.1 The Immune System – An Overview The immune system is a complex defense system that has evolved to protect multicellular hosts from pathogenic microorganisms and abnormal cell growth leading to cancer. The immune system is able to differentiate between self and invading microorganisms. Once identified, the invading microorganisms or pathogens are contained, removed or destroyed before any damage could occur to the host. The immune system has also been recognized as an important defense mechanism against tumour development and cancer leading to the research and development of immunotherapy in cancer treatment. The immune system is built up by a variety of cell types and molecules with distinct but unique functional properties. Nevertheless, the cells and molecules are able to act in concert to maintain the integrity of the immune system. Cells of the immune system originate from their hemapoietic progenitors in the bone marrow. Some cells leave the bone marrow after they were created, migrate to other sites such as the thymus and mature into effector cells. Many of the immune cells mature in the bone marrow before migration to their respective sites in the body where they guard against invading pathogens. An immune response is established on two fundamental steps: recognition and response. The two events mutually affect each other. The immune system is able to detect and recognize a wide variety of foreign pathogens through various receptors. The important task therefore is to differentiate these foreign pathogens from the body’s own constituents, distinguishing between self and non-self. In doing so, the immune system 1 will then be able to induce appropriate and yet specific immune responses towards the specific pathogens. The immune system in mammals can be classified into two arms: the innate immunity and the adaptive immunity (Janeway, 1992). Innate immunity is generally conserved across all species but the adaptive immunity is only found in higher vertebrates (Medzhitov and Janeway, Jr., 1998). Innate immunity is also known as the natural or native immunity, referring to the host’s basic resistance to disease that one is born with and is available at the early stages of infection. The innate immune system consists of several immunoregulatory components, such as natural killer (NK) cells, phagocytes, complements and interferons (IFN) (Fearon and Locksley, 1996). The cells that constitute innate immunity express a restricted number of germline-encoded receptors. Hence, these cells are able to recognize a wide variety of conserved microbial products and pathogens (Janeway and Medzhitov, 2002). Adaptive immunity is referred to as ‘acquired immunity’ as it is acquired over time through natural microbial encounters or vaccination. Adaptive immunity is pathogen specific and possesses immunological memory which enables a faster and heightened immune reactivity to the same pathogen on its repeated encounter. In other words, adaptive immunity develops as a response to infection or vaccination and increases in magnitude and strength with each successive exposure to the same microorgamism (Abbas et al., 2000). The main effector cells of adaptive immunity are the T cells and B lymphocytes. These cells are capable in highly specific antigen detection via a huge repertoire of antigen receptors encoded by somatic gene recombination (Fearson and Lockley, 1996). The general properties of both innate immunity and adaptive immunity are summarized in Table 1.1. 2 Table 1.1 Comparison of Innate and Adaptive Immunity Properties Innate Immunity Effector Cells • Adaptive Immunity NK cells, Monocytes, DCs, • T and B Lymphocytes Macrophages Receptors • encoded in germline • no gene rearrangement • conserved • encoded by somatic gene recombinations • gene rearrangement • massive diversity Distribution of • receptors • non-clonal • clonal all class of an identical class • all cells of a distinct class Recognition conserved • molecular • specific molecular structures patterns Discrimination • of self vs. nonself Time of Action • perfect: immediate activation • delayed activation Responses • cytokines (IL-1β, IL-6) • clonal expansion or anergy • chemokine (IL-8) • IL-2 • co-stimulatory molecules • effector cytokines (IL-4, IL- selected over • evolutionary time imperfect: selected in individual somatic cells 17, IFN-γ) Modified from Janeway, Jr. and Medzhitov, 2002 While innate immunity and adaptive immunity are considered as two separate events, innate immunity and adaptive immunity are closely linked. The activation of innate immunity will then provide adaptive immunity with information regarding the nature of pathogenic challenge encountered by the host. This cannot be done by the T and B lymphocytes although T and B lymphocytes possess great variability in antigen recognition. This explains the occurrence of adverse immune response in autoimmune 3 diseases, allergy and allograft rejection. The antigen presenting cells (APCs) of innate immunity provide the activating signals through regulation of the surface expression of their co-stimulatory molecules such as CD80, CD86 and CD40. Monocytes, macrophages and dendritic cells (DCs) constitute the APCs with DCs playing the most important role in antigen presentation (Banchereau and Steinman, 1998) as DCs are known to be potent activators of T cells. The adaptive immunity will respond and enhance the effector mechanisms of innate immunity to efficiently eliminate the invading microorganisms. For example, the T cells activated by DCs antigen presentation will produce and secrete effector cytokines that will in turn activate macrophages and DCs to mount a stronger response towards the invading pathogen. Hence, the host is protected from the invading foreign microorganisms via the effective interplay of the both arms in the immune system. 1.2 Innate Immunity 1.2.1 Overview of Innate Immunity The innate immunity is known as the front line of host defence against invading pathogens. It is an ancient and universal host defence system (Janeway Jr. et al., 2002). The innate immune system alone is often sufficient to clear the source of infection before a disease develops. The immune mechanisms are able to act immediately because they do not require clonal expansion of antigen specific lymphocytes as the adaptive immunity does. However, the activation of innate immunity does not lead to immunological memory (Janeway Jr., 2002). The other important function of innate immunity is to process and present captured antigens for the stimulation of adaptive immune responses. The innate immunity relies on a set of germ-line encoded receptors to recognize the conserved molecular patterns in specific classes of microorganisms 4 (Medzhitov, 1998). The advantage of having a non-clonal immune system is that it enhances the adaptive immunity by delaying the need of activating adaptive immunity while the effector lymphocytes expand and differentiate (Janeway Jr. and Medzhitov, 2002). The innate immune system is mainly made up of mechanical, chemical and cellular components (Basset et al., 2003). The mechanical components of the innate immunity consist of epithelial cells and the mucosal fluid that form a physical barrier to prevent entry of infectious pathogens. The chemical components of innate immunity are further classified into three subcomponents: (i) fatty acids, proteins, peptides, and enzymes that can cause lysis of microbial pathogens; (ii) pattern recognition molecules such as cell surface receptors or soluble molecules; and (iii) cytokines and chemokines regulating immune responses. Lastly, the cellular components refer to all the cells that play an active role in innate immunity. These cells include epithelial cells, eosiniphils, DCs, mast cells, phagocytic cells, NK cells and γδ T cells. The natural flora and fauna found in the host’s body also form the innate immune system. Together, these components identify, contain and remove the invading pathogen. 1.2.2 Myeloid Cells form a Major Arm of Innate Immunity The cellular component in innate immunity formed by myeloid cells is a major arm of the innate immune system. The generation of immune cells through hematopoiesis is divided to lymphopoeisis which generates the lymphocytes and myelopoiesis. Myeloid cells include neutrophils, eosinophils, basophils, and monocytes which originate from the myeloid progenitor. 5 1.2.2.1 Monocytes Haematopoietic stem cells produced by the yolk sac migrate to the foetal liver during ontogeny and subsequently develop into immature phagocytes (Deimann and Fahimi, 1978). Monocytes appear in foetal blood ciriculation shortly after haematopoiesis begins (Keleman et al., 1979). Monocytes originate in the bone marrow from the committed progenitor cells for granulocytes and monocytes. Monocytes share a common myeloid progenitor, the colony forming unit granulocyte-monocyte (CFU-GM) with the neutrophils (Metcalf, 1971). The progenitor cells differentiate into monoblasts under the influence of colony-stimulating factors and then further differentiate into promonocytes, which is the first morphologically identifiable cells in this line of differentiation (van Furth and Diesselhoff-Den Dulk, 1970). The promonocytes will then divide into two daughter monocytes and are released into the blood circulation, circulating in the peripheral blood. The mononuclear-phagocyte system and the cells differentiation process are illustrated in Figure 1.1 Circulating monocytes migrate into various tissues and differentiate into tissue macrophages that possess specific morphological and functional properties according to the characteristics of the tissues they reside i.e. alveolar macrophages in the lung, microglia cells in the brain and kupffer cells in the liver. Monocytopoiesis can be influenced by various growth factors and cytokines. Interleukin 3 (IL-3), granulocyte macrophage colony-stimulating factor (M-CSF) and macrophage colony-stimulating factor (M-CSF) stimulate the mitotic activity of monocyte precursors (Jones and Millar, 1989). On the other hand, monocytopoiesis can be suppressed by type-I interferons such as IFN-α/β (Perussia et al., 1983) prostaglandin E (PGE) (Pelus et al., 1979) and factor increasing monocytopoiesis (FIM) (Metcalf, 1990). Monocytes were reported to be 6 heterogenous and composed of different subsets (Gordon and Taylor, 2005). Monocytes were initially identified by their high expression levels of CD14. Differential expression of CD14 and CD16 (also known as FCγRIII) provided the current basis for the classification of human monocytes into two subsets: CD14hiCD16- cells which are known as classic monocytes, and CD14+CD16+ cells which resembles mature tissue macrophages. It has been shown that monocytes can differentiate into macrophages or DCs when cultured in the presence of GM-CSF and interleukin-4 (IL-4) (Sallusto et al., 1994; Sanchez-Torres et al., 2001). There are in vitro transendothelial migration models showing that CD14+CD16+ monocyte subset was more likely to differentiate into DCs and reverse transmigrate across the endothelial layer while the CD14hiCD16- monocyte subset remaining in the sub-endothelial matrix developed into macrophages (Randolph et al., 1998). This suggests that the CD14+CD16+ subset might be precursors of DCs, which can pass through tissues and migrate to the lymph nodes through the afferent lymphatic vessels (Randolph et al., 2002). 7 Figure 1.1 The mononuclear-phagocyte system Monocytes differentiate from the HSC-GMCFU in bone marrow and can be further differentiated into macrophages, dendritic cells, and osteoclast residing in the adult tissues. (Gordon and Taylor, 2005) 1.2.2.2 Monocyte Differentiation Monocyte production is greatly increased during inflammation and enters the circulation within 24 hours of their formation (van Furth and Sluiter, 1986). Monocytes circulate for about 25 hours before extravasation. Monocytes can be activated to differentiate into macrophages or DCs upon encountering microbial challenge or infection. GM-CSF and M-CSF are both essential in the production of monocytes and macrophages and both play an important role in regulating the differentiation of monocytes into macrophages 8 or DCs. GM-CSF and M-CSF can specifically induce the proliferation and differentiation of monocytes into distinct subsets of macrophages with various morphology and functions. GM-CSF is pivotal in the development of alveolar macrophages (Nakata et al., 1991) in the lungs while M-CSF is essential for the development of tissue macrophages (Cecchini et al., 1994). The differentiation of monocytes into DCs was originally demonstrated in vitro by Sallusto and Lanzevacchia in 1994 using monocytes cultured with a combination of GM-CSF and IL-4. Monocyte differentiation is now found to be a dynamic process dependent on the tissue or secondary organ that monocytes reside (Chen et al., 2009). For example, monocytes were able to be differentiated into Th17 immunity polarizing DCs by the blood brain barrier secreting transforming growth factor-β (TGF-β) and GM-CSF (Ifergan et al., 2008). Figure 1.2 shows the monocyte differentiation process. Figure 1.2 Monocyte Differentiation into Macrophage and DCs Figure shows the three types of macrophages differentiated from the monocyte precursor under different polarizing conditions. (Auffray et al., 2009) 9 1.2.2.3 Macrophages Macrophages are highly phagocytic cells and play an essential role in the maintenance of tissue homoestasis through the facilitation of apoptotic cell clearance, destruction of invading pathogens and foreign materials, as well as tissue remodeling and repair. Macrophages were found to be extremely dynamic as they are able to perform intensive membrane trafficking, fusion and fission associated with endocytosis, phagocytosis and ruffling (Gordon, 2007). Initially, adult tissue macrophages were thought to be derived only from the circulating pool of monocytes. However, later studies indicated that many tissue-resident macrophage populations, such as alveolar macrophage (Landsman et al., 2007), or liver Kupffer cells (Crofton et al., 1978) are maintained through local proliferation, especially under steady-state conditions. Inflammation on the other hand would result in the massive recruitment of blood-borne precursor of macrophages to the respective tissue macrophage compartment (Arnold et al., 2007) but whether these tissue macrophages are derived from a particular lineage-committed precursors or randomly from the monocyte pool remains elusive. Majority of the macrophages are generally considered to be derived from circulating monocytes (Figure 1.3) though macrophages do display a high degree of heterogeneity as discovered through various studies with monoclonal antibodies (Austyn and Gordon, 1982; Djikstra et al., 1985; Kraal and Janse, 1986). Resident macrophages in tissues are also capable of initiating acute inflammatory and vascular changes due to their close association with the microvasculature in addition to their usual sentinel and clearance functions (Gordon, 2007). Macrophages display very different turnover rates and poorly defined trophic functions. The surrounding environment has been found to dynamically influence the phenotype of tissue-resident macrophages (Smythies et al., 2005). For example, isolated macrophages from the lamina propria have a unique phenotype of high phagocytic and 10 bacteriacidal activity but weak production of pro-inflammatory cytokines. The identification of the diverse macrophage populations found in various organs of the human body was made possible by the use of the antigenic marker CD68 in humans. Figure 1.3 The ontogeny of Monocyte and Macrophage The development and differentiation of monocyte and macrophages from hemapoietic stem cells. (Mosser and Edwards, 2008) Macrophage being an efficient and dynamic phagocytic cell is able to effectively sense the surrounding environment and respond accordingly. That is why macrophages are known as the primary danger sensor in the hosts. Macrophages detect endogenous danger signals such as those present in necrotic cells through a variety of receptors. The common receptors engaged by macrophages in sensing the surrounding signals include the Toll-like receptors (TLRs) (Kono and Rock, 2008; Park et al., 2004), intracellular pattern-recognition receptors (PPRs) and interleukin-1 (IL-1) receptor which commonly signal through myeloid differentiation primary-response gene 88 (MyD88) (Chen et al., 11 2007). The phagocytosis process leads macrophage into dramatic changes in their physiology, altering the expression of surface proteins and the production of cytokines and inflammatory-mediators (Mosser and Edwards, 2008). These changes serve as unique biochemical markers to identify the various types of macrophages. Macrophage activation can be due to endogenous stimuli resulted from inflammation or injury. Antigen-specific immune cell present will generate signals that are specific and prolonged to give rise to longer-term alteration in macrophages. In addition, macrophage themselves can produce alterations and signals that result in changes of their own physiology. Activated macrophages can be generally classified into three different populations with each population possessing unique physiological properties; (i) the classically activated macrophages, (ii) wound-healing macrophages and (iii) regulatory macrophages. The unique physiological properties of the three macrophages populations provide a series of unique biomarkers that may be useful for disease identification (Mosser and Edwards, 2008). (i) Classically activated macrophages Classically activated macrophages traditionally refer to macrophages that are activated by the production and release of interferon-γ (IFN-γ) and tumour-necrosis factor-α (TNF-α). These macrophages in turn secrete high amounts of pro-inflammatory cytokines or mediators and display enhanced microbicidal and tumouricidal activity (O’Shea and Murray, 2008). Hence, classically activated macrophages refer to macrophages that are produced under cell mediated immunity. Besides IFN-γ and TNFα, other cytokines such as IFN-α/β are also able to activate macrophages. NK cells and T cells are the main contributors to the production of these cytokines. TLRs were shown to be important in the generation of classically activated macrophages involving the 12 activation of signal transducer and activator of transcription (STAT) pathway and the nuclear factor-κB (NF-κB) pathway (O’Shea and Murray, 2008). Classically activated macrophages therefore play an important role in protecting the host against invading pathogens as the pro-inflammatory cytokines produced would result in the killing and elimination of the invading pathogens. Mice deficient in IFN-γ production were found to be more susceptible to bacterial infection (Felipe-Santos et. a.l., 2006). However, the pro-inflammatory cytokines can also contribute to serious tissue and host damage such as autoimmunity if not properly regulated (Langrish et al., 2005). Hence, though classically activated macrophages are important in host defence, their activity must be tightly controlled to prevent unnecessary damage to the host. (ii) Wound-healing macrophages Wound-healing macrophages as the name suggests refer to macrophages that are generate for the purpose of tissue repair. Initially, these macrophages were referred to as ‘alternative macrophages’ as these macrophages respond efficiently to the mannose receptor (Stein et al., 1992) and were important in the clearance of helminthes and nematodes (Anthony et al., 2006; Zhao et al., 2008). Wound healing macrophages are usually generated in response to the production of interleukin-4 (IL-4) during tissue injury (Loke et al., 2007). The main contributors to the production of IL-4 during tissue injury are the granulocytes especially basophils and mast cells. In vitro studies showed that macrophages treated with interleukin-4 (IL-4) or interleukin-13 (IL-13) produced less pro-inflammaotry cytokines, displayed less bactericidal activity, had lesser production of oxygen and nitrogen radical species (Edwards et al., 2006) but were able to produce components of the extracellular matrix, suggesting that these macrophages 13 were involved in wound healing and tissue repair. Wound-healing macrophages too can be a threat to the host when the matrix-enhancing ability is not efficiently regulated. Experimental studies have suggested that the over-expression of extracellular matrix components due to uncontrolled activation of these macrophages can lead to formation of tissue fibrosis (Hesse et al., 2001) and airway remodeling (Munitz et al,. 2008). (iii) Regulatory macrophages Regulatory macrophages were found to have reduced inflammatory response by decreasing the transcription of pro-inflammatory cytokines genes and decreasing messenger ribonucleic acid (mRNA) stability (Stenberg, 2006). Glucocorticoids released by adrenal glands in response to stress are one of the main factors mediating the generation of regulatory macrophages by affecting macrophage functions (Elenkov, 2004). Another important role of regulatory macrophages is to dampen the immune response and limit the degree of inflammation at later stages of adaptive immune response. This is to ensure that there will be no over-activation of the adaptive immune response which would cause detrimental effects to the host (Mosser, 2003). Macrophages itself can also produce the regulatory cytokine TGF-β after phagocytosis of apoptotic cells to induce the immunoregulatory functions of macrophages (Fadok et al., 1998). Studies by (Mosser and Edwards) first identified a population of macrophages that displayed regulatory properties through in vitro stimulation of macrophages with TLR agonists in the presence of immunoglobulin-G (IgG) immune complexes (Gerber and Mosser, 2001). In their studies, the macrophages were found to be potent producers of the immunosuppressive cytokine interleukin-10 (IL-10). Though there are many different ways in which regulatory macrophages are generated, the exact mechanism mediating the transformation of macrophages into a regulatory phenotype 14 remains unknown. Both mitogen-activated protein kinase (MAPK) and extracellularsignal-regulated kinase (ERK) have been suggested as potential candidates in the generation of regulatory macrophages (Gerber and Mosser, 2001).The characteristics of regulatory macrophages may differ slightly depending on the stimuli that led to their generation. Nevertheless, the regulatory macrophages are still identifiable by a few common properties. Regulatory macrophages are potent IL-10 producers and are capable of suppressing the production of pro-inflammatory cytokines such as interleukin-12 (IL-12) (Gerber and Mosser, 2001). Regulatory macrophages also do not produce any extracellular matrix protein but expresses high levels of co-stimulatory molecules such as CD80 and CD86. Therefore, regulatory macrophages do contribute to T cell activation through antigen presentation (Edwards et al., 2006). Many parasitic, bacterial and viral pathogens make use of the immunosuppressive properties of regulatory macrophages to evade host detection and killing (Miles et al., 2005; Baetselier et al., 2001) The three different populations of macrophage showed that macrophage physiology can be influenced by various innate and adaptive immune signals (Stout et al., 2005) as shown in Figure 1.4. The plasticity of macrophages has made it difficult to identify and classify them through a single biochemical marker. The plasticity of macrophages can also be observed from their response to diseases in the hosts. Macrophages are thought to play an important role in the eradication of tumour cells due to its phogocytic ability. Classically activated macrophages were shown to be cytotoxic to cancer cells (RomieuMourez et al., 2006). However, tumour associated macrophages were found to have switched to a phenotype similar to regulatory macrophages due to the influence of the tumour microenvironment as the tumour progresses (Pollard, 2008). Macrophages were 15 found to also play an important role in the development of insulin resistance associated with obesity. Studies showed that obese individuals have macrophages accumulated in their adipose tissues. These adipose-associated-macrophages can therefore be a source of pro-inflammatory cytokines and over time lead to the development of insulin resistance and ultimately type two diabetes (Zeyda and Stulnig, 2007; Lument et al., 2007). The heterogeneity of macrophages remains a mystery but is important as it enables macrophages to play important roles in host immunity through regulation of immune response, disease progression and host survival. Figure 1.4 Factors regulating the activation of various macrophages Macrophage respond and activate into three different classes of macrophages according to surrounding environment. (Mosser and Edwards, 2008) 16 1.2.2.4 Dendritic Cells Dendritic cells were first observed by Paul Langerhans in 1868 as he mistakenly classified the stellate-shaped epidermal cells as cutaneous nerve cells (Langerhans, 1868). A century later, Steinman and Cohn discovered dendritic cells in mouse spleen and named them ‘dendritic cells’ based on the unique morphology of DCs when they observed these cells (Steinman and Cohn, 1973). Currently, it is widely accepted that DCs arise from haemapoietic precursors in the bone and are ubiquitously distributed in lymphoid and non-lymphoid tissues. DCs are now regarded as representing a discrete leukocyte population which are highly specialized in antigen presentation and possess the unique ability to activate primary immune response (Hart, 1997; Steinman, 1991). Hence, DCs are known to be the professional antigen presenting cells (APCs). Extensive studies to date have revealed that DCs are not just critical APCs for the induction of primary immune responses and the regulation of T cell-mediated immune response (Liu, 2001; Shortman and Liu, 2002; and Banchereau et al., 2001). DCs also serve as sentinels by recognizing the invading pathogens through the various patternrecognition receptors (PPRs). DCs activated by microbial products secrete proinflammatory cytokines involved in host defense, providing a crucial link between innate and adaptive immunity (Rescigno and Borrow, 2001; Iwasaki and Medzhitov, 2004). DC ontogeny has been divided into four stages, (i) bone marrow progenitors, (ii) circulating DC precursors, (iii) tissue-residing immature DCs (imDCs), and (iv) mature DCs (mDCs) in secondary lymphoid organs (Shortman and Naik, 2006). DCs precursors from haemapoietic progenitors in the bone marrow circulate through the blood and lymphatics to their respective tissues. DCs reside in these tissues as immature 17 cells possessing potent phagocytic capacity, which is a characteristic of imDCs. Upon encountering infection or tissue damage, imDCs will capture and process antigen such as microbial product lipopolysaccharide (LPS), and migrate to the lymphoid organs. The imDCs will then mature into mDCS and present the captured antigen to the antigenspecific T cells, activating the host immune response. Hence, DCs are critical to the induction of adaptive immunity as DCs are required to activate naïve T cells to induce a primary immune response and establish immunological memory (Banchereau and Steinman, 1998). In other words, DCs are important in the induction and maintenance of both central and peripheral tolerance (Steinman et al., 2003; Lutz and Schuler, 2002). The diverse functions of DCs in immune regulation reflect the heterogeneity of DC subsets and functional plasticity. 1.2.2.5 Heterogeneity of dendritic cell subsets DCs in lymphoid organs have been widely considered as the end stage of a stepwise differentiation and migration process during inflammation to initiate immune responses (Fearson and Locksley, 1996; Lanzavecchia, 1996). There are no DC lineage-specific marker identified so far, thus the subsets of DCs in humans and mice are currently defined by linage-MHC II+ cells in combination with various cell surface markers (Sato and Fujita, 2007). Most of the knowledge about the developmental pathway of DCs was based on results obtained by cell culture studies. Cells with characteristics of Langerhans cells and DCs can be generated in vitro by culturing CD34+ cells in the presence of GM-CSF and TNF-α (Caux et al., 1996). imDCs are continuously produced from hemapoietic stem cells within the bone marrow. Human DCs are defined by lineage-MHC II+ cells and all express CD4 but lack CD8 18 expression (Sato and Fujita, 2007). DC heterogeneity in humans is reflected at four levels; (i) precursor populations, (ii) anatomical localization such as skin epidermal Langerhans cells, dermal (interstitial) DCs, splenic marginal DCs T-zone interdigitating cells, germinal-centre DCs, thymic DCs, liver DCs, and blood DCs, (iii) function and (iv) final outcome of immune resonse i.e. tolerance vs. immunity (Banchereau et al., 2000). CD34+ hemapoietic stem cells differentiate into two different progenitors; the common lymphoid progenitor (CLP) and the common myeloid progenitor (CMP). The CMP further differentiates into two different populations of cells. The first population is known as CD34+CLA+ DCs which would give rise to CD11c+CD1a+ cells and subsequently migrate into the skin epidermis to differentiate into Langerhans DCs. CLA refers to cutaneous lymphocyte-associated antigen. CD34+CLA- DCs will generate CD11c+CD1a- DCs that will migrate into the skin dermis and other tissues. CD11c+CD1a- DCs will further differentiate into interstitial DCs (Strunk et al., 1997; Ito et al., 1999). Langerhans DCs and interstitial DCs are very different phenotypically and functionally though both originate from the same precursor. Langerhans DCs have high expression levels of CD1a, Birbeck Granule and E-cadherin while interstitial DCs express CD2, CD9, CD68 and factor XIIIa. Functionally, Langerhans DCS are potent in CD8 T cell-priming but are not capable of macropinocytosis; interstitial DCs on the other hand are capable of macropinocytosis and the activating T and B cells. Table 1.2A summarizes the differences between Langerhans DCs and interstitial DCs. Another two types of DC precursors (pre-DC) can be obtained from CMP and CLP respectively in the bone marrow. CMP give rise to myeloid pre-DC1s which are also known as monocytes while CLP give rise to lymphoid pre-DC2s (plasmacytoid DCs) (Liu, 2001). Monocytes migrate to the blood and then to extravascular tissues before 19 differentiating into myeloid DCs (DC1). On the other hand, plasmacytoid DCs would migrate into the blood and then to the lymphoid tissues. The differences between DC1 and DC2 are summarized in Table 1.2B. These conventional DC subsets can elicit either Th1- or Th2- immune responses depending on the inflammatory environments (Wang et al., 2006; Ito et al., 2004; Ito et al., 2007). Figure 1.5 shows the development of the DC subsets. Recent studies also indicate that bone marrow plasmacytoid DCs are able to differentiate into myeloid DCs upon viral infection (Zuniga et al., 2004). Similar to monocytes and macrophages, DC development is a process with high flexibility and plasticity. 20 Figure 1.5 The development, differentiation and maturation process of DCs. DCs originate from CD34+ hemapoietic stem cells that differentiate into CMPs and CLPs. CMPs further differentiate into CD34+CLA+ and CD34+CLA- progenitor cells which would differentiate Langerhans DCs and interstitial DCs respectively. CMP and CLP also give rise to monocyte/pre-DC1 and plasmacytoid / pre-DC2 which would result in myeloid DCs and plasmacytoid DCs that migrate into the blood and then into lymphoid tissues. (Liu, 2001). 21 Table 1.2 Comparison of DC subsets A. Comparison of Langerhans Cells and Interstitial DCs Langerhans Cells Interstitial DCs + + + + + + + - +/+++ + + + + Phenotype CD1a CD2 CD9 CD68 Factor XIIIa E-cadherin Birbeck Granule / Lag-antigen Function Macropinocytosis IL-10 production B cell activation CD8 T Cell priming B. Comparison between pre-DC1 and pre-DC2 Phenotype Myeloid marker CD11b CD11c CD13 CD14 CD33 Lymphoid Marker Pre-Tα Ig γ-like 14.1 Spi-B Pattern recognition receptors Mannose R CD1a, b, c d Other differentially expressed antigen CD4 CD45RA CD45RO IL-3R GM-CSF Function Phagocytosis and kill bacteria IFN-α/β production Pre-DC1 Pre-DC2 + + + + + - - + + + +/+/- - + + + ++ ++ + +++ + ++ + ++++ 22 C. Comparison of CD11c+DCs and pre-DCs CD11c+DCs Phenotype Dendrites or veils + Co-stimulatory molecules Moderate Mobility High Colonization of non-lymphoid Yes tissues without stimulation Function T cell activation Moderate Innate Immunity Low Tables with modifications from Liu, 2001 pre-DCs Low Low No No High 1.2.2.6 Dendritic cell maturation and migration The mobility of DCs at various differentiation stages is a unique and important characteristic that enabled DCs to function effectively. DC maturation is a pivotal event and provides a crucial control of innate and adaptive immunity. DCs migrate from bone marrow to the peripheral tissues, encountering antigens that would trigger their maturation and migration to the secondary lymphoid organs. The antigen or pathogen encountered induces the imDCs to undergo phenotypic and functional changes that result in the transition of imDCs from antigen-capturing cell to APC. DC maturation and DC migration are two closely intertwined events that would affect the outcome of immune response. Defects in DC maturation have been linked to the progression of cancer (Lin et al., 2009). DC maturation is a continuous process that is initiated in the periphery upon antigen encounter and / or inflammatory cytokines leading to DC-T cell interaction as the final point (Banchereau et al., 2000). DC maturation can be induced and regulated by a series of exogenous and endogenous factors as shown in Figure 1.6: (i) pathogen-related molecules such as LPS, lipotechoic acid (LTA), peptidoglycan (PGN), flagellin, 23 bacterial deoxyribonucleic acid (DNA) and double-stranded DNA; (ii) the balance between pro-inflammatory and anti-inflammatory signals in the local microenvironment, such as TNF, IL-1, IL-6, IL-10, TGF-β and prostaglandins; (iii) T cell-derived signals such as TNF-α, CD40L and IFN-γ; and (iv) tissue damage-derived signals i.e. heatshock proteins (Banchereau et al., 2000; Rossi and Young 2005). DC maturation is a process that requires several coordinated events such as (i) loss of endocytic / phagocytic receptors; (ii) up-regulation of co-stimulatory molecules CD40, CD58, CD80 and CD86; (iii) morphological changes such as loss of adhesive structure, cytoskeleton reorganization, and acquisition of high cellular motility (Winzler et al., 1997); (iv) a shift in lysosomal compartments with down-regulation of DC-lysosomeassociated membrane protein (DC-LAMP); and (v) change in Major Histocompatibility Complex class II (MHC II) compartments (Banchereau et al., 2000). Upon encountering antigen / pathogen, imDCs are activated to become mDCs by down-regulating cell surface expression of endocytic / phagocytic receptors while up-regulating the expression of co-stimulatory molecules as mentioned to facilitate the migration and subsequently interaction of mDCs with T cells. CD83 is another cell surface marker that is often used to mark DC maturation in humans. However, the exact function of CD83 is still not clear (Zhou and Tedder, 1996). The process of DC maturation is closely linked to and followed by DC migration. Mediators of DC maturation will also trigger peripheral DC migration into the T cell area of lymphoid organs to facilitate antigen presentation by DCs and subsequently T cell activation for immune response. DC migration too requires a series of coordination between several chemokines. imDCs lose their responsiveness towards chemokines specific for imDCs such as MIP-3α through either receptor down-regulation of 24 desensitization upon antigen uptake (Dieu et al., 1998; Sallusto et al., 1998). imDCs down-regulate the expression of chemokine receptors CCR1, CCR5 and CCR7 responsible for recognizing inflammatory cytokines. imDCs also up-regulate the expression of CCR7 receptor which recognizes lymphocyte chemokines (Sozzani et al., 1999). mDCs acquire responsiveness to chemokines of lymphoid tissues, enter into the draining lymph nodes and migrate to the T cell zone (Ngo et al., 1998). These series of well-coordinated events (Figure 1.6) will hence lead to the complete functional transition of imDC potent in Ag uptake to mDCs potent in Ag presentation. Figure 1.6 DC Maturation The left side of the diagram shows the factors regulating DC maturation while the right side of the diagrams summarizes the properties of each maturation stage. (Banchereau et al., 2000). 25 1.2.2.7 DCs in antigen uptake, processing and presentation DCs are known to be the professional APCs. DCs are well equipped to capture and process antigens into proteolytic peptides, load these peptides onto MHC molecules and present them to T cells. imDCs can efficiently internalized a diverse array of antigens for processing and are characterized by high levels of endocytic activity which is lost upon maturation. Immature DCs internalize Ag through multiple pathways. Many receptors contribute to the ability of DCs to capture exogenous antigens (Marina et al., 1997). The common receptors identified so far include mannose receptor; C-type lectins such as DEC-205 (Jiang et al., 1995) and CD23 (Mudde et al., 1990); FcεRI (Maurer et al., 1995; Bieber et al., 1992); Fcγ receptor type I and II (Fanger et al., 1996); complement receptor 3 and 4 (Reis de Sousa et al., 1993), and Scavenger receptors (Platt et al., 1998). These receptors help DCs in antigen uptake by facilitating receptormediated endocytosis, allowing the uptake of macromolecules through specialized regions of the plasma membrane, known as coated pits. The same receptors mediating endocytosis also mediates the internalization of particulate antigens. The process of the uptake of particulate antigens is referred to as phagocytosis. Phagocytosis is actin dependent as it requires membrane ruffling and the subsequent formation of large intracellular vacuoles. Immature DCs have been reported to be able to engulf almost any bacteria (Bell et al., 1999) and phagocytose apoptotic and necrotic bodies (Albert et al., 1998). Studies with monocyte derived DCs generated from culture with GM-CSF and IL-4 showed that these DCs have high level of constitutive macropinocytosis allowing them to take up large volumes of fluid and concentrate the macrosolutes (Sallusto et al., 1995). This enables imDCs to continuously sample the microenvironment in a rapid and non-specific manner. Macropinocytosis requires the engulfment of large amount of fluid and solutes by the DCs and hence involves actin rearrangement. 26 DCs process captured antigens into proteolytic peptides and target these peptides to MHC class I (MHC I) and MHC class II (MHC II) molecules. The peptide loading for antigen presentation can be achieved in three ways; (i) MHC II-restricted pathway; (ii) MHC I-restricted pathway; and (iii) CD1-restricted pathway. (i) MHC II-restricted pathway Immature DCs constantly accumulate MHC II molecules in lysosome-related intracellular compartments identified as MHC class II-rich compartments (MIICs) with multivesicular and multilamelar structures (Klejimeer et al., 1995; Nijman et al., 1995). Exogenous antigen captured by DCs are degraded in endosomes and directed towards MIIC containing HLA-DM that promotes the catalytic removal of the class II-associated invariant chain peptide. The invariant chain also enhances peptide binding to MHC II molecules (Cresswell, 1996; Castellino et al., 1997) although loading of class II antigens within DC can also occur in the absence of the invariant chain (Rovere et al., 1998). The invariant chain is degraded upon DC maturation and the peptide-loaded class II molecules will be exported to the cell surface for presentation (Pierre and Mellman, 1998). (ii) MHC I-restricted pathway The MHC I pathway can be loaded with antigen through both an endogenous and an exogenous pathway for DC presentation to generate CD8+ cytotoxic killer cells (Pamer and Cresswell, 1998; Rock and Goldberg, 1999). The endogenous pathway involves the degradation of cytosolic proteins within the endoplasmic reticulum where the peptides will be loaded onto newly synthesized MHC I molecules. The ATP-dependent proteolytic system processes the antigen by ubiquitin conjugation (Guermonprez et al., 27 2002). The ubiquitinylated proteins are then directed to the proteasome, in which the proteins are cleaved into peptides and translocated via the endoplasmic reticulum onto the ATP-dependent transport associated-protein 1 / 2 (TAP 1/2) transmembrane transporters, fitting them into the MHC class I-binding groove. Minor antigens, exogenous peptides generated from phagocytosed particulated antigens, viruses, or immune complexes can also be presented by MHC I molecules (Norbury et al., 1997; Shen et al., 1997). This process is termed cross priming. Two pathways have been identified to facilitate cross presentation of antigens on DCs. The first pathway is a TAP-independent pathway is which the antigens are most likely hydrolyzed in endosomes (Pfeifer et al., 1993) while the second pathway is a TAP dependent phagosome-to-cytosol pathway (Kovacsovics-Bankowski et al., 1993; KovacsovicsBankowski et al., 1995). (iii) CD1 molecules-restricted pathway The CD1 family of molecules has been identified as non-classical, Ag-presenting molecules involved in the regulation of T cell responses to both microbial lipids and glycolipids-containing Ag (Burdin and Kronengerg, 1999; Porcelli and Modlin, 1999). CD1 molecules are a hallmark of DC phenotype and facilitate antigen presentation in a TAP-independent manner. Four CD1 proteins (CD1a-d) are expressed by myeloid DCs in humans. CD1 proteins are functionally heterogenous and can present glycolipids to a large repertoire of T cell, as well as natural killer (NK) T cells (Kitamura et al., 1999). The CD1-restricted pathway contributes not only to the microbial immunity but to autoimmunity and antitumour response. CD1-restricted antigen presentation also appears to regulate γ/δ T cells and intestinal intraepithelial lymphocytes (Banchereau et al., 2000). 28 1.2.2.8 In vitro human DC differentiation models – monocyte derived DCs The study of DC differentiation in vitro has gathered a lot of attention over the years as influenced by the objective of optimizing DC culture system for use in cancer immunotherapy. Currently, the two main protocols established to generate DCs in vitro uses either monocytes (Sallusto and Lanzavecchia, 1994) or CD34+ precursors (Caux et al., 1994) as a source. Peripheral blood mononuclear cells (PBMC) are isolated from blood or buffy coat preparations through density gradient centrifugation. Upon obtaining the PBMCs, monocytes can be further separated from the lymphocytes with various methods. One of the most common methods is the adhesion method, where monocytes are allowed to adhere to a plastic surface (Bennet and Breit, 1994). This method is preferred by many because it is inexpensive and relatively easy to perform. However, the yield and purity of the monocytes obtained can vary greatly. Other methods include immunoselection, such as magnetic cell sorting and centrifugal elutriation. These two methods are much more expensive and requires extensive equipment and expertise to be carried out successfully and hence, less popular for frequent isolation. The isolated monocytes can be differentiated into imDCs by GM-CSF and IL-4. The DCs generated (monocyte-derived DCs) have typical dendritic morphology, with obvious dendrite projections, express high levels of MHC I, MHC II, CD1, FCγ receptors, CD40, B7, CD44, and ICAM-1 but not CD14. These cultured DCs are highly capable of stimulating T cells in a mixed leukocyte reaction (MLR) and are also able to trigger cord blood naïve T cells as they are potent in IL-12p70 production and other inflammatory cytokines (Granucci et al., 2001). Monocyte derived DCs can be driven 29 into a mature state by treating the cells with maturation mediators such as LPS, TNF-α, interferon-gamma (IFN-γ) or CD40L. These resulting mature DCs may differ slightly morphologically and functionally (Timmerman and Levy, 1999). 1.2.3 Pattern Recognition Receptors Pathogen recognition by the innate immune system is dependent on the pattern recognition receptors (PRRs) that recognize conserved molecular patterns on different microbial classes to determine the type of infection agent encountered (Medzhitov et al., 2000) so as to mount an appropriate immune response against the pathogen. Cells of innate immunity that express PRRs are macrophages, dendritic cells, mast cells, neutrophils, eosinophils, and NK cells (Janeway and Medzhitov, 2002). These conserved molecular patterns are mostly products of metabolic pathways or gene products that are essential for the survival of the microorganism and are termed pathogen-associated molecular patterns (PAMPs). The PRRs can be expressed on the cell surface, in intracellular compartments, or secreted into the bloodstream and tissue fluids. (Medzhitov and Janeway, 1997). PRRs can be classified into two major groups (Aderem and Underhill, 1999; Janeway and Medzhitov, 1998). The first group is the sensing receptors which can distinguish between different pathogens leading to the activation of pro-inflammatory pathways. This group consists mainly of the Toll-like receptors (TLRs). The second group of PRRs forms the mechanical arm of innate immunity is made up by the phagocytic and endocytic receptors, such as mannose receptor (MR), scavenger receptor (SR), and complement receptor (CR). The PRRs can therefore function in (i) opsonization of bacteria and viruses for complement activation (Fraser et al., 1998); (ii) pathogen uptake by phagocytes and dendritic cells for antigen 30 presentation (Stahl and Ezekowitz, 1998); or (iii) cell signaling to induce antimicrobial peptides and inflammatory cytokines and induction of apoptosis. In addition to the two main groups of PRRs which are found on the cell surface, there are also several secreted PRRs such as surfactant protein A (SP-A) and D (SP-D), the mannose lectin (MBL) (Lu et al., 2002), C-reactive protein (CRP), serum amyloid protein (SAP) (Schwalbe et al., 1992), LPS-binding protein (LBP) and CD14. Some other PRRs are expressed in the cytosol where they function in detecting intracellular pathogens and induce immune responses that block pathogen replication. Examples of such PRRs are protein kinase receptor (PKR) (Clemens and Elia, 1997), nucleotidebinding oligomerization domain (NOD) proteins (Hammond-Kosack and Jones, 1997) and 2’-5’-oligoadenylate synthase (OSA) (Kumar and Carmichael, 1998). 1.2.3.1 Phagocytic Receptors Phagocytosis refers to the process by which phagocytic cells internalize large particles. Phagocytosis is an important component of host innate immunity and is often referred to as the classic model of microbe-innate immune cell interaction (Stossel, 1999). Phagocytes rely on phagocytic receptors for the uptake of microbial antigens which are degraded in APCs into antigenic epitopes for MHC molecules. These epitopes dictates the specificity of mounting responses. Phagocytosis is accompanied by intracellular signals that trigger various cellular processes such as cytoskeletal rearrangement, alterations in membrane trafficking, activation of microbial killing mechanisms, production of pro-inflammatory and anti-inflammatory cytokines and chemokines, induction of apoptosis, and production of molecules required for effective antigen presentation to activate the adaptive immunity (Underhill et al., 1999). There are a 31 variety of receptors that constitute this arm of host immunity (Figure 1.7). Phagocytes, such as macrophages and DCs express a broad spectrum of receptors to bind and internalize microbes (Underhill and Ozinsky, 2002). The mannose binding receptor (Fraser et al., 1998; Stahl and Ezekowitz, 1998) recognizes mannose residues on microorganisms. The Fc receptors (Gerber and Mosser, 2001; Heyman, 2000) phagocytose signaling receptors that down-regulate the production of pro-inflammatory cytokines and enhance T helper two (Th2)- mediated immune response (Radstake et al., 2004; Sutterwala et al., 1998) through the ligation of Fc receptors. The complement receptors (Gasque, 2004) bind to complement-opsonized pathogens to facilitate phagocytosis. Table 1.3 summarizes the phagocytic receptors and their ligands. Figure 1.7 Receptor and signaling interactions during phagocytosis. Multiple receptors act in concert to recognize microbes through direct binding of binding to opsonized proteins. The engagements of these receptors result in the activation of various downstream signaling pathways, resulting in a specific immune response. (Underhill and Ozinsky, 2002). 32 Table 1.3 Phagocytic receptors for microbes Receptors Ligands Fc Receptors: FcγRI (CD64) IgG-, CRP-, SAP-opsonized particles FcγRII (CD32) IgG-, CRP-, SAP-opsonized particles FcγRIII (CD16) IgG-, CRP-, SAP-opsonized particles FcεRI IgE-opsonized particles FcεRII (CD23) IgE-opsonized particles FcεRIIII (CD89) IgA-opsonized particles Complement Receptors: CR1 (CD35) MBL-, C1q-, C4b-, C3b-opsonized particles CR3 (αMβ2, CD11b/CD18, Mac1) iC3B-opsonized particles CR4 (αXβ2, CD11c/CD18, gp150/95) iC3B-opsonized particles Integrins: α5β1 (CD49e/CD29) Fibronectin/Vitronectin-opsonized particles α4β1 (CD49d/CD29) αvβ3 (CD51CD61) Scavenger Receptors: SRA Bacteria, LPS, LTA MARCO Bacteria Mannose Receptor (CD206) Mannan Dectin-1 Β1,3-glucan CD14 LPS, peptidoglycan C1qR(P) C1q, MBL, SP-A Table modified from Underhill and Ozinsky, 2002 1.2.3.2 Toll-like Receptors (TLRs) The Toll receptor was first identified in the developing embryo of Drosophila as an essential receptor and was found to be involved in anti-fungal responses in the adult fly (Imler and Hoffman, 2001). Subsequent discoveries led to the identification of Toll receptors in mammals and the important roles Toll receptors play in the recognition of 33 microorganisms. The first mammalian homologue of the Toll receptor was identified in 1997 and named hToll (now TLR4) (Medzhitov et al., 1997). Several TLR4 structurally related proteins were identified through various studies leading to the identification of the panel of Toll-like receptors (TLRs). There are altogether 12 members in the TLR family identified so far in mammals (Janeway and Medzhitov, 2002; Akira et al., 2006; Medzhitov, 2007; Beutler, 2009). The human TLR family consists of 10 members (TLR1 to TLR10) while twelve TLRs family members were identified in mice. TLRs are type I integral membrane glycoproteins and possess a trimodular structure (Kumar et al., 2009). The cytoplasmic portion which is the intracellular C-terminal domain of TLRs displays high similarity to the IL-1 receptor family, known as the Toll/IL-1 receptor (TIR) domain. This domain is required for the interaction and recruitment of various adaptor proteins to activate the downstream signaling cascade for TLRs. The extracellular domains of both receptors however, were structurally unrelated. The extracellular N-terminal domain of TLRs bears approximately 16-28 leucine-rich repeats (LRRs), with each LRR comprising of 20-30 amino acids with the conserved motif “LxxLxLxxN” (Janeway and Medzhitov, 2002; Akira et al., 2006; Medzhitov, 2007; Beutler, 2009). The crystal structure of the TLRs and their ligand complex has been revealed recently (Jin et al., 2008) showing that these complexes can form heterodimers (TLR1-TLR2 or TLR4-MD2) (Jin et al., 2007; Kim et al., 2007) or homodimers (TLR3-TLR3) after association with their respective agonist or antagonist ligands. The complex will then assume a horseshoe-like structure (m-shape) which is essential for the initiation of TLR downstream signaling (Park et al., 2009; Liu et al., 2008). 34 A comparison of the amino acid sequences of the human TLRs divided the human TLRs into five groups: The TLR3, TLR4, TLR5, TLR2 and TLR9 subfamilies (Gangloff et al., 2003; Takeda et al., 2003). The TLR2 subfamily members are composed of TLR1, TLR2, TLR6 and TLR10, while the TLR9 subfamily comprises of TLR7, TLR8 and TLR9. These TLRs are expressed in distinct cellular compartments aiding in the effective recognition of various PAMPs by TLRs. TLR1, TLR2, TLR4, TLR5, and TLR6 are expressed on the cell surface whereas TLR3, TLR7, TLR8 and TLR9 and expressed in intracellular vesicles such as the endosome and ER. The intracellular TLRs are transported to the intracellular vesicles via the transmembrane protein localized in the endoplasmic reticulum (Kim et al., 2008; Brinkmann et al., 2007). 1.2.3.2.1 TLRs and their ligands TLRs can recognize various PAMPs from bacteria, viruses, fungi, protozoa, making them the most important sensing receptors for the activation of immunity. TLRs are also able to recognize non-PAMPs endogenous ligands such as heat-shock proteins and extracellular matrix degradation products (Takeda et al., 2003). The TLRs ligands were mostly identified through in vitro studies using ligand binding assays or through in vivo generation of knockout mice. Table 1.4 provides a detailed summary of the TLRs with their ligands and the signaling pathways involved. TLR1 TLR1 was discovered to be functionally associated with TLR2 through co-expression studies of TLR1 and TLR2 in HeLa cells by Wyllie et al., 2000. The co-transfected HeLa cells exhibited responsiveness to soluble factors released from Neisseria meningitides. Studies using TLR1-deficient mice demonstrated that TLR1 is involved in 35 the recognition of triacyl lipopetides which is mainly found on bacteria and mycobacteria (Takeuchi et al., 2002). TLR1 has also been shown to be involved in the recognition of outer surface lipoprotein of Borrelia burgdorferi (Alexpoulou et al., 2002). TLR2 TLR2 can recognize components from a variety of microbial pathogens including lipoproteins from gram negative bacteria, peptidoglycan, lipoteichoic acid from gram positive bacteria, lipoarabinomannan from mycobacteria, glycosylphosphatidylinositol anchors from Trypanosoma cruzi, a phenol-soluble modulin from Staphylococcus epidermis, zymosan from fungi, and glycolipids from Treponema maltophilum (Kumar et al., 2009). Studies of TLR2 knockout mice demonstrated the involvement of TLR2 in the recognition of peptidoglycan and lipoproteins (Akira et al., 2006). The unique ability of TLR2 in being able to recognize such a large variety of microbial components may be due to the fact that TLR2 cooperates with other TLRs such as TLR1 and TLR6. Such cooperation between TLR2 and other TLRs made it possible for the discrimination of the various microbial components (Kumar et al., 2009). TLR3 TLR3 is unique in comparison to the other TLRs in that it has a unique signaling cascade due to the lack of a conserved proline residue in the cytoplasmic region corresponding to proline 712 in the Tlr4 gene. TLR3 plays an important role in detecting viral infection as it recognizes double stranded RNA (dsRNA) demonstrated by Alexpoulou et al., 2001. TLR3 also promote cross-presentation of virus-infected cells through viral dsRNA-mediated activation of DCs (Schulz et al., 2005). Besides, 36 dsRNA, ssRNA from viruses such as West Nile virus, lymphocytic choriomeningitis virus (LCMV), vesicular stomatitis virus (VSV), murine cytomegalovirus (MCMV), and reovirus can also be recognized by TLR3. However, TLR3 knockout mice do not seem to exhibit high susceptibility to infection with these viruses (Edelmann et al., 2004; Wang et al., 2004) and there are TLR-independent dsRNA recognition mechanisms. TLR4 The discovery of TLR4 started with the observation of mouse C3H/HeJ strain displaying hypo-responsiveness towards LPS treatment, leading to the identification of the Tlr4 gene (Poltorak et al., 1998). The importance of TLR4 in LPS signaling was later confirmed by Hoshino et al., 1999 through knockout mice studies. TLR4 does not recognize LPS alone but act in concert with CD14 molecule and MD2 secreted protein to bind LPS. LPS binds to LPS-binding protein (LBP) in serum and this complex associates with CD14. LPS would also induce CD14 and TLR4 to be in close proximity (Jiang et al., 2000; da Silva Correia et al., 2001) while MD2 associates with the extracellular portion of TLR4. MD2 is a critical component of the LPS-TLR4 complex as MD2 mediates the surface expression of TLR4, affecting the responsiveness of TLR4 to LPS (Nagai et al., 2002). An additional component, RP105 had been identified to be essential for B cells recognition of LPS from knockout mice studies (Nagai et al., 2002). However, macrophages from RP105 knockout mice had enhanced response to LPS, suggesting RP105 is involved in negative regulation of LPS responses in macrophages (Divanovic et al., 2005). TLR4 recognizes other ligands in addition to LPS such as LPSmimetic activity of Taxol (Kawasaki et al., 2000; Byrd-Leifer et al., 2001) and together with CD14 recognize the fusion protein of respiratory syncytical virus (RSV) (KurtJones et al., 2000). Heat-shock proteins (HSP) such as HSP60 have been reported to 37 possess immuno-stimulatory activity through TLR4 (Ohashi et al., 2000; Vabulas et al., 2001; Asea et al., 2002). TLR4 is also involved in the recognition of extracellular matrix components produced in response to tissue injury such as extra domain A (EDA) of fibronectins and oligosaccharides of hyaluronic acid that are capable in activating immune cells (Okamura et al., 2001; Termeer et al., 2002). Hence, TLR4 seem to play an important role in the recognition of general endogenous ligands involved in the inflammatory response regardless of the source of infection. TLR5 TLR5 was first discovered to be involved in recognizing flagellin through a TLR5 overexpression study in Chinese Hamster Ovary (CHO) cells (Hayashi et al., 2001), indicating its importance in the recognition of flagellated bacteria. Subsequently, it was discovered that TLR5 recognizes an evolutionary conserved domain of flagellin through close contact of the receptor and flagellin (Smith et al., 2003). TLR5 is expressed on the basolateral side of intestinal epithelial cells (Gewirtz et al., 2001) and interestingly, flagellin is also capable of activating lung epithelial cells to induce inflammatory cytokines (Hawn et al., 2003). Besides epithelial cells, TLR5 was found to be expressed in CD11c-positive cells residing in the small intestinal lamina propria, suggesting that TLR5 is important in the regulation of immune responses against intestinal infections (Uematsu et al., 2006). TLR6 TLR6 associates with TLR2 as heterodimer to aid in the discrimination of wide variety of ligands recognized by TLR2. TNF-α production in response to peptidoglycan but not bacterial lipopeptides was inhibited when a dominant negative form of TLR6 was 38 introduced into macrophage cell lines (Ozinsky et al., 2000) though both peptidoglycan and bacterial lipopeptides were recognized by TLR2. Macrophages from TLR6 knockout mice did not respond to mycoplasma-derived diacyl lipopeptides (Takeuchi et al., 2001) while the introduction of human TLR2 and TLR6 expression vectors into TLR2/TLR6 double knockout embryonic fibroblast cells demonstrated that both TLR2 and 6 are required for the recognition of mycoplasma-derived diacyl lipopeptides, confirming that TLR6 is essential for the recognition of mycoplasma-derived diacyl lipopeptides (Kumar et al., 2009). TLR7 TLR7 recognizes mainly nucleic acid-like structures. TLR7 was first identified to be involved in the recognition of synthetic compounds such as imidazoquinolines used for treatment of diseases associated with viral infection (Hemmi et al., 2002). TLR7 was later shown to recognize guanosine-, or uridine-rich single stranded RNA (ssRNA) from viruses such as human immunodeficiency virus, vesicular stomatitis virus, and influenza virus (Diebold et al., 2004; Heil et al., 2004; Lund et al., 2004). Host-derived ssRNAs are not recognized by TLR7 as TLR7 is expressed in the endosomal membrane and host-derived ssRNA will not be delivered into the endosomal membrane under normal circumstances. However, under special circumstances such as autoimmune systemic lupus erythematosus (SLE) and Sjörgen syndrome, TLR7 is suspected to be involved in the recognition of immune complexes where self-derived ssRNA was conjugated to RNA-specific antibody and delivered into the endosome of plasmacytoid DCs, leading to the production of IFN-α (Berland et al., 2006; Christensen et al., 2006). There were also reports on ssRNA engaging the RNA-specific B cell receptor (BCR) of 39 autoreactive B cells, leading to autoantibody production (Barrat et al., 2005; Lau et al., 2005; Vollmer et al., 2005). TLR8 Human TLR8 is expressed in regulatory T cells (Treg), the activation of TLR8 as found to inhibit Treg function (Peng et al., 2005). TLR8 gene is located on the X chromosome and is highly homologous to the TLR7 gene. So far, TLR8 has been reported to recognize ssRNA and imidazoquinoline, which are also the recognized by TLR7. TLR9 TLR9 is essential for the recognition of CpG motif of bacterial and viral DNA (Hemmi et al., 2000), dsDNA of virus and hemozoin from plasmodium (Kumar et al., 2009). TLR9 has been suspected to be involved in pathogenesis of autoimmune disorders (Marshak-Rothstein, 2006), as it is able to facilitate the engagement of IgG2a-chromatin complex by the B cell receptor, leading to production of rheumatoid factors (Leadbetter et al., 2002). TLR10 Human TLR10 has been identified as a member that is closely related to TLR1 and TLR6. The ligand of TLR10 has not been identified so far but TLR10 is suspected to be involved in the recognition of TLR2 ligands. 40 Table 1.4 TLRs T L R 1/ 2 Location PAMPs recognized Plasma membrane (cell surface) 2 Plasma membrane (cell surface) 3 Endosome 4 Plasma membrane (cell surface) 5 Plasma membrane (cell surface) Plasma membrane (cell surface) Triacyl lipopeptides Heterodimer TIRAP, (bacteria and of TLR1/2 MyD88 mycobacteria) forms a functional receptor PGN (Gram-positive CD36, TIRAP, bacteria), LAM RP105 MyD88 (mycobacteria), Hemagglutinin (Measles virus), phospholipomannan (Candida), Glycosylphosphatidyl inositol mucin (Trypanosoma) ssRNA virus (WNV), TRIF dsRNA virus (Reovirus), RSV, MCMV LPS (Gram-negative MD2, TIRAP, bacteria), mannan CD14, LBP, MyD88, (Candida), RP105 TRAM Glycoinositolphosphol and TRIF ipids (Trypanosoma), Envelope proteins (RSV and MMTV) Flagellin (Flagellated MyD88 bacteria) 6/ 2 7 Endosome 8 Endosome 9 Endosome 10 ? Coreceptor(s) Signaling adaptor Diacyl lipopeptides (Mycoplasma), LTA (Streptococcus), Zymosan (Saccharomyces) Heterodimer TIRAP, of TLR6/2 MyD88 or dectin-1 forms a functional receptor ssRNA from RNA MyD88 virus (VSV, Influenza virus) ssRNA from RNA MyD88 virus dsRNA viruses (HSV, MCMV), CpG motifs from bacteria and viruses, Hemozin (Plasmodium) MyD88 Transcription factor(s) NFκB Effector cytokines induced Inflammatory (TNFα, IL-6 etc.) NFκB Inflammatory (TNFα, IL-6 etc.) NFκB, IRF3,7 Inflammatory (TNFα, IL-6 etc.), type I IFNs NFκB, IRF3,7 Inflammatory (TNFα, IL-6 etc.), type I IFNs NFκB Inflammatory (TNFα, IL-6 etc.) NFκB Inflammatory (TNFα, IL-6 etc.) NFκB, IRF7 Inflammatory α, IL-6 etc.), IFNs Inflammatory α, IL-6 etc.), IFNs Inflammatory α, IL-6 etc.), IFNs NFκB, IRF7 NFκB, IRF7 (TNFtype I (TNFtype I (TNFtype I Table modified from (Kumar et al., 2009) 41 1.2.3.2.2 TLR signaling Ligand recognition by TLRs leads to the dimerization of TLRs and the recruitment of various TIR domain-containing adaptors. The recruitment of adaptors triggers the cascade of signaling pathway and ultimately leads to the activation of transcription factors such as NFκB and interferon regulatory factors (IRFs); or the activation of MAP kinases such as p38, JNKs and ERK1/2, which activates the AP-1 transcription factor. The TLR signaling pathway is categorized into MyD88-dependent and MyD88independent pathway /TRIF pathway (Akira and Takeda, 2004; Akira et al., 2006; Kumar et al., 2009). The pathways engaged by TLRs are shown in Figure 1.8 (i) MyD88-dependent pathway The MyD88-dependent pathway is utilized by all TLRs except TLR3. MyD88 possesses a C-terminal TIR domain and an N-terminal death domain. MyD88 associated with the TIR domain of TLRs upon stimulation and recruits IRAK-4 which would then facilitate the phosphorylation of IRAK-1. Activated IRAK-1 associates with TRAF6, leading to the activation of two distinct signaling pathways. One pathway leads to the activation of the AP-1 transcription factors via the MAP kinases while the other pathway leads to the activation of NFκB via the IκB kinase (IKK) complex (Akira and Takeda, 2004). In addition, the TIR domain-containing adaptor protein (TIRAP)/MyD88-adaptor like (Mal) has been reported to be essential for the MyD88-dependent signaling pathway via TLR2 and TLR4 (Horng et al., 2002; Yamamoto et al., 2002). (ii) MyD88-independent pathway / TRIF-dependent pathway The MyD88-independent pathway was discovered when TLR4 ligand-stimulated MyD88-deficient macrophages showed delayed activation of NFκB (Kawai et al., 1999). 42 This pathway was originally found in TLR3 and TLR4 and activates IRF3, leading to the induction of type I interferons. Recent reports showed the TIR domain-containing adaptor inducing IFN-β (TRIF) is essential for TLR3- and TLR4-mediated IRF3 activation, while TRIF-related adaptor molecule (TRAM) is involved in IRF3 activation via TLR4 alone (Fitzgerald et al., 2003; Hoebe et al., 2003; Yamamoto et al., 2003a,b). Figure 1.8 Signaling pathways for TLRs (Takeda and Akira, 2007) (iii) TLR-independent recognition of microorganisms Several of the pathogens that invade the cytoplasm are capable of evading recognition by the TLRs. The mammalian immune system has developed TLR-independent cytoplasmic pathogen recognition systems such as nucleotide-binding oligomerization 43 domain (NOD)-leucine rich repeats (LRR) proteins (Inohara et al., 2005) which mediates recognition of peptidoglycan core structures; and RNA helicases (Yoneyama et al., 2004) which recognizes viral RNA in the cytoplasm. 1.3 Adaptive Immunity 1.3.1 Overview of the adaptive immunity The innate immunity may be efficient at preventing an infection by significantly reducing the pathogen load, but sterile cure or control of an infection requires the successful activation of the adaptive immunity (Trinchieri, 2003). The adaptive immunity is also referred to as acquired immunity and is composed of randomly generated, clonally expressed, highly specialized receptors of seemingly limitless specificity (Cooper and Alder, 2006). The adaptive immune system is mainly composed of systemic cells and processes that eliminate or prevent pathogenic challenges. The innate immune system is limited by the level of immunopathology that can be tolerated and hence the adaptive immune system plays a role of increasing the potential efficacy of the immune system. This is done by minimizing collateral damage as it focuses on immune defense in an antigen-specific manner through the usage of highly specific antigen receptors (Palm and Medzhitov, 2009). The adaptive immunity enables host to recognize and remember the pathogen encountered (immunological memory), so that a stronger immune response can be mounted against the same pathogen upon repeated encounters. The adaptive immune system depends on a process known as somatic hypermutation and V(D)J recombination to generate a large repertoire of antigenic receptors that are uniquely expressed on the lymphocytes. Randomly generated antigen receptors have the 44 potential to mount an immune response against self antigens. The adaptive immunity overcomes this problem through the process of negative selection of autoreactive lymphocytes in the thymus. The adaptive immunity will recognize non-self antigens during antigen presentation; mount a specific immune response against the invading pathogen and at the same time, generate immunological memory of the antigen so that a faster and stronger immune response can be mounted against the very same pathogen on the next encounter. However, this also means that a delay in response is needed when the pathogen is encountered for the first time as the adaptive immunity needs time to activate the specific effectors for a response. Antigen receptors of the adaptive immune system are uniquely advantageous because it enables the adaptive immunity to recognize nearly any antigen and their clonal expansion. The adaptive immune response possesses exquisite specificity, maximizing the efficacy of the immune response while minimizing unnecessary collateral damage. Clonal expansion and selection of the effector cells in adaptive immunity endows the immune system with a mechanism by which to remember previous infections and provide future protection (Palm and Medzhitov, 2009). The cells responsible for adaptive immunity are named lymphocytes with T cells and B cells playing a major role. Both T and B cells originate from the same progenitor but they play rather different roles in the maintenance of the adaptive immunity. T cells are involved in cell-mediated immunity while B cells are involved in humoral immunity where antibodies play a large role in the elimination and control of infection (Janeway et al., 2005). The T lymphocytes are divided into three populations: (i) CD8+ cytotoxic T cells, (ii) CD4+ helper T cells and (iii) gamma-delta T cells (γδ-T cells). 45 (i) CD8+ cytotoxic T cells CD8+ cytotoxic T cells are also known as killer cells because the main responsible of these cells is to identify and induce the death of cells infected with pathogen (mainly viruses) and cells that are damaged or dysfunctional. Naïve cytotoxic T cells are activated when the T cell receptor (TCR) encountered a specific peptide-loaded MHC I. The interaction of TCR and MHC I activates the naïve cells to go into clonal expansion, proliferate and generate copies of the same effector cell bearing the unique TCR recognizing the specific peptide-loaded MHC I on antigen presenting cells. When the effector cytotoxic T cells encounter infected cells or damaged cells, these cytotoxic T cells would release perforin and granulysin, two enzymes that will cause the infected or damaged cells to lyse. Cytotoxic T cells can also induce apoptosis in the infected or damaged cells by releasing granzyme. The cytotoxic T cells will be cleared away by the phagocytes upon resolution of the infection but some of these cells will remain in the circulation as memory cells. The memory cells can differentiate into effector cells quickly upon the next encounter of the same pathogen, significantly shortening the duration needed to activate a cytotoxic immune response. However, uncontrolled activation of the cytotoxic T cell response can cause major damage to the host. Hence, the activation of CD8+ T cells would usually require a strong interaction of the TCRMHC I or an additional signal provided by the helper T cells. (ii) CD4+ helper T cells Currently there are two sub-populations of the CD4+ helper T cells, each of them responsible for the elimination of different type of pathogens, the T helper 1 (Th1) and T helper 2 (Th2) cells. Th1 cells are effective against intracellular pathogens such as viruses and bacteria. The induction of Th1 response leads to the production of IFN-γ, 46 IL-2, TNF-α and TNF-β, activating bactericidal activities of the macrophages and inducing B-cells to produce opsonizing antibodies, activating cell-mediated immunity (Szabo et al., 2003). On the other hand, Th2 immune response is effective is dealing with extracellular pathogens such as parasite, toxins, helminthes, nematodes and extracellular bacteria. Th2 immune response is characterized by the production of IL-4, IL-5, IL-6 and IL-13, activating B-cells to produce killing antibodies, leading to the activation of humoral immunity. The CD4+ T cells will die and be cleared by phagocytes upon the resolution of infection while some of the cells will remain as CD4+ memory cells for a faster activation of the T helper immune response. (iii) gamma-delta-T cells (γδ-T cells) γδ-T cells are a unique population of the T lymphocytes as it carries an alternative T cell receptor as opposed to the αβ-CD4/CD8 T cells and possesses the characteristics of helper T cells, cytotoxic T cells and natural killer cells. The γδ-T cells are able to respond to common microbial molecules through the usage of the TCR as pattern recognition receptor. Another important lymphocyte in the adaptive immunity is the B-cells. B-cells produce antibodies called immunoglobulins that circulate in the blood or lymph, mediating humoral immunity. B-cells produce five different classes of immunolgobulins (Ig); immunoglobulin-A (IgA), immunoglobulin-G (IgG), immunoglobulin-M (IgM), immunoglobulin-D (IgD) and immunoglobulin-E (IgE). Each immunoglobulin has their unique function and are specific for different antigen. B-cells recognizes antigen in their ‘native’ from as opposed to T cells that recognizes ‘processed’ antigen peptides. B-cells 47 differentiate into antibodies producing-plasma cells upon encountering antigen and receiving an additional signal from helper T cells. Adaptive immunity is tightly controlled due to the undesirable effects if not properly regulated. The innate immune recognition serves as a method of control for the regulation of adaptive immunity (Medzhitov and Janeway, 1998; Barton and Medzhitov, 2002). The adaptive immune responses can be classified into mainly (i) Type I / Th1 immunity, (ii) Type II / Th2 immunity and (iii) Th17 immunity. There are evidences showing that Th1, and Th2 do not derive from distinct lineages but rather they develop from the same Th-cell precursor under the influence of environmental and genetic factors acting at the level of antigen presentation (Romagnani, 1997). Environmental factors such as antigen entry, the physical form of antigen, the type of adjuvant and the dose of antigen play a role in the development of Th1 or Th2 immunity while the genetic factors remain rather elusive (Constant and Bottomly, 1997). Figure 1.10 shows the different cytokines that influence the development of a naïve CD4 T cell into Th1, Th2 or Th17 immunity. Naïve CD4 T cells develop into Th1 cells in a cytokine environment of IFN-γ and IL-12. These two cytokines are mainly produced by macrophages and DCs. IL-4 and IL-2 would favour the development of CD4 T cells into Th2 cells while development of Th17 cells requires the cytokines TGF-β, IL-6 and IL21. The role of cytokines and the development of Th1, Th2 and Th17 immunity will be further explored in the next few sections. 1.3.2 Th1 immunity The type I or Th1 immunity is also known as cell-mediated immunity. While CD8 T cells are already predestined to become cytotoxic cells as they leave the thymus, the naïve CD4 T cells can differentiate into either Th1 or Th2 cells. This is crucial in 48 determining whether a cell mediated immunity or humoral immunity will predominate as the appropriate immune response. The Th differentiation pathway is influenced by various factors upon TCR engagement. The type of APC encountered, the concentration of antigen (duration, strength and signal), the ligation of specific co-stimulatory molecule, and the local cytokine environment are all able to affect the Th cell differentiation process (Szabo et al., 2003). Th1 cells produce IFN-γ and are mainly involved in the protection against intracellular microbes (Abbas et. al., 1996). 1.3.2.1 Effectors of Th1 Immunity DCs are the key regulator of Th1 immunity. Cells of Th1 immunity secrete cytokines such as IFN-γ, IL-2, TNF-α and TNF-β, which are critical in the eradication of intracellular pathogens and viral infection. Excessive Th1 response has been associated with tissue destruction in autoimmune disease due to over-production of cytokines. IL-2 promotes T cell growth. IFN-γ activates macrophages and MHC expression while increasing IgG production. TNF-α and TNF-β activates macrophages and nitric oxide production. All these work together to defend against the invading intracellular pathogens (Janeway, 2002). An important determining factor of Th1 development in CD4+ T cells is STAT4 activation by IL-12. Two physiological pathways have been described for inducing IFNγ production by T cells. The first pathway is the TCR pathways and the second pathway is the engagement of IL-12-IL-18 signaling. CD8+ T cells produce IFN-γ independently of STAT4 activation and of IL-12 when activated through the TLR pathway whereas CD4+ T cells require STAT4 for activation. However, both CD4+ and CD8+ T cells require STAT4 activation for the induction of IFN-γ through the IL-12-IL-18 signaling 49 pathway (Yang et. al., 1999; Carter et. al., 1999). STAT4 can be activated by either IL12 or type I interferons such as IFN-α in humans (Cho et. al., 1996). 1.3.3 Th2 Immunity The Th2 immunity is critical in protection of the host against gastrointestinal nematodes, extracellular parasites and also responsible for allergic disorders (Romagnani et. al., 1997). Th2 immunity produces mainly IL-4, IL-5, IL-9 and IL-13 which are important for a strong antibody response. Th2 immune response inhibits the activation of Th1 and macrophage activity as attempts to destroy large parasites through Th1 responses and excessive macrophage activity would be harmful to the host. (Gordon and Taylor, 2005). IL-4 induces the differentiation of Th-cells into Th2 cells when the concentration of IL4 reaches a necessary threshold because the inducing effect of IL-4 dominates over other cytokines (Romagnani, 1997). Th2 development requires the signaling pathway of IL-4 and STAT6 with GATA-3 as the transcription factor. IL-4-independent and STAT6-independent development of Th2 has also been observed in various studies both in vivo and in vitro (Finkelman, et. al., 2000; Ouyang et al., 2000). GATA-3 is able to maintain its own expression through an autoactivation loop while STAT6 acts as a repressor for GATA-3 (Rodriguez-Palmero et. al., 1999; Ouyang, et. al., 1998). Hence, Th2 has been assumed to be the default pathway when IL-12 signaling is absent. 1.3.3.1 Effectors of Th2 Immunity The effectors of Th2 immunity include IL-4 which stimulates the growth of B cells, T cells, and mast cells. IL-4 also inhibits macropinocytosis while activating the production of IgG1 and IgE. Figure 1.9 shows the engagement of TCR and its downstream signaling upon activation of the IL-4 receptor (IL-4R). The IL-4R signals through Stat6 50 while the TCR/CD3/CD28 complex activates the NF-κB pathway, activating the GATA3 promoter which will then favour a Th2 environment, producing Th2 cytokines. IL-5 is another effector of Th2 immunity and is actively involved in the stimulation growth and differentiation of eosinophils, increasing the production of IgA. IL-10 promotes the activation of Th2 immunity while inhibiting Th1 activation and inhibits cytokine release (Kapsenberg et. al., 2003). IL-6 and TGF-β are also important effectors of the Th2 immunity. TGF-β inhibits B cell growth, promotes IgA production, inhibits T cell growth, promotes T cell survival, inhibits macrophage activation, activates neutrophils, inhibits or activates other somatic cells (Janeway, 2002). 1.3.4 Th17 Immunity Th17 cells have been named so because of their ability to produce IL-17 though the signature cytokines for Th17 cells are IL-17 and IL-22 (Zhu et. al., 2010). Th17 has been shown to be critical in their involvement in the pathogenesis of autoimmune diseases such as rheumatoid arthritis (Cua et. al., 2003). IL-17 promotes granulopoiesis and neutrophil accumulation. IL-17 also plays an important role in inflammatory disorders while offering protection to the mucosal barrier due to the ability in stimulating the formation of tight junction and secretion of mucin (Chen et al., 2003). Th17 cells represent a distinct lineage that originates mainly in the presence of TGF-β and IL-6. IL-23 is crucial for the expansion and maintenance of the Th17 cells but not the initial differentiation of Th17 cells. The IL-23 receptor has found to be only expressed after the naïve T cells have partially completed the Th17 differentiation (Zhu et. al., 2010). Th17 cells are controlled by the transcription factor Foxp3 (Zheng and Flavell, 1997). Th17 cells have been shown to be involved in the defense mechanism of certain pathogen, especially pathogens endangering the epithelial surface (Happel et. al., 51 2005; Huang et. al., 2004). Th17 immunity has also been suggested to play a critical role in the development of autoimmune diseases (Langrish et. al., 2005). Th17 cells originate from the same Th-cells precursor but under different polarizing conditions which is determined at the early presence at the time of antigen presentation (Seder and Paul, 1994). Subsets of cells sharing features of both Th1 and Th17 have been identified with IL-12 suggested as the key modulator of the development of these cells (Annunziato et. al., 2007). 1.3.4.1 Effectors of Th17 Immunity IL-23 is produced primarily by the APCs (macrophages and DCs) in response to TLR molecules. IL-23 is a member of the IL-12 cytokine family and it shares the p40 subunit with IL-12 as a heterodimer with p19 instead of p35. The IL-23 receptor is expressed mainly on memory T cells. IL-23 directs the development of Th17 T cells together with TGF-β and IL-6 (Garrett et. al., 2008). Although IL-23 appeared to be required for Th17-mediated immunopathology, recent reports have indicated that IL-23 is not required for Th17 commitment, but rather appears to be important for the amplification and stabilization of the Th17 phenotype (Aggarwal et. al., 2003; Weaver et. al., 2006). The cytokines crucial for driving the differentiation of Th17 cells are TGF-β and IL-6. 1.4 Dendritic cells in Th1, Th2, and Th17 Induction Dentritic cells as professional APCs play a major role in determining the immune response. DCs are the only APCs that are capable of migrating to the lymph nodes for antigen presentation. DCs are crucial for presenting antigens encountered by the host to naïve T cells and hence determining the expansion of Th1, Th2 or Th17 cells. DCs are also important for the induction of immunological tolerance through the involvement in 52 the mechanisms of clonal deletion of self-reactive T cells in thymus; and clonal deletion and anergy through the production of regulatory T cells (Weaver et. al., 2006; Steinman and Nussenzweig, 2002; Roncarolo et. al., 2001). The diverse functions of DCs in immune regulation reflect the heterogenous subsets with different lineages and maturity, and functional plasticity (Sato and Fujita, 2007). There had been two opposing views on the activation of T cells by DCs. The first view holds that distinct subsets of DCs were predetermined to differentially bias the T helper response while the second view suggests that microbes and the local microenvironment are potent modulators of DCs function and hence affect T cell activation (Moser and Murphy, 2000). Human DCs differentiate from two distinct types of precursor in culture: monocytes (myeloid lineage) and CD4+CD3-CD11c- plasmacytoid cells (lymphoid lineage). Both DC types are able to induce strong proliferation of naïve CD4+ T cells (Grouard et. al., 1997). The subclass of DCS used to stimulate T cells in vitro determines the nature of primary allogeneic T cell responses (Rissoan et. al., 2000). Naïve human CD4+CD45RA+ T cells cultured with monocyte-derived DCs are potent in IFN-γ production while T cells cultured with plasmacytoid-derived DCs produced large amounts of IL-4, IL-5 and IL-10 (Moser and Murphy, 2000). Among the factors shown to influence the balance between Th1 and Th2, IL-12 is the dominant cytokine in directing the development of Th1 cells which produce large amounts of IFN-γ. DCs function simultaneously as APCs and IL-12-producing cells which will then induce the development of Th1 cells, promoting a Th1 immune response (Moser and Murphy, 2000). T cell priming by DCs require engagement of CD28 by CD80 or CD86 and the IL-12 produced by DCs is a potent and obligatory 53 inducer of the differentiation of IFN-γ-producing cells in vivo (De Becker et. al., 1998). DCs undergo a refractory state after systemic triggering of the Th1 cells in which DCs are no longer capable of producing IL-12. The paralysis of IL-12 production may constitute a feedback mechanism to limit the immunopathology associated with prolonged exposure of IL-12 which would be detrimental to the host (Kalinski et. al., 1999). The role of DCs in Th2 development has been rather controversial. Earlier studies had shown that splenic DCs and macrophages are capable of producing IL-6, which would drive the differentiation of Th2 cells (De Becker et. al., 1998; Rincón et. al., 1997). However, blocking IL-6 does not prevent IL-4 induction by DCs, but abrogates the activation of Th2-type cells by macrophages. Th2 development does not seem to require APC-derived IL-4 and activated plasmacytoid-derived DCs do not seem to produce detectable amount of IL-4 (Schmitz et. al., 1994; Rissoan, et. al., 1999). Hence, there are hypothesis that Th2 is the default pathway and that Th2 cells would develop spontaneously in the absence of IL-12. Human DC2 subset appears to drive Th2 development even in the absence of IL-4 (Rissoan et. al., 1999). Th2 development requires the signaling pathway of IL-4 and STAT6 with GATA-3 as the transcription factor. IL-4-independent and STAT6-independent development of Th2 has also been observed in various studies both in vivo and in vitro (Finkelman, et. al., 2000; Ouyang et al., 2000). GATA-3 appears to have an autoactivation loop that is able to maintain its own expression while STAT6 appears to be able to repress GATA-3 (RodriguezPalmero et. al., 1999; Ouyang, et. al., 1998). Hence, Th2 has been assumed to be the default pathway in the absence of IL-12 signal. 54 The role of DCs in Th17 development has been studied extensively in recent years after the characterization of IL-17 producing Th17 cells. Th17 has been shown to be critical in their involvement in the pathogenesis of autoimmune diseases such as rheumatoid arthritis, inflammatory disorder and mucosal immunity. DCs derived IL-23 had been thought to be the critical factor for the induction of Th17 immune response as IL-23 increases the production of IL-17 from activated CD4+ T cells (Aggarwal et. al., 2003; Langrish et. al., 2005). Recent studies had shown however, that IL-23 does not induce the differentiation of Th17 cells but rather TGF-β and IL-6 are the important factors in Th17 differentiation (Veldhoen et. al., 2006). DCs have been thought to be important for the development of Th17 cells because of the generation of IL-17 producing CD4 T cells in the presence of LPS, a TLR ligand. Besides, ligands for TLR3 and TLR9 have also been shown to be capable in inducing the differentiation of IL-17 producing cells (Veldhoen et. al., 2006). This study suggests that DCs stimulated by TLR ligands through MyD88 is crucial for the differentiation of Th17 cells. 55 Figure 1.9 Major pathways in the regulation of T cells development with the Th2 phenotype. Transcription factor GATA-3 appears to be central to the Th2 response with an autoactivation mechanism, stabilizing the Th2 phenotype through an intracellular positive feedback loop (Farrar et. al., 2002). Figure 1.10 The role of cytokines in differentiation and effector functions of Th1, Th2 and Th17 cells. CD4+ T cells differentiate into distinct Th lineages in the context of combinations of cytokines upon TCR activation. The differentiation processes involve upregulation of master transcriptional factors and STAT proteins. (Zhu et. al., 2010) 56 1.5 Dimethyl Sulfoxide (DMSO) Dimethyl sulfoxide (DMSO, [(CH3)2SO]) is an amphipathic molecule with a highly polar domain and two apolar methyl groups. Hence, DMSO is soluble in both aqueous and organic media. This unique property had made DMSO a widely used solvent for the administration of water-insoluble-subtances in vivo. The other important characteristic of DMSO is that it is a hydrogen–bound disrupter (Santos et al., 1997) and an antioxidant, making it an important chemical in both the laboratory and clinical settings such as its applications as cyroprotectant, cell differentiating agent, hydroxyl radical scavenger, intercellular electrical uncoupler, intracellular low-density lipoproteinderived cholesterol mobilizing agent, solubilizing agent used in sample preparation for electron microscopy, antidote to the extravasation of vesicant anticancer agents, and topical analgesic (Santos et al., 2003). (i) DMSO applications in industry DMSO is a by-product of paper and pulp production. DMSO is currently the most commonly used solvent in industry for paint stripping. There has been an increase in the applications of DMSO in the electronic and microelectronics industry such as flat panel displays (Kvakovszky et. al., 2007). (ii) DMSO medical applications DMSO has been extensively debated over its potential as a medicine. Over the years, DMSO has been used in various medical conditions since DMSO was first discovered to be able to penetrate the skin easily without causing much damage to the skin (Kolb et. al., 1967). Nevertheless, there had been many critics and controversies over its efficacy and potential side effects as a medicinal drug (Herschler et. al., 1980). DMSO had been 57 used as a veterinary medicine for horses in treatment of pain and intracranial pressure. In humans, DMSO had been on clinical trials for its application as a topical analgesic (Lockie et. al., 1967), as an anti-inflammatory drug (Salim et. al., 1992), in the treatment for scleroderma (Scherbel et. al., 1967). DMSO had also been studied for its potential in the pain relief of arthritis patients (Matsumoto et. al., 1967) and treatment of trauma to the central nervous system (de la Torre, et. al., 1975). DMSO has also been proposed to play a role in cancer treatment due to its antioxidant properties (Salim et. al., 1992). DMSO has been found to be able to decrease metastasis of line 1 lung carcinoma murine tumour cells (Cerosaletti et. al., 1990). DMSO also increased the immune recognition of H-2 antigen-deficient murine lung carcinoma cells (Bahler and Lord, 1985). However, clinical trials with DMSO have not been supported due to its possible toxicity and side effects, resulting in the limitation of developing DMSO as a medicinal drug. Thus far, DMSO has only been approved for its use in the symptomatic pain relief of interstitial cystitis. The ability of DMSO to penetrate membranes has led to the investigation of DMSO as a potential drug delivery system. DMSO had also been proposed as a potential novel strategy for coating drug-eluting stents in the treatment of acute coronary symptoms as it was shown to inhibit tissue factor expression, thrombus formation and vascular smooth muscle cell activation (Camici et. al., 2006). Neverthelss, the potential of DMSO emerging as a drug is still faced with many skepticism. (iii) Biomedical applications of DMSO DMSO is currently widely used in the storage of cell lines as it is an effective cryoprotectant. DMSO is able to protect the cells from freeze-induced damage and death due to its ability to penetrate the cell membrane. DMSO penetrates the cell membrane and partially solubilize the cell membrane preventing puncture of the cell and minimize 58 the formation of ice crystals during the freezing process. DMSO on its own appears to be non-toxic (Vignes, 2000). Nevertheless, DMSO has been reported to be toxic to cells at high concentrations causing certain side effects (Zhang and Eyzaguirre, 1999). Despite of its side effects, it offers protection to the cryopreserved cells. The cryopreservation of live cells is a delicate and important technique. High quality cryopreserved cells are not just important for cellular research purposes but is extremely crucial with the advancement of cellular therapies using live cells such as immunotherapy. Very often the success of these medical procedures depends on the ability to freeze and store live cells for future use. In addition, DMSO is used in polymerase chain reactions (PCR) to inhibit formation of secondary structures in the DNA (Chakrabarti et. al., 2001). (Heckert et. al., 2002) reported that DMSO enhanced the liposome-meidated transfection of nucleic acid in chicken macrophage cells. (iv) DMSO effects on the immune system DMSO has been used in many medical applications. Hence, it is important to investigate the short and long term effects of DMSO on the immune system. DMSO was reported to be capable of inhibiting LPS-elicited IL-8 production in human whole blood (Laura et. al., 1993) and bone marrow derived-macrophages from mice (Keiran et. al., 2004). The ability of DMSO in suppressing LPS-elicited IL-8 production was attributed to its antioxidant property. Fresh human whole blood containing DMSO and DMSO cryopreserved human whole blood both demonstrated an increase in IL-1β and IL-6 production (Stefanie et. al., 2004). In contrast, DMSO was also reported to inhibit TNFα induced IL-6 production in both airway epithelial cells and lung fibroblast (Yoshida et. al., 1999). (Kubin et al., 1994) reported that DMSO could enhance LPS-elicited IL-12 production by human myeloid leukemia cell lines and primary peripheral blood 59 mononuclear cells. In vivo, dendritic cells (DCs) are major producers of IL-12 which is key to the induction of Th1 type of immunity. DMSO was also found in inhibit adhesion of larval haemocytes to slides at high concentrations (Dunphy et. al., 2007). 1.6 Aims of Study The aim of this thesis is to study: (i) DMSO effect on cell survival and profile Dimethyl sulfoxide (DMSO, [(CH3)2SO]) is an amphipathic molecule with a highly polar domain and two apolar methyl groups. Hence, DMSO is soluble in both aqueous and organic media. This unique property had made DMSO a widely used solvent for the administration of water insoluble-subtances in vivo. The other important characteristic of DMSO is that it is a hydrogen–bound disrupter (Santos et al., 1997), making it an important chemical in both the laboratory and clinical settings. Other common uses of DMSO are such as cyroprotectant, cell differentiating agent, hydroxyl radical scavenger, intercellular electrical uncoupler, intracellular low-density lipoproteinderived cholesterol mobilizing agent, solubilizing agent used in sample preparation for electron microscopy, antidote to the extravasation of vesicant anticancer agents, and topical analgesic (Santos et al., 2003). DMSO has been known to possess various toxic effects on human kind. It has been reported that DMSO differentiated HL60 cells displayed changes in their antigen expression (Ian et al., 1998). This study aims to investigate the effects of DMSO usage on the survival and behavior of cell lines and cell culture. 60 (ii) The role of DMSO in DC and Macrophage activation DMSO has been shown to stimulate cytokine production when employed as a differentiating agent. DMSO differentiated HL-60 cells were responsive to Saccharomyces cerevisiae and Candida albicans stimulation and secreted proinflammatory cytokines such as IL-1β, IL-12, IL-18 and TNF-α (Saegusa et al., 2009). In addition, it has also been reported that pre-treatment of human myeloid leukemia cell lines and peripheral blood mononuclear cells with DMSO enhanced the production of IL-12 (Kubin et al., 1994). Both DCs and macrophages are involved in antigen presentation, while DCs are potent IL-12 producers upon activation. This study hence aims to investigate the effect of DMSO pre-treatment on the activation of antigen presenting cells in inducing an immune response. (iii) DMSO effect on DC histone protein Mammalian development and cellular differentiation are controlled epigenetically by DNA methylation and histone modifications. Since DMSO has been reported to affect cellular functions and cell differentiation, it is highly possible that DMSO affects the epigenetic profile. Studies carried out on mouse embryoid body suggest that DMSO is capable of altering DNA methylation profiles with upregulation of Dnmt3a expression while accompanied by phenotypic changes (Iwatani et al., 2006). This study proceeds to study if DMSO is able to induce any histone modifications on immune cells, especially DCs and macrophages. 61 CHAPTER 2 MATERIAL AND METHODS 2.1 Materials LPS was obtained from Sigma-Aldrich (St Louis, IL). Recombinant human Interleukinfour (rhIL-4), interferon-gamma (IFN-γ), macrophage colony-stimulating factor (MCSF) and granulocyte/macrophage colony-stimulating factor (GM-CSF) were obtained from R&D Systems Inc. (McKinley Place N.E., MN). The following mouse monoclonal antibodies were obtained from Ancell Co. (Bayport, MN): CD1a (FITC), CD14 (FITC), CD40 (FITC), CD86 (FITC), MHCII (FITC), CD54 (FITC), and CD83 (PE). CD80 (PE) and CD83 (PE) mouse monoclonal antibodies were purchased from BD Pharmingen. Anti-histone antibodies (anti-H3, anti-H2A, anti-H2B, anti-H4), dimethylated-histone antibodies kit, acetylated-histone antibodies kit and mitotic marker (phosphorylation) histone antibodies kit were purchased from Cell Signaling Technology Inc. (Beverly, MA). Purified-pan-H3 was obtained from Upstate Millipore (Billerica, MA). DMSO was obtained from Applichem GmbH (Darmstadt, Germany). 2.1.1 Bacteria culture and preparation E.coli DH5α was obtained from Invitrogen and cultured in Luria-Bertani (LB) broth at 37°C overnight with shaking. The bacteria were harvested by centrifugation for 10 min at 2000 g, washed and re-suspended in PBS at 1.75 x 108/ml. Bacteria density was determined by measurement at 600 nm. 2.2 Buffers and Media Complete media – RPMI-1640 or DMEM with 10% BCS and 1% penicillinstreptomycin 62 HI-media – RPMI-1640 or DMEM with 10% heat-inactivated BCS and 1% penicillinstreptomycin Serum free media – RPMI-1640 or DMEM with 1% penicillin-streptomycin MACS running buffer – Phosphate buffered saline (PBS) pH 7.2 with 0.5% BSA and 2mM EDTA Freezing Media – Complete RPMI or DMEM with 10% DMSO Western Blotting Buffer – 25 mM Tris-HCl with 150 mM glycine and 20 % (v/v) methanol Western Blot Washing Buffer (TBST) – 10 mM Tris-HCl, 100 mM NaCl, pH 7.4 with 0.05% Tween-20 Western Incubation and Blocking Buffer – 5% (w/v) non-fat milk in TBST Hypotonic Lysis Buffer – 10 mM Tris-HCl pH 8.0, 1 mM KCl, 1.5 mM MgCl2 and 1 mM Dithiothreitol (DTT) Western Blot Striping Buffer – 62.5 mM Tris-HCl pH 6.8, 2% SDS, 0.1 M βmercaptoethanol 2.3 Cell Culture Techniques 2.3.1 Isolation of Human Peripheral Blood Monocytes Peripheral blood leukocytes were obtained in the form of buffy coat preparations derived from healthy donors from the NUH Blood Donation Centre. Monocytes were isolated from the buffy coats as previously described (Cao et al., 2005). Briefly, buffy coats were diluted two-fold in PBS and subjected to centrifugation through a FicollPaque gradient (Amersham Biosciences Corp, Piscataway, NJ). Peripheral blood mononuclear cells (PBMCs) at the gradient interface were collected and washed four times with PBS to remove platelets. Washed cells were then re-suspended at a volume 63 of 2-3 x 106/ml in RPMI containing 5% (v/v) iron-supplemented bovine calf serum (BCS) (Hyclone) and incubated for two hours in T75 tissue culture flasks at 37°C, five percent (5%) CO2. Non-adherent cells which are mainly lymphocytes are removed by washing with warm 5% media. The adherent fraction of monocytes is then harvested while the non-adherent fraction of peripheral blood mononuclear cells are collected and used for further experiments such as T cells isolation and histone protein isolation. 2.3.2 Isolation of CD4+ T Cells Non-adherent fraction of peripheral blood mononuclear cells was collected and CD4+ T cells were isolated according to manufacturer’s (Miltenyi Biotech, Bergisch Gladbach, Germany) protocol. Briefly, cells were washed and counted before re-suspending cells at a density of 1 x 107/ml in 40 µl of running buffer (phosphate buffered saline (PBS), pH 7.2 supplemented with 0.5% BSA and 2 mM EDTA). 10 µl of Biotin-antibody cocktail was added and incubated on ice for 10 minutes. Another 30 µl of running buffer was added and 20 µl of anti-biotin microbeads were added followed by 15 minutes of incubation on ice. Cells were washed with 20x labeling volume and centrifuge at 300 g for 10 minutes. Supernatnant was discarded and cells re-suspended at a density of maximum 1 x 108 cells per 500 µl buffer. Cell separation was carried out with the autoMACSTM Separator (Miltenyi Biotech) using the “depletes” programme. Negatively labeled CD4+ T cells were collected at the negative port and this constitutes the fraction of isolated CD4+ T cells. 2.3.3 Monocyte Differentiation - Macrophages and DCs Culture Isolated monocytes were re-suspended at a density of 1 x 106/ml in RPMI containing 10% (v/v) BCS, 100 units/ml penicillin, 100µg/ml streptomycin, two (2) mM L- 64 glutamine, one (1) mM sodium pyruvate, and 0.0012% (v/v) 2-mercaptoethanol (complete cocktail RPMI). Macrophages were cultured from isolated monocytes in the presence of M-CSF (20 ng/ml) (R&D) for a period of six days. These are known as MCSF macrophages. Macrophages were also cultured for six days in the presence of GMCSF (40 ng/ml) (R&D) (GM-CSF macrophages). The MGM-macrophages were cultured in complete cocktail RPMI with 20 ng/ml of both M-CSF and GM-CSF. DCs were cultured in the presence of GM-CSF (20 ng/ml) and rhIL-4 (40 ng/ml) (R&D) for six days, known as GM-DC. M-DC refer to DCs cultured in the presence of M-CSF (20 ng/ml) and rhIL-4 (40 ng/ml). Monocytes were cultured in M-CSF (20 ng/ml), GM-CSF (20 ng/ml) and rhIL-4 (40 ng/ml) to generate MGM-DC. Half of the culture media volume was replaced with fresh media every other day. 2.3.4 Cell Lines Culture 2.3.4.1 Human Monocytic Cell Line (THP-1) Human monocytic cell line, THP-1 was cultured in RPMI-1640 supplemented with 10 % (v/v) BCS, 100 units/ml penicillin, 100µg/ml streptomycin, and two (2) mM Lglutamine. 2.3.4.2 Human Embryotic Kidney 293 T Cell Line (HEK 293T) Human embryonic kidney 293T cell line (HEK 293T) was cultured in DMEM supplemented with 10% (v/v) BCS, 100 units/ml penicillin, 100 µg/ml streptomycin, and two (2) mM L-glutamine. 65 2.3.4.3 Cryopreservation of Cell Lines (A) Suspension Cells Cells in log phase were adjusted to a density of 5 x 106 cells / ml of freezing medium (complete media with 10% DMSO). The cell suspension was aliquot into cryogenic storage vials and transferred to -80°C for short-term storage. Cells for long term storage were first stored at -80°C overnight before transfer to a liquid nitrogen tank. (B) Adherent Cells Cells were detached from flask with trypsin or through mechanical scraping and resuspended in complete medium. Cells were centrifuged at 300 g for 5 minutes. The cells were re-suspended in freezing medium at a density of 5 x 106 cells / ml, aliquoted into cryogenic storage vials and stored either at -80°C or in a liquid nitrogen tank. 2.3.4.4 Thawing of Cryopreserved Cells Cells were removed from storage and thawed quickly in a 37°C water bath. Cells were then transferred quickly into 10 ml of complete media and centrifuged at 300 g for 5 minutes. The supernatant was discarded and the cell pellet re-suspended in fresh complete media at a density of 1 x 106 / ml. Cells were then grown in a 37 °C humidified tissue culture incubator in the presence of 5 % CO2. 2.3.5 Priming and Activation of Monocyte, Macrophage and Dendritic Cell Cells were harvested and re-suspended at 1 x 106 / ml in HI-RPMI and cultured in 24well plates (0.5 ml/well) or 96-well plates (0.1 ml/well). Activation was assessed by increased expression of CD83, CD80 and CD86 for DCs and increased expression of CD54 for macrophages as analyzed by flow cytometry. 66 (A) Activation with Lipopolysaccharide (LPS) Cells were activated with 1 µg/ml of LPS for 24 hours for the study of cytokine production or 48 hours for study of surface molecule expression. (B) Activation with Interferon-gamma (IFN-γ) and LPS Cells were primed with IFN-γ (500 ng/ml) for 10 min before activation with LPS as (A) (C) Activation with Escherichia coli DH5α Cells were activated with DH5α at a multiplicity of infection of 20 bacteria to 1 cell for 24 hours and the cytokine production was studied by ELISA. (D) Priming of Dendritic Cells with Dimethyl-sulfoxide (DMSO) DCs were primed with 1 % DMSO for 2 to 24 hours depending on experiment before the addition of IFN-γ and LPS activation. 2.3.6 Generation of anti-CD3/anti-CD28 coated beads Polybead® Microspheres 2.00 µm (Polysciences, Inc., PA) latex beads (calculated to the amount to be used in a ratio of 2 beads to 1 T cell) was re-suspended in 1 ml serum free media and centrifuged at 14000 rpm for 5 minutes for washing. Supernatant was removed and beads re-suspended in 1 ml of PBS. 0.1 µg anti-human CD3 and 0.1 µg anti-human CD28 (Ancell, MN) per 2 x 105 T cells were added to beads and incubated at 37°C CO2 incubator for 2 hours for coating. Beads were then re-suspended in 1ml culture media and centrifuged at 14000 rpm for 5 minutes. Supernatant was removed after washing and beads re-suspended to a volume such that every 200 µl of HI-RPMI media would contain beads to T cells at a ratio of 2:1. 67 2.3.7 Mixed-Leukocyte Reaction (MLR) Dendritic cells were harvested and re-suspended at 1 x 105 / ml in HI-RPMI and cultured in 96-well round bottom plates (0.1 ml/well). Freshly isolated CD4+ T cells were washed and re-suspended at a density of 1 x 106/ml in HI-RPMI and seeded into the same 96-well round bottom plate (0.1 ml/well). The ratio of DC to T cells was 1:10. Cells were primed with DMSO (1%), IFN-γ (500 ng/ml) before activation with LPS (1 µg/ml) or directly stimulated with DH5α (20:1 cell). Supernatant was harvested after seven days and cytokine production was measured with ELISA. For re-stimulation of the cells, the supernatant will be harvested after 7 days and the cells will be washed. Fresh HI-RPMI containing anti-CD3/anti-CD28-coated beads (Refer Section 2.3.6) will be added to the cells in a ratio of 2 beads to 1 T cell. The reaction will be carried out for another 3 days and the supernatant harvest for cytokine assay by ELISA. 2.4 Immuno-detection of Proteins 2.4.1 Western Blotting Proteins were separated on a 12.5% or 15% acrylamide gel by SDS-PAGE before transferred into blotting buffer (25 mM Tris-HCl / 150 mM glycine with 20% (v/v) methanol). The gel was laid flat onto a methanol-pre-soaked polivinylidene fluoride (PVDF) transfer membrane and sandwiched between two wet filter papers in a western blot cassette. Electro-transfer was carried out at 100 V for 2 hours in cold blotting buffer. Upon completion of transfer, PVDF membrane was rinsed briefly in TBST and incubated with blocking buffer (5 % non-fat milk in TBS-T) for 1 hr at RT. Membrane was then incubated with primary antibody in incubation buffer (5 % non-fat milk in TBS-T or 5 % BSA in TBST-T) on a shaking platform overnight at 4 °C or 2 hour RT. Blots were then rinsed with washing buffer for 3 x 10 minutes at RT before proceeding 68 with incubation of secondary antibody diluted in incubation buffer. Secondary antibody incubation was carried out for 1 hour at RT and blots were then washed as before. Blots were then incubated with alkaline phosphatase substrate for 5 minutes and protein bands were exposed onto an x-ray film. Film was then developed in the dark with film developer Konica Minolta SRX-101A for visualization of protein bands. 2.4.2 Protein Stripping from Western Blot PVDF blots were washed in western washing buffer before incubation in western blot protein stripping buffer. Protein stripping was carried out for 15 to 30 min at 50 °C in a water bath. Blots were then washed with washing buffer for 3 x 10 min before incubation with western blocking buffer and continued with the remaining steps of western blotting. 2.4.3 Flow Cytometry Analysis 2.4.3.1 Detection of Surface Proteins Cells such as adherent DCs and macrophages were harvested by scraping and combined with cells in suspension. Monocytes were harvested after 2 hour adhesion during the monocytes isolation from buffy coats. The cells were washed twice with cold PBS and re-suspended in cold HI-RPMI at 5 x 106 / ml. A fraction of 50 µl of the cells was incubated with a specific fluorochrome-conjugated-antibody for 45 minutes on ice. Cells to be incubated with purified antibodies were blocked with 20% (v/v) goat serum before primary antibody incubation and washed before proceeding with secondary antibody incubation. The cells were then wash for another two times with cold PBS and resuspended in cold 1% (w/v) paraformaldehyde (PFA) in PBS. Cells were analyzed on 69 FACScalibur using the CellQuest software (BD Bioscience, San Jose, CA) or Dako Cyan with Summit version software 4.3 (Dako, Stockport). 2.4.3.2 Detection of Intracellular Proteins Detection of intracellular proteins was similar to the procedure of surface proteins detection with a few additional steps. Cells were harvested, washed, and fixed with 1 % PFA (w/v) for 15 min on ice. Cells were then permeabilized with 0.2% (w/v) saponin before blocking or antibody incubation. Cells were then washed with cold PBS where washing and fixing steps were performed as mentioned in Section 2.4.3.1 2.4.3.3 Detection of Intracellular Cytokine Intracellular cytokine detection was carried out with the according to manufacturer’s instruction (BD Pharmingen, NJ, USA). Cells cultured in round bottom 96-well plate were washed with HI-RPMI and centrifuged at 2000 g x 3 min. Supernatant was removed and 150 µl of HI-RPMI supplemented with 0.1 µg/ml of phorbol 12-myristate 13-acetate (PMA) and 1 µg/ml of ionomycin was added to each well 6 hours before cells will be harvested for staining. Brefeldin A (Sigma, Saint Louis, IL) (10 µg/ml) was added to each well 2 hours after stimulation with PMA and ionomycin to prevent the secretion of cytokines. Cells were washed 6 hours after PMA and ionomycin stimulation. Cells were fixed and permeabilized with 100 µl / well of Fix/Perm buffer (provided in kit) for 20 min. Cells were washed 3 times before re-suspended into washing buffer with the corresponding fluorochrome-conjugated antibody (e.g., IFN-γ-PE). Staining was allowed to proceed for 30 min and cells were washed before re-suspended in staining solution and transferred to Dako flow cytometry tubes. Cells were analyzed on Dako Cyan with Summit software version 4.3 (Dako, Stockport). 70 2.4.4 Cytokine Assay - ELISA (A) BD OptEIA ELISA Kit Cytokine production (with exception of TNF-α, IL-17 and IL-23) was assayed using BD OptEIA ELISA kit according to manufacturer’s instruction. Briefly, 96-well assay plated were coated with 100 µl/well of capture antibody diluted in coating buffer and incubated overnight at 4 °C. The following day, the plate was aspirated and washed for three times with 1 x wash buffer. Blocking was carried out using 200 µl of assay diluent for one hour. After washing the plate for three times, 100 µl of standard or sample was added to each well and incubated overnight at 4°C. On the next day, the washing step was performed five times and 100 µl of working detector (detection antibody and Avidin-HRP diluted according to manufacturer’s instruction) was added to each well. After two hours of incubation at room temperature, the plate was washed for seven times with one minute incubation between washes. Substrate solution containing equal volumes of Reagent A and Reagent B was added in volumes of 100 µl to each well. The plate was then incubated in dark for 30 minutes at room temperature to allow colorimetric development. Finally, the reaction was stopped with 50 µl of Stop solution (H2SO4) for each well. Reading of the plates was done using a Bio-rad microplate reader, Bio-rad microplate manager model 680, version 5.2 at a wavelength of 450 nm. (B) R&D ELISA Kit The procedure of ELISA for TNF-α and IL-17 was similar to section (A) above with some slight modifications according to the manufacturer’s instruction. After the addition of standard and sample, the plate was incubated for 3 hours at room temperature instead of overnight at 4 °C. The incubation with detection antibody was carried out for 2 hours, 71 washed and continued with the incubation of Avidin-HRP for 30 min. The assay was completed on the same day. (C) eBioscience ELISA Kit The procedure of ELISA for IL-23 was performed according to the manufacturer’s instruction. Firstly, 96-well assay plated were coated with 100 µl/well of capture antibody diluted in PBS, pH 7 and incubated overnight at 4°C. Blocking was done in diluent provided in the kit for 1 hr at RT. Cytokine standards and samples were then diluted in the same diluent. After the addition of standard and sample, the plate was incubated overnight at 4°C. The plate was then incubated with secondary antibody for 1 hr at RT followed by 30 min of avidin-HRP incubation at RT. Plate was washed with washing buffer between each incubation step. TMB substrate (provided with kit) was then added to the wells (100 µl each well) for colorimetric development. The reaction was stopped with 50 µl of 0.2 N H2SO4 for each well. Reading of the plates was done using a Bio-rad microplate reader, Bio-rad microplate manager model 680, version 5.2 at a wavelength of 450 nm. 2.5 Protein Chemistry and Electrophoresis Tecniques 2.5.1 SDS-Polyacrylamide Gel Electrophoresis (SDS-PAGE) Table 2.1 Reagents for SDS-PAGE Reagents Separating 12.5 % Separating 15 % Stacking 6 % ddH2O 3.17 ml 2.35 ml 3.05 ml Tris pH 8.8 2.5 ml (pH 8.8) 2.5 ml (pH 8.8) 1.25 ml (pH 6.8) 10 % SDS 100 µl 100 µl 50 µl 30 % Acrylamide 4.16 ml 5 ml 0.65 ml 10 % APS 50 µl 50 µl 25 µl TEMED 5 µl 5 µl 5 µl 72 Sodium dodecylsulfate (SDS) 10% (w/v) in H2O Ammonium Persulfate (APS) 10% (w/v) in H2O N,N,N’,N-tetramethylene-diamine (TEMED) Reducing sample buffer (5x) 0.6 ml 1M Tris-HCl, pH 6.8 5 ml 50% (v/v) glycerol 2 ml10% (w/v) SDS 0.1 mM DTT 1 ml 1% (w/v) bromophenol blue 0.9 ml H2O Non-reducing sample buffer (5x) 0.6 ml 1M Tris-HCl, pH 6.8 5 ml 50% (v/v) glycerol 2 ml10% (w/v) SDS 1 ml 1% (w/v) bromophenol blue 1.4 ml H2O Electrophoresis Buffer 3g Tris (25 mM) 14.4 g glycine (192 mM) 1 g SDS (0.1 % w/v) H2O to make 1 litre SDS-polyacrylamide gel electrophoresis (SDS-PAGE) was carried out in a MiniProtean III electrophoresis chamber (Bio-rad). Samples were denatured by heating at 100 °C for 10 min in reducing or non-reducing sample buffer. Electrophoresis was conducted at 100 V at RT in electrophoresis buffer. Electrophoresis was stopped when 73 the dye-front had reached the end of the gel. Protein bands were visualized by Coomassie Brilliant Blue staining or Silver staining. 2.5.2 Coomassie Brilliant Blue Staining Coomassie Brilliant Blue Staining Solution 1 g Coomassie Blue R-250 450 ml methanol 450 ml H2O 100 ml glacial acetic acid Destaining Solution 10% glacial acetic acid with H2O The gel was transferred to a container with 20 ml of Coomassie staining solution and staining was allowed to proceed for 15 min at RT on a shaking platform. The staining solution was discarded and the gel was transferred to 50 ml of destaining solution. Destaining of gel was carried out until protein bands could be clearly observed. The detection limit of Coomassie Brilliant Blue staining is 0.1 µg of protein in a single band. 2.5.3 Silver Staining After SDS-PAGE, gel was soaked into 50 ml of 50 % ethanol / 10 % acetic acid for 10 min and transferred into 50 ml of 5 % ethanol / 7 % acetic acid for another 10 mins. Gel was washed with ddH2O for 5 times (2 min each wash). Gel was then soaked in 100 ml of ddH2O with 0.06 mM DTT for 15 min. Gel was wash 5x and transferred to 50 ml of 0.1 % of AgNO3 (silver nitrate) for 30 min. After 30 mins, the gel was transferred immediately to 100 ml of 3 % Na2CO3 supplemented with 50 µl of 37 % formaldehyde and soaked for 1 min. The solution was poured away and fresh 100 ml of 3 % Na2CO3 supplemented with 50 µl of 37 % formaldehyde was added for the development of silver stained bands. The staining reaction was monitored until bands were clearly visible and 74 2.4 M of citric acid was added to stop the reaction. All steps were performed at RT on a rocking platform. 2.5.4 Quantification of Protein Concentration – Bradford Assay Bradford assay was performed according to manufacturer’s (Bio-rad) instruction. Briefly, a standard curve ranging from 0-400 µg/ml was constructed. Samples were diluted to the working range with H2O. Samples were loaded into a 96-well plate (10 µl per well) and 200 µl of 1x Bradford dye was added to each well. The plate was then read with a Bio-rad microplate reader, Bio-rad microplate manager model 680, version 5.2 at 595 nm after 5 min incubation and protein concentration was estimated from the absorbance reading and the standard curve. 2.6 Molecular Biology Techniques 2.6.1 Polymerase Chain Reaction (PCR) PCR was performed in 30 µl reaction volumes each containing 10mM Tris-HCl (pH8.8), 1.5 mM MgCl2, 50 mM KCl, 0.1% (v/v) triton X-100, 200 µM of each dNTP, 0.5 µM of each forward and reverse primers and 1.25 U of Taq polymerase (Promega). Amplification was carried out in a DNA thermal cycler (MJ research, Inc, Waltham, MA) for 30 cycles. Each cycle comprises of 30 seconds at 94°C, 30 seconds at 52-68°C and 1-3 minutes at 72°C. At the end of last cycle, the reactions were extended for 10 minutes at 72°C. The PCR products were analyzed on 1-2% (w/v) agarose gels. The primers used for PCR in this project are listed in Table 2.2 75 Table 2.2 Primers used in PCR Primers Sequence (5’-3’) IL-12p40 F TGCAGTTAGGTTCTGATCCA IL-12p40 R CAGCAAAGATATCATTGTGATCCT IL-12p35 F TTTACCCTTGCACTTCTGA IL-12p35 R CAACTCCCATTAGTTATGAAAGA IL-23p19 F AATCAGGCTCAAAGCAAGTG IL-23p19 R TCTTCTCTTAGATCCATGTGTCC IL-10 F AATGCCTTTAATAAGCTCCAAGA IL-10 R TCTCAGTTTCGTATCTTCATTGT β-actin F GGAAGGAAGGCTGGAAGA β-actin R GGCGTGATGGTGGGCATG GAPDH F CGGAGTCAACGGATTTGGTCG GAPDH R TCTCGCTCCTGGAAGATGGTGAT 2.6.2 Real-time Polymerase Chain Reaction Real-time PCR was performed in 20 µl reaction volumes with each containing 10 µl of SYBr Green Master Mix (ABI), 2 µl of cDNA, 1 µl of forward and reverse primer and 7 µl of nuclease-free water. Reaction was carried out in a 7500 Real Time PCR System and analyzed with 7500 System SDS Software Version 1.4 (Applied Biosystems, CA, USA). 76 2.6.3 Isolation of Total RNA Total RNA of monocytes, macrophages and DCs were isolated using TRIZOL® reagent (Gibco, BRL). One million cells were lysed in 1 ml of TRIZOL reagent. The cell lysate was allowed to stand at room temperature for five minutes before the addition of 0.2 ml chloroform. The mixture was subjected to vigorous mixing for 15 seconds and allowed to stand for five minutes. Following, the mixture was centrifuged at 12, 000 rpm for 15 minutes at 4°C. After centrifugation, the colourless aqueous layer containing RNA was transferred into a fresh eppendorf tube. RNA precipitation was carried out using 0.5 ml of isopropyl alcohol. After incubation of 10 minutes, the precipitated RNA was centrifuged for 10 minutes at 12, 000 rpm. The supernatant was removed after centrifugation and the pellet washed with 70 % (v/v) ethanol. The washed RNA was allowed to dry and the purified RNA was dissolved in 20 µl of Diethyl Pyrocarbonate (DEPC, Sigma)-treated water. Dissolved RNA was stored at -80°C. 2.6.4 Quantification of RNA RNA optical density was measured with Nanodrop™ Spectrophotometer ND-1000. The readings at 280 nm, 260 nm and 230 nm were taken. The ratio of OD260/OD280 was used to determine RNA purity. RNA samples were used in experiments only when the OD260/OD280 ratio is greater than 1.8 2.6.5 Reverse Transcription and cDNA synthesis Reverse transcription was carried out using the Advantage RT-for-PCR Kit (Clontech Laboratories, Palo Alto, CA). Briefly, RNA was diluted to 1 µg/ml in DEPC-treated water to a total volume of 12.5 µl. The RNA was mixed with random hexamers and oligo(dT)18 primers. The mixture was denatured at 70°C for two minutes and rapidly 77 quenched on ice. Reverse-transcription (RT) was carried out for one hour at 42°C in 20 µl reactions containing 50 mM Tris-HCl (pH 8.3), 75 mM KCl, 3 mM MgCl2, 0.5 mM of each dNTP, 20 U recombinant RNase inhibitor and 200 U moloney murine leukemia virus (MMLV) reverse transcriptase. cDNA synthesis was terminated by heating at 94 °C for five minutes. The synthesized cDNA was either used immediately or stored at -80 °C. 2.6.6 DNA Agarose Gel Electrophoresis Agarose was melted in Tris-Acetate-EDTA buffer (TAE: 40 mM Tris, 20 mM Acetic acid, 1 mM EDTA, pH 7.8) at a concentration of 1 – 2 % (w/v). The melted agarose was allowed to cool to approximately 60°C and 0.05 % (v/v) of gel green was added to the mixture. The agarose solution was then casted in a gel casting set. DNA samples were mixed with a five-fold dilution of five-times (5 x) sample buffer (15 % (w/v) Ficoll 400, 0.1 M Na2EDTA (pH 8.0), 0.025 % (w/v) bromophenol blue and 0.25 % (w/v) xylene cyanol) and loaded into the wells of the gel together with 1 Kb Plus DNA Size Standard (Gibco, BRL). Electrophoresis was carried out at 100 V in TAE buffer. Electrophoresis was stopped when the dye front had reached ¾ of the gels. Visualization was carried out under a UV illuminator. Results were recorded by photography with Chemi-Smart 3000 Gel Doc Imaging System supported by Chemicapt version 12.6a software (Vilber Lourmat, France). 78 2.7 Histone Study Techniques 2.7.1 Cell Lysis (A) Biosource Lysis Buffer Cell lysis was carried out according to manufacturer’s instruction. Phosphatase inhibitor and protease inhibitor were added to the 1 x lysis buffer before cell lysis to prevent phosphorylation or degradation of proteins. Cell lysis was carried out for 30 min on a rotator at 4°C. (B) Hypotonic Lysis Buffer Hypotonic cell lysis was performed as described by Hake et. al., 2007. Cells were harvested on ice and kept on 4 °C for subsequent steps. Cells were washed three times with cold PBS and re-suspended at a maximum concentration of 5 x 106 cells / ml of hypotonic lysis buffer in a 1.5 ml tube. Cells were incubated for 30 min on a rotator at 4 °C to promote hypotonic swelling of cells and lysis by mechanical shearing. The intact nuclei was pelleted by centrifuging at 10 000 g for 10 min and used for nuclear extract preparation. 2.7.2 Acid Extraction of Histones Intact nuclei were collected by centrifugation after hypotonic cell lysis. Supernatant was discarded and nuclei obtained from each 5 x 106 cells were re-suspended in 400 µl of 0.4 N H2SO4. Nuclei were then incubation overnight at 4 °C on a rotator. Nuclear debris were then removed the next day by centrifugation at 16 000 g, 10 min. The histones will be in the supernatant. The supernatant which was highly acidic was dialyzed into ddH2O supplemented with 0.01 % (v/v) β-mercaptoethanol for 2 hours. 79 2.7.3 SDS Isolation of Histones Cells were cooled quickly to 4 °C and harvested on ice by mechanical scraping. Cells were washed three times with cold PBS. At the last wash, cells will be separated into 2 fractions at a ratio of 1:5. The lesser fraction will be re-suspended with Biosource lysis buffer for cell lysis and used to determine the protein concentration. The other fraction will be re-suspended with 100 µl of 1x SDS sample buffer (diluted from 5x nonreducing sample buffer for SDS-PAGE) containing 100 mM DTT. The maximum density of cells re-suspended into the sample buffer was 5 x 106 cells / ml. The cells were then subjected to 2 cycles of ultra-sonication by a Biorupter (Diagenode Inc., Belgium). Each cycle comprised of 30 sec ultra-sonication and 30 sec rest performed at 4 °C. 2.8 Cell Death Assessment – LDH Assay Cell death was assessed by measuring the released levels of endogenous lactate dehydrogenase (LDH). The assay was carried out according to the manufacturer’s (Pierce, Rockford, IL) instruction. Briefly, cells in 96-well plate (1 x 105 cells per well in 100 µl) were centrifuged at 2000 g, 3 min and the supernatant was harvested for the assay of LDH levels. A 100 % total LDH control (total cell lysate) was prepared by subjecting equal amount of cells to lysis by 1 x lysis buffer (provided in kit). Other controls that included were LDH positive control (kit provided), media control (to correct for phenol-red present in cell culture media). The assay was performed in triplicates with 50 µl of samples, total cell lysate, media control and LDH positive control added to the 96-well plate. 50 µl of substrate solution was added to the wells and the colorimetric development was allowed to proceed for 30 min. After 30 min, 50 µl of stop solution (provided in kit) was added to the wells and the plates were read at an 80 absorbance of 490 nm with a Bio-rad microplate reader, Bio-rad microplate manager model 680, version 5.2. Levels of LDH released were determined from the absorbance readings as below. Cell death % = (OD490nm of samples - OD490nm of media control) x 100% OD490nm of Total Cell Lysate OD490nm of Total Cell Lysate = 100 % 2.9 Stastitical Analysis Statistical analysis was performed with the Student T test unless otherwise stated. 81 CHAPTER 3 RESULTS 3.1 Overview Dimethyl sulfoxide (DMSO, [(CH3)2SO]) is an amphipathic molecule with a highly polar domain and two apolar methyl groups. Hence, DMSO is soluble in both aqueous and organic media. This unique property had made DMSO a widely used solvent for the administration of water-insoluble-subtances in vivo. The other important characteristic of DMSO is that it is a hydrogen–bound disrupter (Santos et al., 1997), making it an important chemical in both the laboratory and clinical settings such as its applications as cyroprotectant, cell differentiating agent, hydroxyl radical scavenger, intercellular electrical uncoupler, intracellular low-density lipoprotein-derived cholesterol mobilizing agent, solubilizing agent used in sample preparation for electron microscopy, antidote to the extravasation of vesicant anticancer agents, and topical analgesic (Santos et al., 2003). DMSO is currently widely used in the storage of cell lines as it is an effective cryoprotectant. Nevertheless, DMSO has been known to be toxic to cells at high concentrations. Despite its side effects (Zhang and Eyzaguirre, 1999), it offers protection to the cryo-preserved cells. (Kubin et al., 1994) reported that DMSO could enhance LPS-elicited IL-12 production by human myeloid leukemia cell lines and primary peripheral blood mononuclear cells. In vivo, dendritic cells (DCs) are major producers of IL-12 which is key to the induction of Th1 type of immunity. In this study, we examine how DMSO regulates IL-12 production by DCs. We found that while DMSO increases the production of IL-12 by DCs, it suppresses LPS-elicited IL-10 production by these cells, further potentiating a Th1 immune response. However, 82 DMSO has minimal effect on the phenotype of DCs and T cells. Besides, DMSO also polarizes macrophages towards a Th1 immune response though not as prominently as it does with DCs. 3.2 Monocytes differentiate into Macrophages and DCs The main cell type used in this project is DC with macrophages being included in some experiments. Both macrophages and DCs used in this investigation were derived from monocytes (Cao et al., 2006). Monocytes were isolated from buffy coat preparations of healthy blood donors by an adhesion method. Monocytes but not other blood leukocytes adhere to tissue culture plates under defined conditions which allow the separation of these cells from other leukocytes (e.g. lymphocytes). Monocytes isolated by this method were around 95 % pure as judged by the high levels of surface CD14 molecules. The monocytes can be differentiated into three different types of macrophages when cultured with different cytokines; (i) MCSF alone, (ii) GMCSF alone, and (iii) MCSF + GMCSF. Thus generated macrophages are named M-MF, GM-MF, and MGM-MF, respectively. All three macrophage types had high levels of CD14 surface expression and low CD1a expression. M-MF displayed a phenotype characterized by generally weak response to IFN-γ and LPS stimulation in term of IL-12 production. However, these cells produced high levels of IL-10 when challenged with LPS. GM-MF and MGM-MF produced higher levels of IL-12 when stimulated with IFN-γ and LPS but relatively lower IL-10 compared to MMF. 83 Likewise, three types of DCs were generated from monocytes by culturing with (i) MCSF + IL-4 (M-DC), (ii) GMCSF + IL-4 (GM-DC) and (iii) MCSF + GMCSF+ IL-4 (MGM-DC). All three DC types expressed surface CD1a to a significant level but they have down-regulated surface expression of CD14. GM-DCs represent a population of inflammatory DCs and were able to respond to IFN-γ/LPS treatment by producing high levels of IL-12. GM-DCs will be used in most experiments of this study. MGM-DC was found to be similar to GM-DC while M-DC was less immunostimulatory compared to the other two DC types. M-DCs were poor in IL-12 production but these cells produce a significant amount of IL-10 when challenged with LPS. The phenotypic characteristics of monocytes, M-MF and GM-DCs are shown in Figure 3.1. 84 Figure 3.1 Phenotypic markers on monocytes, macrophages and DCs. Macrophages (Mac) shown in this experiment are M-CSF macrophages, DCs are GM-CSF DCs. Two surface markers are examined (CD14 and CD1a). After activation with LPS for 24 hr, macrophages were also examined for CD54 and DCs examined for surface CD83. Activated DCs are also known as mature DC (mDC). Before activation, DCs are also known as immature DC (imDCs). Solid histograms represent isotype control; solid lines represent surface markers on monocytes (MCs), macrophages and imDCs without LPS stimulation. CD54 and CD83 detected on activated macrophages and DCs are represented by dotted blue histograms. Cell analysis was performed on FACScalibur using the CellQuest software. 85 3.3 DMSO Effect on Cytokine production by Macrophages and DCs Macrophages and DCs were cultured under different conditions to generate the six different cell types; M-MF, GM-MF, MGM-MF, M-DC, GM-DC and MGM-DC. The cells were activated either with LPS alone or with both IFN-γ and LPS. Cells were activated with or without DMSO priming. As shown in Figure 3.2 (a), with the exception of M-MF, all five cell types responded to DMSO priming with an increased IL-12p70 production upon IFN-γ/LPS stimulation. DMSO alone did not induce the production of IL-12p70 without subsequent IFN-γ/LPS stimulation. The enhancing effect of DMSO was most significant with GM-DCs. GM-MF also showed substantial increase in IL-12p70 production upon DMSO priming. M-MFs are poor producers of IL-12p70 and showed little IL-12p70 production upon IFN-γ/LPS stimulation with or without DMSO priming. M-DCs produced low levels of IL-12p70 compared to the other DCs though there is a slight increase in the IL-12p70 production upon DMSO priming. This suggests that M-MF and M-DC could be more tolerogenic or suppressive in immune responses and might favour either Th2 immune response or tolerance while GM-DCs seem to have the potential for inducing Th1 type immune response. The corresponding IL-10 production by these six cell types are shown in Figure 3.2 (b). All three macrophage types especially M-MF and M-DC produced high levels of IL-10 after LPS stimulation. Additional IFN-γ treatment partially inhibited LPS-elicited IL-10 production. DMSO priming before LPS or IFN-γ/LPS stimulation suppressed IL-10 production in all six cell types except M-MF. IL-10 production by the five cell types decreased greatly when DMSO was present. However, DMSO priming did not result in a significant decrease in LPS-elicited IL-10 production by M-MF. M-MF only showed a significant decrease in its IL-10 production when M-MF was primed with DMSO and 86 subsequently challenged with IFN-γ and LPS suggesting that DMSO synergizes with IFN-γ to skew the cytokine profile of M-MF. For the other five cell types, DMSO priming almost completely abrogated IL-10 production. 87 (a) DMSO Regulation of Cytokine Production (6 Cell Types) 12000 IL-12p70 Conc (pg/ml) 10000 8000 Control LPS IFN-γ+LPS DMSO 1% DMSO 1% LPS DMSO 1% IFN-γ+LPS * 6000 4000 2000 0 MMF (b) GMMF MGMMF MDC GMDC MGMDC DMSO Regulation of Cytokine Production (6 Cell Types) 2500 Control LPS IFN-γ+LPS DMSO 1% 2000 IL-10 Conc (pg/ml) DMSO 1% LPS DMSO 1% IFN-γ+LPS 1500 1000 500 0 MMF GMMF MGMMF MDC GMDC MGMDC Figure 3.2 DMSO enhances LPS-elicited IL-12p70 production but suppresses LPSelicited IL-10 production. (a) DMSO priming increases the IFN-γ and LPS-elicited IL12p70 production by GM-MF, GM-DC and MGM-DC. Cells were primed with DMSO (1%) for 12 hr and then stimulated for 24 hr with IFN-γ/LPS. IL-12p70 production was measure by ELISA. The increase is most significant in GM-DC. (b) DMSO priming caused reduced IL-10 production in all cell types except M-MF. Data shown is a representative of 3 experiments. * p-value < 0.01 88 3.4 Time and Concentration Dependent Effect on DMSO on DCs The response of DCs to DMSO treatment was tested under various concentrations and under different time periods. A range of DMSO concentrations from 0 to 2 % (v/v) were used to prime DCs before subsequent IFN-γ and LPS stimulation. Cytokine production especially IL-12p70 was determined. Besides varying the DMSO concentration, the duration of DMSO priming was also investigated. Three different time points were selected; i.e. 12 hr, 1.5 hr and 0 hr. 0 hr means that DMSO was added to the cells immediately before IFN-γ and LPS stimulation. As shown in Figure 3.3a, DMSO at 1 % greatly enhanced LPS induction of IL-12p70 from GM-DCs and this was observed irrespective of the period of priming, i.e. 0 hr, 1.5 hr or 12 hr. IL-12p70 induction by IFN-γ and LPS increased in a dose-dependent manner when priming DMSO concentration was increased from 0 to 1 % (Figure 3.3b). However, a sharp decrease in IL-12p70 production by GM-DCs was observed at 2 % priming DMSO concentration for both LPS and IFN-γ/LPS stimulation. This might be due to DMSO toxicity to DCs at high concentrations. 89 (a) DMSO Regulation of Cytokine Production _ IL-12p70 (LPS) 350 Control 12 hours 1.5 hours 0 hour IL-12p70 Conc (pg/ml) 300 250 200 150 100 50 0 2 1 0.5 0.25 0.125 0.0625 0.03125 0 LPS DMSO % (b) DMSO Regulation of Cytokine Production - IL-12p70 (IFN-y+LPS) 14000 Control 12 hours 1.5 hours 0 hour IL-12p70 Conc (pg/ml) 12000 10000 8000 6000 4000 2000 0 2 1 0.5 0.25 0.125 0.0625 0.03125 0 IFNγ+LPS DMSO % Figure 3.3 DMSO increased IL-12p70 production by GM-DCs in a dose- and timedependent manner (a) DCs were primed with DMSO at various concentrations (0 to 2 %) and for 0 hr, 1.5 hr or 12 hr before LPS stimulation for 24 hr. (b) DCs were primed with DMSO at various concentrations (0 to 2 %) and for 0 hr, 1.5hr or 12 hr before IFNγ/LPS stimulation for 24 hr. IL-10 production was assayed by ELISA. Data shown is a representative of 3 experiments. 90 Figure 3.4 illustrates IL-10 production by GM-DCs with DMSO priming for 0 hr, 1.5 hr or 12 hr at 0 - 1.0% which were then stimulated with IFN-γ/LPS for another 24 hr. As opposed to DMSO-induced increase in IL-12p70 production, DMSO inhibited IL-10 production by LPS-activated GM-DCs in a dose-dependent manner. The levels of IL-10 production by IFN-γ/LPS treated GM-DCs also decreased when these cells were primed with DMSO (Figure 3.4 (b)). The decrease also showed a dose-dependent manner though IFN-γ alone suppressed the overall IL-10 production. Both enhancement of IL12p70 production and suppression of IL-10 production by DMSO were most significant when 1 % DMSO was used to prime the cells. Hence, DMSO 1 % priming for 1.5 hr was chosen for most subsequent experiments unless otherwise stated. For the control experiments, cells were primed with DMSO at the corresponding DMSO concentrations according to the stated duration respectively but these cells were not stimulated with IFN-γ/LPS. 91 (a) IL-10 Conc (pg/ml) DMSO Regulation of Cytokine Production - IL-10 (LPS) 300 Control 12 hours 1.5 hours 250 0 hour 200 150 100 50 0 2 1 0.5 0.25 0.125 0.0625 0.03125 0 LPS DMSO % (b) DMSO Regulation of Cytokine Production - IL-10 (IFN-y+LPS) 120 IL-10 Conc (pg/ml) 100 Control 12 hours 1.5 hours 0 hour 80 60 40 20 0 2 1 0.5 0.25 0.125 0.0625 0.03125 0 IFNγ+LPS DMSO % Figure 3.4 DMSO inhibits IL-10 production by GM-DCs in a dose- and timedependent manner DCs were primed with DMSO at various concentrations (0 to 2 %) and for 0 hr, 1.5 hr or 12 hr before LPS stimulation for another 24 hr. IL-12p70 (a) and IL-10 (b) production was determined by ELISA. Data shown is a representative of 3 experiments. 92 3.5 DMSO Treatment Effect on Cell Survival Lactate dehydrogenase (LDH) is an intracellular enzyme that will only be released upon cell death. LDH levels were measured to determine the extent of cell death in these experiments which can also affect IL-12p70 and IL-10 production. Figure 3.5 (a) shows the level of cell death in GM-DC culture when the cells were primed with different concentrations of DMSO for 12 hr, 1.5 hr or 0 hr. GM-DC was also stimulated with IFN-γ/LPS after DMSO priming. DMSO priming up to 1 % did not significantly increase cell death as judged from the levels of LDH released. However, elevated LDH release was seen in the cell culture upon priming at 2 % DMSO. This could be the reason why DC primed at 2 % DMSO failed to produce IL-12p70 and IL-10 as shown in Figure 3.4. Figure 3.5 (b) showed that LDH levels in the GM-DC culture were similar with or without DMSO 1 % priming. This suggests that DMSO has minimal toxicity on the DCs used in this study as the level of cell death indicated by the level of LDH released is similar regardless of the presence or absence of DMSO. The LDH levels decreased substantially when DMSO was removed by washing before IFN-γ/LPS stimulation. The washing of cells is to remove the DMSO from the culture supernatant. This was to investigate if the continuous presence of DMSO would result in a higher percentage of cells death. However, the levels of LDH released were similar for both control and DMSO 1% DCs. The LDH levels measured were relative to the total amount of LDH released upon complete lysis of GM-DCs (Total Cell Lysate). Figure 3.5(b) also indicated that IFN-γ/ LPS stimulation had no effect on the viability of GM-DC. 93 (a) Cell Death Assessment for DMSO primed GM-DC 100 12 hr 90 1.5 hr 0 hr 80 DMSO alone Total Cell Lysate % LDH Release 70 IFN-y+LPS 60 50 40 30 20 10 0 2 1 0.5 0.25 0.125 0.0625 0.03125 0 DMSO % (b) LDH Release by GM-DC upon 1% DMSO Treatment 120 Relative LDH Levels % 100 No treatment LPS IFN-γ+LPS 80 60 40 20 0 DMSO 1% wash Control wash DMSO 1% Control Total Cell Lysate LDH Positive Control Figure 3.5 Determination of DMSO toxicity by LDH release assay. (a) LDH levels were measured to determine extent of cell death upon treatment by DMSO at various concentrations and durations. GM-DCs showed signs of toxicity upon 2 % DMSO priming. (b) DMSO 1 % was removed by washing prior to IFN-γ/LPS treatment. Cell viability was higher when DMSO was removed through washing. Data shown is a representative of 3 experiments. 94 3.6 DMSO Effect on Cytokine Production by GM-DC is reversible DMSO at 1% greatly enhanced IL-12p70 production by IFN-γ/LPS-stimulated GM-DCs. It was shown in Figure 3.6(a) that removing of DMSO by washing before IFN-γ/ LPS stimulation, also removed the enhancement effect of DMSO on IFN-γ/LPS-elicited IL12p70 production in GM-DC. . The increase in IL-12p70 production by GM-DCs, which were primed with DMSO 1 % and then washed, was negligible compared to GMDCs which were not primed with DMSO. It shows that the synergistic effect of DMSO requires its constant co-stimulation. Similarly, the DMSO effect on IL-10 production was also lost upon the removal of DMSO. DMSO significantly reduced the production of IL-10 by LPS-stimulated GMDCs. IFN-γ alone also down-regulated LPS-elicited IL-10 production. Figure 3.6(b) demonstrated that, if DMSO was removed before LPS stimulation, LPS-elicited IL-10 production by GM-DCs was not affected. DMSO synergized with IFN-γ to suppress LPS-elicited IL-10 production further to near background level. Thus, DMSO can potentially skew immune response towards a Th1 type of immune response by increasing IL-12p70 production while suppressing IL-10 production. Nevertheless, DMSO is only able to exert its influence when it co-exists with microbial or inflammatory stimuli as its effect on GM-DCs is lost upon its removal by washing. 95 (a) DMSO Regulation of DC Cytokine Production (washing effect) 20000 * Wash 18000 No Wash IL-12p70 Conc (pg/ml) 16000 14000 12000 10000 8000 6000 4000 2000 0 DMSO 1% Control DMSO 1% with Control with LPS DMSO 1% with Control with IFNLPS IFN-γ+LPS γ+LPS (b) DMSO Regulation of DC Cytokine Production (wash effect) 600 Wash No Wash IL-10 Conc (pg/ml) 500 400 300 200 100 0 DMSO 1% Control DMSO 1% with Control with LPS DMSO 1% with Control with IFNLPS IFN-γ+LPS γ+LPS Figure 3.6 DMSO effect on cytokine by GM-DCS is lost upon removal of DMSO. Cells were primed with 1 % DMSO for 2 hr before washing with medium to removed DMSO from the culture which was followed by IFN-γ/LPS stimulation. (a) The enhancement of LPS or IFN-γ/LPS-elicited IL-12p70 by DMSO diminished upon removal of DMSO. (b) DMSO was not able to inhibit LPS-elicited IL-10 production by GM-DCs if it is removed from the culture media before LPS stimulation. Data shown is a representative of 3 experiments. * p-value < 0.01 96 3.7 DMSO Effect on GM-DC Maturation Figure 3.7 shows the surface molecules on DCs which are indicative of immature GMDCs and activated or mature DCs. DCs were activated with IFN-γ/LPS with or without prior DMSO priming. Immature GM-DCs typically express low levels of surface CD14, high levels of surface CD1a, and high levels of surface MHC II molecules. After IFNγ/LPS activation, the expression of CD14 and CD1a remains the same. Figure 3.7(a) shows that DMSO (1 %) treatment did not alter the expression of these surface molecules on GM-DCs. Hence, DMSO treatment has not changed these two characteristic surface markers on GM-DCs. Matured GM-DCs exhibited increased surface expression of MHC II, CD86, CD80 and CD83. Figure 3.7(b) shows that the expression of CD86, CD83 and CD80 on GM-DCs was low before activation. However, GM-DCs activated with IFN-γ/LPS showed a significant up-regulation. Immature GM-DCs already expressed high MHC II but this was further elevated upon activation. Nevertheless, DMSO priming had no significant effect on the surface expression of these activation markers. Immature GM-DCs that were primed with 1 % DMSO alone showed no significant change in the expression of these molecules GM-DCs that were primed with DMSO and then stimulated with IFNγ/LPS showed levels of these molecules as compared to IFN-γ/LPS-activated GM-DCs which were not primed with DMSO. Therefore, DMSO priming did not alter the surface and activation markers of GM-DCs leaving its regulation of GM-DCs selectively in the production of IL-12p70 and IL-10 cytokines. 97 (a) DMSO Effect on Cell Surface Markers DC-control 310 375 313 232 281 204 209 Counts 155 Counts 187 102 104 77 93 102 FL 2 Log 103 0 100 104 101 102 FL 2 Log 103 104 0 100 101 102 FL 2 Log 103 0 100 104 493 433 447 342 369 324 335 228 246 Counts 216 Counts 223 114 123 108 111 101 102 FL 2 Log 103 0 100 104 101 102 FL 2 Log 103 104 0 100 101 102 FL 2 Log 103 104 0 100 883 610 603 684 662 457 452 Counts 441 Counts 305 Counts 301 220 152 228 0 100 10 1 10 2 FL 1 Log 103 0 100 10 4 DC-control 101 102 FL 1 Log 103 104 103 104 101 102 FL 2 Log 103 104 101 102 FL 1 Log 103 104 150 0 100 DC-DMSO 102 FL 2 Log Counts 913 456 101 Counts 456 Counts MHC II 101 Counts 418 306 0 100 (b) DC-DMSO+IFNγ+LPS 408 0 100 CD1 a DC-IFNγ+LPS Counts CD 14 DC-DMSO 101 102 FL 1 Log 103 104 DC-IFN-γ+LPS 0 100 DC-DMSO+IFN-γ+LPS 757 493 433 447 567 369 324 335 378 Counts 246 Counts 216 Counts 223 189 123 108 CD86 101 102 FL 2 Log 103 104 0 100 101 102 FL 2 Log 103 104 0 100 Counts 0 100 111 101 102 FL 2 Log 103 104 0 100 757 493 433 447 567 369 324 335 Counts 246 Counts 216 Counts 223 101 102 FL 2 Log 103 104 101 102 FL 2 Log 103 104 101 102 FL 2 Log 103 104 CD83 189 0 100 123 101 102 FL 2 Log 103 104 0 100 Counts 378 108 101 102 FL 2 Log 103 104 0 100 111 101 102 FL 2 Log 103 104 0 100 456 493 433 447 342 369 324 335 228 Counts 246 Counts 216 Counts 223 114 123 108 111 CD80 101 102 FL 2 Log 103 104 0 100 101 102 FL 2 Log 103 104 0 100 Counts 0 100 101 102 FL 2 Log 103 104 0 100 Figure 3.7 DMSO does not alter expression of cell surface markers. (a) GM-DCs primed with DMSO at 1% displayed no difference in the expression of CD14 and CD1a. (b) Surface expression of CD80, CD86, CD83 and MHC II on imDCs and IFN-γ/LPSactivated DCs was not affected by DMSO (1 %) priming. No significant up-regulation of DC activation markers was observed upon DMSO priming. Clear region represents isotype control while green shaded region represents the test antibody marker. Data shown is a representative of 5 experiments. 98 3.8 DMSO does not Affect the Morphology of DCs Figure 3.7 demonstrates that DMSO priming did not alter the expression of surface molecules on GM-DCs. The morphology of GM-DCs was examined for changes induced by DMSO priming. As shown in Figure 3.8, imDCs appear as tiny clusters in culture under microscope with slight projections of dendrites. Upon IFN-γ/LPS stimulation, imDCs become mature mDCs displaying many dendrite projections interconnecting the different cell clusters. mDCs also appear to have great motility. DMSOprimed imDCs and mDCs showed no significant change in this characteristic DC morphology though imDCs primed with DMSO for 24 hr appeared to have more clustered cells in the culture. Similarly, DMSO-primed mDCs had large amount of dendrite projections and was not significantly different from mDCs without DMSO priming. Hence DMSO treatment did not cause significant morphological changes on DCs. 99 (a) (b) (c) (d) Figure 3.8 DMSO does not affect GM-DC morphology Immature GM-DCs (a), DMSO (1%)-primed GM-DCs (b), IFN-γ/LPS-stimulated GM-DCs without DMSO priming (c), and IFN-γ/LPS-stimulated GM-DCs with DMSO priming (d) were examined in live culture. Images were taken 24 hr after LPS challenge (20x magnification) 100 3.9 DMSO Enhances Th1 Type Immune Response induced by GM-DC GM-DCs were primed with DMSO for 2 hr and subsequently stimulated with IFNγ/LPS for another 24 hours before RNA isolation. Real-time PCR was performed to determine cytokine regulation by DMSO at the transcriptional level. The culture supernatants from the same experiments were collected and assayed for cytokine production by ELISA. The mRNA for IL-12p40 and IL-12p35, two subunits that form the bioactive IL-12p70, was determined. Results showed that GM-DCs produced large amounts of IL-12p40 and IL-12p35 mRNA when stimulated with IFN-γ/LPS (Figure 3.9a and 3.9b). DMSO priming alone did not affect the RNA expression for IL-12p40 and IL-12p35. However, when GM-DCs were first primed with DMSO and subsequently stimulated with IFN-γ/LPS, a significant increase in IL-12p40 and IL12p35 mRNA expression was observed. This is consistent with the ELISA result. (Figure 3.10a and 3.10b). GM-DCs produced IL-12p70 upon IFN-γ/LPS stimulation. DMSO (1 %) priming before IFN-γ/LPS stimulation greatly increased IL-12p70 induction. DMSO priming alone did not result in IL-12p70 production by GM-DCs. Similarly, IFN-γ/LPS-elicited IL-12p40 production was increased when GM-DCs were primed with DMSO. Figure 3.9(c) shows that GM-DCs also produced high amount of IL-23p19 if these cells were primed with DMSO before stimulation with IFN-γ/LPS. IL-23p19 is a subunit of IL-23 and the other subunit for this cytokine is IL-12p40. IFN-γ/LPS induced much less IL-23p19 mRNA from GM-DCs without DMSO priming. Figure 3.10(c) shows that IFN-γ/LPS indeed increased much higher levels of IL-23 in DMSO primed GM-DCs as compared to GM-DCs without DMSO priming. 101 Analysis of real-time PCR results showed that DMSO slightly decreases the mRNA of IL-10 mRNA in GM-DCs (Figure 3.9d). However, IFN-γ seems to play a greater role than DMSO in inhibiting LPS-elicited IL-10 mRNA expression. Figure 3.10(d) showed that IL-10 cytokine was much reduced in culture with DMSO-primed GM-DCs upon IFN-γ/LPS stimulation, as compared to activated GM-DCs without DMSO priming. It was noted that the IL-10 mRNA was present in GM-DCs without stimulation but no IL10 was secreted by these cells. IL-10 cytokine was only produced when GM-DCs were stimulated with IFN-γ/LPS. The PCR product was also analyzed on a 1% agarose gel. The results are shown in the gel photo in Figure 3.9e. The brightness of the DNA bands correspond to the levels of real-time PCR. Thus, both the real-time PCR and ELISA results, especially the latter, indicate that DMSO skews GM-DCs for the induction of Th1 type of immune response. The reduced IL-10 production may result in reduced Th2 type immune response or reduced tolerance. 102 (a) (b) 10000000 1000000 IL12p40 1000000 IL12p35 100000 100000 10000 10000 1000 1000 g+ LP S +I FN D D M SO M SO IF N +I FN g+ LP M SO g ne g+ L M SO D g+ LP ne g IF N D 1 PS 10 1 S 10 S 100 100 (c) (d) 120 250000 IL-10 IL23p19 100 200000 80 150000 60 100000 g+ LP S M SO D M SO +I FN D S g+ LP +I FN M SO D IF N LP S g+ M SO D IF N g+ LP S 0 ne g 20 0 ne g 40 50000 (e) IL-12p40 IL-12p35 IL-23p19 IL-10 GAPDH Figure 3.9 Real-time PCR detection of cytokine mRNA in DMSO-primed GM-DCs. GM-DCs were treated as follows: (1) unstimulated (neg), (2) stimulated for 24 hr with IFN-γ/LPS, (3) stimulated with DMSO for 2 hr, AND (4) primed with DMSO for 2 hr followed by IFN-γ/LPS stimulation for 24 hr. RNA was isolated from these cells for RT-PCR detection of mRNA for IL-12p40 (a), IL-12p35 (b), IL-23p19 (c), and IL-10 (d). DMSO priming increased IL-12p40, IL-12p35 and IL-23p19 mRNA expression but it inhibited IL-10 (d) mRNA expression. IFN-γ also inhibited IL-10 mRNA expression. (e) The RT-PCR reactions were also examined on a 1% agarose gel (Lane 1,Control; lane 2,DMSO; lane 3,IFN-γ/LPS; lane 4, DMSO followed by IFNγ/LPS) 103 (a) IL-12p70 Production by DCs 120000 * IL-12p70 Conc (pg/ml) 100000 80000 60000 40000 20000 0 Control DMSO (1%) IFN-γ+LPS DMSO+IFN-γ+LPS (b) IL-12p40 Production by DC * 80000 70000 IL-12p40 Conc (pg/ml) 60000 50000 40000 30000 20000 10000 0 Control DMSO (1%) IFN-γ+LPS DMSO+IFN-γ+LPS Figure 3.10 DMSO regulation of DC cytokine production. After cells were harvested for RNA isolation, the culture supernatants were used for ELISA detection of (a) IL12p70; (b) IL-12p40; (c) IL-23; (d) IL-10. * p-value < 0.005 104 (c) IL-23 Production by DCs * 90000 80000 IL-23 Conc (pg/ml) 70000 60000 50000 40000 30000 20000 10000 0 Control DMSO (1%) IFN-γ+LPS DMSO+IFN-γ+LPS (d) IL-10 Production by DCs 250 IL-10 Conc (pg/ml) 200 150 * 100 50 0 Control DMSO (1%) IFN-γ+LPS DMSO+IFN-γ+LPS Figure 3.10 DMSO regulation of DC cytokine production. After cells were harvested for RNA isolation, the culture supernatants were used for ELISA detection of (a) IL12p70; (b) IL-12p40; (c) IL-23; (d) IL-10. * p-value < 0.005 105 3.10 DMSO Effect on Histone Expression and Histone Modifications on DCs How DMSO synergizes with IFN-γ/LPS in IL-12p70, and IL-23 induction while inhibiting IL-10 induction from GM-DCs is not understood. Examination of DMSO on IFN-γ/LPS -elicited ERK, p38 and PI3K signaling revealed no obvious effect (data not shown). We then asked whether DMSO synergizes through epigenetic regulation through chromatin modification by examining the methylation, phosphorylation and acetylation status of histone 3 (H3). Figure 3.11 shows the panel of histone H3 modifications investigated. For simplicity, abbreviated names are used in this section for untreated GM-DCs (con-DC), DMSO primed-GM-DCs (DMSO-DC), IFN-γ/LPS-stimulated GM-DCs (IL-DC) and IFNγ/LPS-treated GM-DCs with DMSO priming (DIL-DC). The expression level of histone H3 was not affected by IFN-γ/LPS or DMSO stimulation. Methylation of H3 on 5 different lysine residues were examined. Dimethylation on lysine 4 (H3K4me2) was high in GM-DCs and this was not affected by DMSO or/and IFN-γ/LPS stimulation. IFN-γ/LPS slightly inhibited dimethylation on lysine 9 (H3K9me2) but this was rescued by DMSO which, by itself, significantly increased lysine 9 dimethylation. DMSO was found to marginally increase the dimethylation of lysine 27 (H3K27me2) while it reduced the IFN-γ/LPS-induced increase in the dimethylation of lysine 36 (H3K36me2) and lysine 79 (H3K79me2) to levels that were not different from that observed in untreated GM-DCs. Overall, synergy between DMSO and IFN-γ/LPS in the regulation of H3 methylation was not obvious except for lysine 9 where it was consistenly noted that DMSO was able to rescue the IFN-γ/LPS inhibition of dimethylation on H3 lysine 9. 106 H3 acetylation was examined on lysine 18, 23 and 28. Lysine 18 is highly acetylated in unstimulated GM-DCs (H3K18Ac) and this was not affected by DMSO or IFN-γ/LPS. In contrast, both lysine 23 and 28 showed low acetylation and these were not affected by DMSO or IFN-γ/LPS. Lysine 9 is a versatile residue which, beside methylation, is also acetylated. Acetylated lysine 9 can be detected in conjunction with phosphorylated serine 10 residue using a single antibody. In unstimulated GM-DCs, this double modification (H3S10PK9Ac) was strong but this was inhibited by both IFN-γ/LPS and DMSO to the same extents However, synergy between these two stimuli was not observed in inhibiting this double modification. Phosphorylation on threonine 3 and 11 was also examined on H3. Unstimulated GMDCs showed a high level of threonine 3 phosphorylation (H3Thr3P). However, this was markedly reduced upon IFN-γ/LPS or DMSO stimulation. Synergy was again not observed between IFN-γ/LPS and DMSO in inhibiting threonine 3 phosphorylation. Phosphorylation of threonine 11 (H3Thr11P) was low in GM-DCs and was not significantly altered by the stimuli. The expression of human β-actin was detected to ensure equal amount of protein was loaded for the western blot studies. 107 H3 Total Legend: H3 K4 Me2 D – DMSO (1%) I – IFN-γ (500 ng/ml) H3 K9 Me2 L – LPS (1 µg/ml) H3 K27 Me2 Me2 – dimethylation H3 K36 Me2 Ac – Acetylation H3 K79 Me2 P – Phosphorylation K – Lysine H3 K18 Ac S – Serine H3 K23 Ac Thr – Threonine H3 S10P K9Ac H – Histone H3 S28 Ac IL – IFN-γ + LPS DIL – DMSO + IFN-γ + LPS H3 Thr3 P H3 Thr11 P h β-actin Control IL DMSO DIL Figure 3.11 Western blot analysis of DMSO- and IFN-g/LPS-induced histone H3 methylation, acetylation and phosphorylation in GM-DCs. DMSO priming did affect some H3 modifications but synergy was observed between DMSO and IFNγ/LPS to explain the synergy observed in the induction of IL-12p70 and IL-23 and in the inhibition of IL-10. IL denotes cells stimulated with IFN-γ and LPS while DIL denotes cells that were primed with DMSO and further stimulated with IFN-γ and LPS. Data shown is a representative of 3 experiments. 108 3.11 DMSO Effect on CD4+ T Cell The effect of DMSO on DC production of IL-12, IL-23 and IL-10 is indicative of its effect on T cell activation or the activation of adaptive immunity. IL-12 production by DC is important for the induction of Th1 cells and IL-23 induces Th17 cells. We therefore decide to examine whether DMSO-treated DCs activate these T cell subsets differently from the non-primed DCs. This will be examined by mixed leukocyte reactions (MLR) by co-culturing DCs with allogeneic CD4+ T cells. Before the MLR experiments, we evaluated whether DMSO has direct stimulatory or inhibitory effects on CD4+ T cells in the absence of DCs. This was performed by activation of CD4+ T cells in vitro with anti-CD3 and anti-CD28 antibodies in the presence or absence of DMSO. The antibodies were coated on latex beads to stimulate naïve CD4+ T cells in the presence and absence of DMSO. Culture supernatants were harvested and were assayed for IFN-γ, IL-17 and IL-2 production after 3 days and 7 days. Figure 3.12 shows the cytokine (IFN-γ, IL-17 and IL-2) production by the CD4+ T cells. DMSO inhibited the production of all three cytokines induced by anti-CD3/antiCD28. IFN-γ production was inhibited by more than 50 % in the presence of DMSO (Figure 3.12(a)). DMSO almost completely abrogated the production of IL-17 at both day 3 and day 7 (Figure 3.12(b)). In Figure 3.12c, it was observed that IL-2 production detected in the supernatant collected on day 3 but not that obtained on day 7. Nevertheless, DMSO strongly inhibited the production of IL-2 by the activated CD4+ T cells. These results suggest that, where DMSO is used as a solvent for T cell-stimulating agent, its concentration needs to be tightly monitored to avoid the potent inhibitory effects. It also presents a challenge in our following up MLR experiments in which DMSO is used in the DC-T cell co-culture. 109 (a) IFN-y Production by T Cells upon treatment with DMSO 6000 Day3 Day7 * IFN-y Conc (pg/ml) 5000 4000 3000 2000 1000 0 DMSO with αCD3/CD28 (b) Media with α-CD3/CD28 DMSO Media T Cells Production of IL-17 upon DMSO treatment 2500 Day3 Day7 * IL-17 Conc (pg/ml) 2000 1500 1000 500 0 DMSO with α-CD3/CD28 Media with α-CD3/CD28 (c) DMSO Media DMSO Media DMSO Effect on T cells (wells coated with anti-CD3/CD28) 1400 Day3 Day7 1200 IL-2 Conc (pg/ml) 1000 800 600 400 200 0 DMSO with α-CD3/CD28 Media with α-CD3/CD28 Figure 3.12. Direct DMSO Effect on T Cell Activation. CD4+ T cells were primed with DMSO for 2 hr before stimulation with anti-CD3/anti-CD28 antibodies coated on latex beads. At day 3 and day 7, the culture media were assayed for the production of cytokines: (a) IFN-γ; (b) IL-17; and (c) IL-2. Data shown is a representative of 3 experiments. * p-value < 0.01 110 3.12 DMSO Effect on Cytokine Production by CD4+ T Cells in MLR MLR was then performed to investigate how DMSO-primed GM-DCs activate CD4+ T cells. This was determined by CD4+ T cell production of IFN-γ, IL-17 and IL-2 in these experiments. As shown in Figure 3.13(a), DMSO alone had no effect on CD4+ T cells in cytokine production if these cells were not stimulated with DCs or IFN-γ/LPS. However, it showed inhibition when these T cells were activated with IFN-γ/LPS. When DCs were also present as allogeneic stimuli, the inhibitory effects of DMSO on T cells were abolished. While DMSO was previously shown to be potent in increasing GM-DC production of IL-12p70, this was not translated into increase of IFN-γ induction in these MLR experiments. A possible explanation is that its direct inhibitory effects on T cell production of IFN-γ neutralized its indirect stimulatory effects through DCs. Figure 3.13(b) shows the IL-17 production by CD4+ T cells. IFN-γ/LPS stimulated GMDCs co-cultured with CD4+ T cells had lesser IL-17 production compared to LPS activated GM-DCs co-cultured with CD4+ T cells. This is because IFN-γ would skew the immune response toward a Th1 type of immune response instead of a Th17 response which is usually characterized by the production of IL-17. IL-17 production was greatly suppressed when GM-DCs were co-cultured with CD4+ T cells in the presence of DMSO. From Figure 3.13(c), it was observed that IL-2 production level was very low for all experimental conditions though IFN-γ/LPS treatment increased the IL-2 production. DMSO did not seem to have any effect on the IL-2 production by CD4+ T cells in MLR. Therefore, DMSO did not have any significant effect on the 7 days mixed leukocyte reaction except that it was able to inhibit IL-17 production. 111 Supernatant was removed after seven days for MLR and the CD4+ T cells were restimulated with anti-CD3/anti-CD28 coated beads for another 3 days in fresh HI-RPMI. Supernatant was harvested and assayed for IFN-γ, IL-17 and IL-2 production. Figure 3.14(a) showed that upon re-stimulation, the addition of DMSO did not affect IFN-γ production for both GM-DCs-CD4+ T cells co-cultured and CD4+ T cells alone. DMSO decreases the IL-17 production levels for both GM-DC-CD4+ T cells co-culture and T cells alone (Figure 3.14(b)). IL-2 production by re-stimulated CD4+ T cells was not affected by the presence of DMSO in the co-culture system. These seems to further confirm that while DMSO was able to exert significant effect in modulating the cytokine profile of antigen presenting cells, DMSO does not affect the activation of CD4+ T cells. 112 (a) DMSO_DC MLR 12000 10000 Control LPS IFN-γ+LPS IFN-y Conc (pg/ml) 8000 6000 4000 2000 0 DC with DMSO 1% (b) DC DC + DMSO with T Cells DC DC + DMSO with T Cells DC with T Cells T Cells + DMSO T Cells IL-17 Conc (pg/ml) DMSO_DC MLR 3000 Control LPS IFN-γ+LPS 2500 2000 1500 1000 500 0 DC with DMSO 1% DC with T Cells T Cells + DMSO T Cells DMSO MLR (7 days) 400 (c) 350 Control LPS IFN-γ+LPS IL-2 Conc (pg/ml) 300 250 200 150 100 50 0 DC + DMSO DC alone DC + T Cells + DMSO DC + T Cells T Cells + DMSO T Cells Figure 3.13 DMSO Effect on T Cells Activation (a) DMSO did not induce any changes in IFN-γ production in a co-culture system (b) IL-17 production was not affected by DMSO but was decreased when IFN-γ was present (c) No significant differences in the IL-2 production by T Cells was observed. Data shown is a representative of 5 experiments. 113 (a) MLR DMSO (with Restimulation) 8000 7000 Control LPS IFN-γ+LPS IFN-y Conc (pg/ml) 6000 5000 4000 3000 2000 1000 0 DC + DMSO DC alone DC + T Cells + DMSO DC + T Cells T Cells + DMSO T Cells DC + T Cells + DMSO DC + T Cells T Cells + DMSO T Cells DC + T Cells + DMSO DC + T Cells (b) MLR DMSO (with Restimulation) 200 180 IL-17 Conc (pg/ml) 160 Control LPS IFN-γ+LPS 140 120 100 80 60 40 20 0 DC + DMSO (c) DC alone DMSO MLR (with Restimulation) 300 IL-2 Conc (pg/ml) 250 Control LPS IFN-γ+LPS 200 150 100 50 0 DC + DMSO DC alone T Cells + DMSO T Cells Figure 3.14 DMSO Effect on T Cells Activation (Re-stimulation) (a) IFN-γ production was not affected by DMSO after re-stimulation. (b) IL-17 production by T Cells was slightly decreased when cells were primed with DMSO. (c) IL-2 production by T Cells upon re-stimulation for 48 hr after 7 days MLR showed no differences. Data shown is a representative of 3 experiments. 114 3.13 DMSO Effect on Cytokine Production by CD4+ T Cells in Intracellular Cytokine Production The intracellular pool of cytokines (IFN-γ and IL-17) was studied in a system where CD4+ T cells were co-cultured with GM-DCs in the presence or absence of DMSO. After seven days of co-culture MLR, cells were washed and re-stimulated with ionomycin and treated with brefeldin A to prevent secretion of the cytokines produced. In Figure 3.15, DMSO increased the intracellular IFN-γ production by CD4+ T cells. However, DMSO did not increase the intracellular IFN-γ production when GM-DCs were co-cultured with CD4+ T cells in the presence of DMSO. In fact, DMSO decreased the intracellular IFN-γ production compared to GM-DCs co-cultured with CD4+ T cells without DMSO. Overall, DMSO did not affect the intracellular levels of IL-17 production. 115 Con T Cells T + DMSO 104 104 R1 T + DC 104 R1 R2 T + DC + DMSO 104 R2 R1 104 R2 R1 R2 R1 103 103 103 103 103 Alexa-647 Log 102 Alexa-647 Log 102 Alexa-647 Log 102 Alexa-647 Log 102 R2 Con 101 101 R3 100 100 101 102 PE Log 103 104 R1 100 100 101 R3 102 PE Log 103 100 100 104 R2 101 R4 101 R3 102 PE Log 103 R4 100 100 104 104 R1 R2 101 R4 104 104 101 R3 102 PE Log 103 104 R1 R2 101 R2 R1 103 103 Alexa-647 Log Alexa-647 Log 102 Alexa-647 Log 102 Alexa-647 Log 102 101 100 100 101 R3 R4 101 102 PE Log 103 104 104 100 100 101 102 PE Log R3 103 104 104 R1 R2 101 R4 100 100 102 PE Log R3 103 104 104 R1 R2 100 100 R2 101 102 PE Log R3 103 104 100 100 R2 R1 103 103 103 Alexa-647 Log 102 Alexa-647 Log 102 Alexa-647 Log 102 Alexa-647 Log 102 101 R3 100 100 R4 101 102 PE Log 101 R3 103 104 100 100 R4 101 102 PE Log 101 R3 103 104 100 100 R4 101 102 PE Log 104 100 100 103 104 R2 IFN-γ+LPS 101 R3 103 102 PE Log Alexa-647 Log 103 101 R4 101 104 R1 103 102 R2 LPS R4 104 R1 104 101 R4 101 103 Alexa-647 Log 103 102 R3 102 PE Log 104 R1 103 101 R4 100 100 104 103 102 IL-17 101 R3 R4 Alexa-647 Log 102 R4 101 102 PE Log R3 103 104 100 100 R4 101 102 PE Log 103 104 IFN-γ Figure 3.15 DMSO effect on IFN-γ and IL-17 production by CD4+ T cells (Intracellular cytokine staining). Intracellular staining of IFN-γ and IL-17 on GMDCs that were co-cultured with CD4+ T cells over seven days. Cells were primed with DMSO and stimulated with IFN-γ and LPS. DMSO has no effect on the production of IL-17 but increased the IFN-γ production only when GM-DCs were not stimulated with DMSO. The vertical axis shows the expression levels of IL-17 while expression levels of IFN-γ are represented on the horizontal axis. Data shown is a representative of 3 experiments. 116 CHAPTER 4 DISCUSSION 4.1 DMSO primes APCs towards a Type I Immune Response DMSO is commonly used in the cryo-preservation of cell lines despite its known toxicity. There had been various studies on how DMSO cryo-preservation affects the cellular function, morphology or characteristics. DMSO has been reported to possess various effects on the regulation of inflammation process. One study on human blood showed that DMSO inhibited IL-8 production at the transcriptional level and prevents neutrophil adhesion to the endothelium (DeForge et. al., 1992). DMSO was also shown to be responsible for the decrease of NF-κB activation and TNF-α bio-activity in macrophage-like cell line (Kelly et al., 1994). Besides, DMSO has been reported to inhibit TNF-α induced-IL-6 production in airway epithelial cells and lung fibroblast (Yoshida et. al., 1999), favouring a type one immunity. This study showed that DMSO primed-IFN-γ/LPS stimulated cells were skewed towards a Th1 type of immune response. Three different macrophage types and three different DC types were used for this investigation and with the exception of M-MF, the other five cell types responded with an increase in LPS-elicited IL-12p70 production. GM-DC had the most significant increase of IL-12p70 production as GM-DCs are known to be potent APCs in the activation of T cell responses. On the other hand, the LPS-elicited IL-10 production for all DMSO primed cells was suppressed significantly with the same exception of M-MF which retained its high IL-10 production. IFN-γ too was efficient in suppressing the LPS elicited IL-10 production. The suppression of IL10 production by IFN-γ had previously been reported by (Dieu-Nosjean et. al., 2001) through studies on langerhans cells development. The DMSO regulation of IL-12 117 production had been previously reported by studies on human myeloid leukemia cell line, HL-60 and peripheral blood mononuclear cells (Kubin et al., 1994). This study agrees that DMSO is able to regulate IL-12 production and further shows that this regulation is found on both macrophages and DCs with DCs demonstrating a stronger response to DMSO regulation of IL-12. Till date there are not many studies on the regulation of IL-12 by DMSO. In the study by (Kubin et. al., 1994), DMSO was also shown to regulate the production of TNF-α and IL-1β. IFN-γ is produced by NK cells and T cells during infections and acts as a potent activator of phagoycytes (Chan et. al., 1991) IFN-γ/LPS stimulates phagocytes to produce IL-12. DMSO priming before IFN-γ/LPS stimulation was found to further increase the LPS-elicited production of IL-12. DMSO alone was not able to induce any IL-12p70 production by macrophages or DCs though the study by Kubin showed that DMSO alone was able to induce IL-12p70 production in THP-1 and HL-60. The ability of DMSO to synergize with IFN-γ in elevating IL-12 production suggests that DMSO might be potent in skewing the immune response towards a Th1 type immune response. On the other hand, the suppression of IL-10 production by DMSO suggests the role of DMSO being a potent Th1 type immune response inducer as IL-10 possesses an antagonistic effect on IL-12 production (Cao et. al., 2002). This further indicates that DMSO is able to skew the APCs towards a Th1 type immune response phenotype. The ability of DMSO in favouring a Th1 type of immune response suggests the potential of DMSO as a drug for cancer treatment or as an adjuvant for vaccination. DMSO has already been studied for its possible use in cancer treatment as DMSO has excellent antioxidant properties (Salim et. al., 1992) and was found to be able to 118 increase the immune recognition of H-2 antigen in H-2 deficient murine lung carcinoma (Bahler and Lord, 1985). 4.2 DMSO effect is concentration dependent A titration of DMSO concentration from 0 to 2 % was performed to investigate if cells were sensitive to DMSO toxicity and the effect of DMSO concentration in regulating IL-12 production. Results showed that there was no cytokine production at 2 % DMSO concentration possibly due to DMSO toxicity at such high concentration resulting in cell death. However, it is worth noting that cell lines are commonly cryo-preserved at 10% DMSO which is much higher than the 2% DMSO used in this study. Yet, many studies had shown that cryo-preservation of cells at 10% DMSO did not result in significant cell death of damage to the cells (Birkeland, 1976; Strong et. al., 1975). The difference however, was that the cells were incubated at 37°C for 2 to 24 hours while cryopreserved cells are stored at sub-zero temperature in liquid nitrogen. DMSO priming was performed either 12 hours, 1.5 hours or just before the addition of LPS or IFNγ/LPS. There was no DMSO priming in the control cells. The LPS-elicited IL-12p70 production increased significantly upon 1% DMSO priming but other concentrations were not as effective in increasing the LPS-elicited IL-12p70 production. IL-12p70 production by IFN-γ/LPS stimulated DCs increased accordingly with the increasing DMSO concentrations with the exception of 2 % DMSO. The increasing concentration of DMSO corresponded to a gradual inhibition of IL-10 production by DCs. Hence, DMSO 1 % was selected to perform most of the subsequent studies. There were no significant differences in cytokine production by DCs for the different duration used in DMSO priming. This may be due to the supernatant harvested 24 hour later, at the saturation point of the cytokine production. Studies from other groups have also chosen 119 a similar range of DMSO concentration (1 – 1.25 %) for their studies (Kubin et. al., 1994; Trayner et. al., 1998) 4.3 DMSO does not affect cell survival DMSO toxicity has been a subject of interest to many because of the potential of DMSO as a pain reliever, anti-inflammatory drug and cancer treatment. DMSO toxicity has been debated many years. DMSO was claimed to be abe to penetrate the sin without causing much damage (Kolb et. al., 1967). However, DMSO toxicity has been observed in the study of inflammation, cell cycle, differentiation, lipid metabolism and apoptosis. Previous reports suggested that DMSO potentiates TNF-α-induced cytotoxicity in various human cell lines (McConnell et. al., 1999) and inihibits IL-8 production (DeForge et. al., 1992). DMSO had also been found to inhibit c-myc expression resulting in the arrest of cell cycle (Thomas et. al., 1995; Srinivas et. al., 1991; Sawai et. al., 1990). In addition, there are reports on DMSO toxicity in lipid metabolism especially in the metabolism and transport of cholesterol (Sakuragawa, 1995; Mackie et. al., 1989). DMSO is currently the standard agent for cryo-preservation of cells. (Bӧck et. al., 1995) reported that DMSO induced the release of K+, Ca2+ and lactate dehydrogenase (LDH) from the intracellular space into extracellular space while activating the complement system in cryo-preserved human platelets. LDH is an enzyme release by the cells upon cell death and is commonly used to measure the degree of cell death. In our study, there were no cytokine production by DCs when treated with 2% DMSO before LPS and IFN-γ challenge. This suggests the possibility that DMSO at 2 % concentration was too toxic for cell survival. This study showed that LDH release from DCs were significantly 120 higher at 2 % DMSO compared to the other lower concentrations but the LDH levels for 2 % DMSO was only 50% of the positive control where all cells were induced to apoptosis. This suggests that only 50% of DC cell death occurred at 2 % DMSO. Therefore, it appears that DCs are able to survive up to 2 % or maybe higher concentration of DMSO (Birkeland, 1976) though there is a possibility of compromise in the cellular or immunological functions. Hence, cells cryo-preserved at 10 % DMSO would most probably survive but whether its cellular functions remain healthy is uncertain. Much further studies will be required to ascertain the long term effects of DMSO. 4.4 DMSO does not affect cell morphology and DC maturation This study proceeded to investigate if DMSO affects cellular morphology or since it did not cause significant cell death while modulating the cytokine production in DCs. The addition of DMSO to monocyte derived–DCs did not induce any noticeable changes in morphology observed under microscope. Both im-DCs and IFN-γ/LPS activated DCs showed no difference in morphology whether with or without DMSO priming. This again shows that DMSO is a good cryo-preservation agent as it will not cause morphological changes to the cells and thus affect in vitro studies of cell culture. Changes in antigen expression had been observed on HL-60 cells differentiated with DMSO (Trayner et. al., 1998). HL-60 cells can be induced to differentiate into neutrophil-like cells by DMSO. Upon differentiation, changes in antigenic expression on HL-60 such as CD15, CD63 and CD71 were observed. The authors also noted that most changes in antigen expression do not correspond to morphological differentiation. Further investigation on the antigen expression on the monocyte-derived DCs upon 121 DMSO treatment was carried out since there were no morphological changes detected. Maturation markers CD80, CD83 and CD86 for DCs were included to ascertain if DMSO interferes with the maturation process of DCs. There were no detectable changes in the expression of CD14, CD1a and MHC II molecules for imDCs and IFNγ/LPS-activated DCs when primed with DMSO for 12 hours. The DCs were then activated with IFN-γ/LPS in the presence and absence of DMSO. There were no difference observable between DMSO primed and normal IFN-γ/LPS stimulated DCs. The expression levels of CD83, CD80 and CD86 remained the same. DMSO primed imDCs showed an up-regulation of CD83 expression in comparison to the control im-DCs. However, the up-regulation was not as significant compared to the IFN-γ/LPS activatedDCs. CD86 and CD80 expression on im-DCs were not affected by the presence of DMSO. Hence, it appears that DMSO alone is not sufficient to induce the maturation of imDCs. DMSO also does not appear to interfere with the maturation process of DCs induced by IFN-γ and LPS. Thus, DMSO is an effective and safe cryo-preservation agent as the DCs seem to be able to retain the morphology and antigen expression after DMSO treatment. 4.5 DMSO Effect on cells is reversible An experiment was carried out to determine if the continuous presence of DMSO is needed to observe the regulation of cytokine production in DCs and macrophages. Monocyte derived GM-DCs were primed with 1 % DMSO for 12 hours IFN-γ/LPS stimulation. After 12 hours of DMSO priming, the DCs were washed with HI-media to remove all traces of DMSO before stimulation with IFN-γ/LPS. The LPS-elicited IL12p70 production levels were significantly lower when DMSO was removed from the 122 cells before IFN-γ/LPS stimulation compared to the cells cultured in continuous presence of DMSO. In fact, the increase of LPS-elicited IL-12p70 production due to DMSO was marginal when DMSO was removed from the culture media before LPS challenge. The suppression of LPS-elicited IL-10 was absent when DMSO was removed from the culture media. Hence, the effect of DMSO on cytokine production is reversible upon the removal of DMSO from the cells. 4.6 DMSO primes GM-DC to favour a Th1 Type of Immune Response DMSO had been shown previously to be effective in regulation of IL-12 production in human myeloid leukemia cell lines and peripheral blood mononuclear cells (Kubin et. al., 1994). This study showed that pretreatment of cell lines HL-60, ML-3 and THP-1 with DMSO for 24 hours enhances LPS-elicited IL-12 production significantly. There have not been many reports on the regulation of IL-12 production by DMSO. Results obtained for this study showed that DMSO priming of macrophages and DCs was able to up-regulate the LPS-elicited IL-12 production to a significant level. More focus was placed on the investigation of DMSO effects in regulation of IL-12 production by DCs because DCs are specialized APCs to initiate a response from naïve CD4+ T cells. IL-12 is a heterodimeric cytokine consisting of a p40 and a p35 chain. More importantly, IL12 plays a critical role in regulating the balance between Th1 and Th2 immune responses as IL-12 is potent in inducing IFN-γ-secreting Th1 cells (Gately et. al., 1997; Heufler et. al., 1996). The increase of LPS-elicited IL-12 production indicates that DMSO could possibly skew the immune response towards a Th1 response through the activation of Th1 cells. Data showed that DMSO increased the IFN-γ/LPS-elicited production of IL-12p70, IL-12p40, and IL-23 by GM-DCs at the protein level. The corresponding RNA levels were also increased as shown by PCR. The three mRNA 123 transcripts of IL-12p40, IL-12p35 and IL-23p19, showed up-regulation when GM-DCs were primed with DMSO and subsequently stimulated with IFN-γ/LPS. One would expect to see an increase in the production of IFN-γ by CD4+ T cells when co-cultured with DMSO primed GM-DCs as DCs are potent in their IL-12p70 and IL12p40 production. Results of MLR indicate however, that there were no significant differences in IFN-γ production by the CD4+ T cells co-cultured with GM-DCs in the presence or absence of DMSO. Besides, DMSO does not affect the cytokine production by CD4+ T cells. The reason might be so that DMSO would not induce an adverse immune reaction in the host and hence DMSO might be considered as a potential adjuvant in vaccination studies. Nevertheless, It has been recently reported that high concentrations of DMSO do not affect T cells responses but when T cells are incubated with DMSO for more than 2 hr, the responses of T cells are compromised (Kloverpris et. al., 2010). IL-23 is another heterodimeric cytokine composed of the p40 chain and a p19 chain. IL23 has been suggested to be involved in the regulation of Th17 immunity and autoimmune disease (Mus et. al., 2010). The production of IL-23 was increased by the priming of DMSO for both PCR and ELISA results. This might be due to the increase of IL-12p40 subunit resulting in more formation of the heterodimeric cytokine. However, there seem to be an inhibition of IL-17 production by CD4+ T cells during coculture. Further investigations are needed to ascertain if DMSO has an inhibitory effect on Th17 immunity and if so, why would there be an increase in the production of IL-23 as IL-23 is an effector for Th17 immunity. One possible reason might be the usage of naïve CD4+ T cells instead of memory T cells in this study. IL-17 is usually produced 124 by memory T cells. The CD4+ T cells used in this study are mainly naïve T cell and hence might not be as potent in IL-17 production. Besides, the IL-23 receptor is mainly expressed on the memory T cells (Garrett et. al., 2008). Hence, the T cells in this study might not be responsive to the increase in IL-23 production. Further studies using both memory and naïve T cells should be done for a clearer idea of DMSO regulation of Th17 immunity in IL-17 production. 4.7 DMSO and Histone modifications The histone proteins of GM-DCs primed with DMSO and stimulated with IFN-γ/LPS were isolated for western blotting studies. This is to analyze if DMSO priming would result in any changes on the chromatin levels, and possibly identify if there is a connection between the chromatin modifications and the up-regulation of IL-12 production. A report of mice studies suggested that DMSO was able to up-regulate Dnmt3a expression and at the same time alter DNA methylation profiles on a genomewide level (Iwatani et. al., 2006). This study was performed on mouse embryoid body. The authors also reported phenotypic changes as an effect of DMSO treatment on mouse embryonic stem cells. DMSO has been reported to be an effective histone deacetylase and thus has been involved in the development of an anti-cancer drug known as vorinostat (Marks et. al., 2007). The western blots showed that DMSO seemed to increase the di-methylation of histone 3 on the residue lysine 9 (H3K9). Dimethylation of H3K9 is usually associated with the control of chromatin activities. Fission yeast experiments have shown that methylation of H3K4 and H3K9 are important in the maintenance of heterochromatin boundaries (Kouzarides, 2007). Silent heterochromatic state is usually associated with high levels 125 of methylated H3K9 and H3K27 while active heterochromatic state is associated with acetylated and methylated H3K4, H3K36 and H3K79. This might suggest that dimethylation of H3K9 might be involved in the regulation of IL-12 production. GM-DCs primed with DMSO alone showed higher levels of di-methylated H3K27 compared to control GM-DCs. This further indicates that DMSO indeed is able to exert an effect at the chromatin level, thus affecting the transcription activity in a cell. However, further studies are needed to ascertain the relation between chromatin modifications and the regulation of IL-12 or other cytokines. 4.8 Conclusion and Future work In conclusion, DMSO at high dosage does not appear to affect the cell survival, cell morphology and expression of surface markers in DCs. Neither is DMSO able to affect cell maturation. Nevertheless, DMSO is able to regulate the cytokine production of a cell, thus affecting the critical function of the cell (antigen presentation and T cell activation in this study) and the immune response. This has important implications should DMSO be approved as a drug. DMSO is a common solvent and is widely used for cryo-preservation due to its excellent ability in penetrating the cell membrane. The cellular function of a cell might be affected when DMSO is used for the cryopreservation though morphologically the cells would appear unchanged. It is worth noting that DMSO was shown to modify the dimethylation status of H3 lysine 9, suggesting that DMSO has the capability of inducing chromatin modifications. DMSO might also have the potential to function as an adjuvant since it is potent in the upregulation of IL-12 production while not affecting the T cell responses. However, further studies are needed to understand the mechanism behind the regulation of cytokines by DMSO. (Kieran et. al., 2004) reported that DMSO is able to regulate 126 TLR4-mediated activation of NF-γB and thus inhibit IL-8 production. Therefore, further studies suggested include the study of signaling mechanisms involved in the regulation of cytokines by DMSO, the investigation of histone regulation by DMSO and the potential of DMSO in eliciting a Th1 immune response in animal studies. The understanding of how DMSO affects the regulation of the immune responses will be critical in the evaluation of DMSO as a potential drug. 127 CHAPTER 5 REFERENCES Abbas, AK., Murphy, KM., Sher, A. (1996).Functional diversity of helper T lymphocytes. Nature. 383, 787-793 Abbas. AK., Lichtaman, AH., Pober, JS. (2000). Cells and tissue of the immune system. In cellular and molecular immunology. (Philadelphia: W.B.Saunders Company), 247249 Aderem, A., Underhill, DM. (1999). Mechanisms of phagocytosis in macrophages. Annu. Rev. Immunol. 17, 593-623 Aggarwal, S, Ghilardi, M., Xie, MH., de Sauvage, FJ., Gurney, AL. (2003). Interleukin23 promotes a distinct CD4 T cell activation state characterized by the production of interleukin-17. J. Biol. Chem. 278, 1910-1914 Akira, S., Uematsu, S., Takeguchi, O. (2006). Pathogen recpgnition and innate immunity. Cell 124, 783-801 Albert, ML., Sauter, B., Bhardwaj, J. (1998). Dendritic cells acquire antigen from apoptotic cells an dinduce class I-restricted CTLs. Nature 392, 86-89 Alexpoulou, L., Holt, AC., Medzhitov, R., Flavell, RA. (2001). Recognition of doublestranded RNA and activation of NF-kappaB by Toll-like receptor 3. Nature 413, 732738 Alexpoulou, L., Thomas, V., Schnare, M., Lobet, Y., Anguita, J., Schoen, RT., Medzhitov, R, Fikrig, E., Flavell, RA. (2002). Hyporesponsiveness to vaccination with Borrelia burgdoferi OspA in humans and TLR1- and TLR2-deficient mice. Nat. Med. 8, 878-884 Annunziato, F., Cosmi, L., Santarlasci, V., Maggi, L., Liotta, F., Mazzinghi, B., Parente, E., Fili, L., Ferri, S., Frosali, F., Giudici, F., Romagnani, P., Parronchi, P., Tonnelli, F., Maggi, E., Romagnani, S. (2007). Phenotypic and functional features of human Th17 cells. Anthony, R. M. et al. (2006). Memory TH2 cells induce alternatively activated macrophages to mediate protection against nematode parasites. Nature Med. 12, 955– 960 Arnold L, Henry A, Poron F, Baba-Amer Y, van Rooijen N, Plonquet A et al. (2007). Inflammatory monocytes recruited after skeletal muscle injury switch into antiinflammatory macrophages to support myogenesis. J Exp. Med. 204, 1057–1069. Asea, A., Rehli, M., Kabingu, E., Boch, JA., Bare, O., Auron, PE., Stevenson, MA., Calderwood, SK. (2002). Novel signal transduction pathway utilized by extracellular HSP70: Role of toll-like receptor (TLR2) 2 and TLR4. J. Biol. Chem. 202, 1131-1139 Auffray, C., Sieweke, MH., Geissmann, F. (2009). Blood Monocytes: development, heterogeneity, and relationship with dendritic cells. Annu. Rev. Immunol. 27, 669-692 128 Austyn, J. M. & Gordon, S. F4/80, a monoclonal antibody directed specifically against the mouse macrophage. (1981). Eur. J. Immunol. 11, 805–815 Baetselier, P. D. et al. (2001). Alternative versus classical macrophage activation during experimental African trypanosomosis. Int. J. Parasitol. 31, 575–587 Bahler, DW., Lord, EM. (1985). Enhanced immune recognition of H-2 antigen-deficient murine lung carcinoma cells following treatment with dimethyl sulfoxide. Cancer Res. 45, 6362-6365 Banchereau, J., Briere, F., Caux, C. et al., (2001). Immunobiology of dendritic cells. Annu. Rev. Immunol. 18, 767-811 Banchereau, J., Steinman, R.M. (1998). Dendritic cells and the control of immunity. Nature 392, 245-252 Barrat, FJ., Meeker, T., Gregorio, J., Chan, JH., Uematsu, S., Akira, S., Chang, B., Barton, GM., and Medzhitov, R. (2002). Control of adaptive immune responses by Tolllike receptors. Curr. Opin, Immunol. 14, 380-383 Basset, C., Holton, J., O”Mahony, R., Roitt, I. (2003). Innate immunity and pathogen host interaction. Vaccine 21, 12-23 Beautler, BA. (2009). TLRs and innate immunity. Blood 113, 1399-1407 Bell, D., Young, JW., Banchereau, J. (1999). Dendritic cells. Adv. Immunol. 72, 255324 Bennet, S., Breit, SN. (1994). Variables n the isolation and culture of human monocytes that are of particular relevance to studies of HIV. J. Leukoc. Biol. 56, 236-240 Berland, R., Fernandez, L., Kari, E., Han, JH., Lomakin, I., Akira, S., Wortis, HH., Hearney, JF., Ucci, AA., Imanishi-Kari, T. (2006). Toll-like receptor 7-dependent loss of B cell tolerance in pathogenice autoantibody knockin mice. Immunity 25. 429-440 Bieber, T., De La Salle, H., Wollemberg, A., Hakimi, J., Chizzonite, R., Ring, J., Hanau, D., de La Salle, C. (1992). Human epidermal Langerhans cells express the high affinity receptor for immunoglobulin E (FcεRI). J. Exp. Med. 175, 1285-1290 Birkeland, SA. (1976). The influence of different freezing procedures and different cryoprotective agents on the immunological capacity of frozen-stored lymphocytes. Cryobiology. 13, 442-447 Brinkmann, MM., Spooner, E., Hoebe, K., Beutler, B., Ploegh, HL., Kim, YM. (2007). The interaction between the ER membrane protein UNC92B and TLR2, 7, and 9 is crucial for TLR signaling. J. Cell. Biol. 177, 265-275 Burdin, N., Kronenberg, M. (1999). CD1-mediated immune responses to glycolipids. Curr. Opin. Immunol. 11, 326-331 129 Byrd-Leifer, CA., Block, EF., Takeda, K., Akira, S., Ding, A. (2001). The role of MyD88 and TLR4 in the LPS-mimetic activity of Taxol. Eur. J. Immunol. 31, 24482457 Camici, GG., Steffel, J., Akhmedov, A., Schafer, N., Baldinger, J., Schulz, U., Shojaati, K., Matter, CM., Yang, S., Lüscher, TF., Tanner, FC. (2006). Dimethyl sulfoxide inhibits tissue factor expression, thrombus formation, and vascular smooth muscle cell activation: a potential treatment strategy for drug-eluting stents. Circulation. 114, 15121521 Cao, S., Liu, J., Chesi, M., Bergsagel, PL., Ho, IC., Donelly, RP., Ma, X. (2002). Differential regulation of IL-12 and IL-10 gene expression in macrophages by the basic leucine zipper transcription factor c-Maf fibrosarcoma. J. Immunol. 169, 5715-5725 Cao, W., Lee, S.H., Lu, J. (2005). CD83 is preformed inside monocytes, macrophages and dendritic cells, but it is only stably expressed on activated dendritic cells. Biochem. J. 385, 85-93 Carter, LL., Murphy, KM. (1999) Lineage-specific requirement for signal transducer and activator of transcription (Stat)4 in interferon γ production from CD4(+) versus CD8(+) T cells. J. Exp. Med. 189, 1355-1360 Castellino, F., Zhong, G., Germain, RN. (1997). Antigen presentation by MHC class II molecules: invariant chain function, protein trafficking, and the molecular basis of diverse determinant capture. Hum. Immunol. 54, 159-169 Caux, C., Vanbervliet, B., Massacrier, C., Azuma, M., Okumura, K., Lanier, LL., Banchereau, J. (1996). CD34+ hematopoietic progenitors from human cord blood differentiate along two independent dendritic cell pathways in response to GMCSF+TNF alpha. J. Exp. Med. 184, 695-706 Cecchini MG, Dominguez MG, Mocci S, Wetterwald A, Telix R, Fleisch H, Chisholm O, Hofstetter W, Pollard JW, Stanley ER. (1994). Role of colony stimulating factor-1 in the establishment and regulation of tissue macrophages during postnatal development of the mouse. Development 120, 1357-1372 Cella, M., Sallusto, F., Lanzavecchia, A. (1997). Origin, maturation and antigen presenting function of dendritic cells. Curr. Opi. Immunol. 9, 10-16 Cerosaletti, KM., Blieden, TM., Harwell, LW., Welsh, KM., Frelinger, JG., Lord, EM. (1990). Alteration of the metastatic potential of line 1 lung carcinoma cells: opposite effects class I antigen induction by interferons versus DMSO or gene transfection. Cell Immunol. 127, 299-310 Chakrabarti R, Schutt CE. (2001). The enhancement of PCR amplification by low molecular-weight sulfones. Gene 274, 293–298 Chan, SH., Perussia, B., Gupta, JW., Kobayashi, M., Pospísil, M., Young, HA., Wolf, SF., Young, D., Clark, SC., Trinchieri, G. (1991). Induction of IFN-γ ptoduction by NK 130 cell stimulatory factor (NKSF): Characterization of the responder cells and synergy with other inducers. J. Exp. Med. 173, 869 Chen V, Yona S, Jung S. (2009). Origins and tissue-context-dependent fates of blood monocytes. Immunol. and Cell Biol. 87, 30-38 Chen, C. J. et al. (2007). Identification of a key pathway required for the sterile inflammatory response triggered by dying cells. Nature Med. 13, 851–856 Chen, Y., Thai, P., Zhao, YH., Ho, YS., DeSouza, MM., Wu, R. (2003). Stimulation of airway mucin gene expression by interleukin (IL)-17 through IL-6 paracrine/autocrine loop. J. Biol. Chem. 278, 17036-17043 Cho, SS., Bacon, M., Sudarshan, C., Rees, RC., Finbloom, D., Pine, R., O’Shea, JJ. (1996). Activation of STAT4 by IL-12 and IFN-α: evidence for the ligand-induced tyrosine and serine phosphorylation. J. Immunol. 157, 4781-4789 Christensen, SR., Shupe, J., Nickerson, K., Kashgarian, M., Flavell, RA., Shlomchik, MJ. (2006). Toll-like receptor 7 and TLR9 dictate autoantibody specificity and have opposing inflammatory and regulatory roles in a murine model of lupus. Immunity 25, 417-428 Clemens, MJ., Elia, A. (1997). The double-stranded RNA-dependent protein kinase PKR: structure and function. J. Interferon Cytokine Res. 17, 503-524 Constant, SL., Bottomly, K. (1997). Induction of Th1 and Th2 CD4+ T cell responses: the alternative approaches. Annu. Rev. Immunol. 15, 297-322 Cooper, MD and Alder, MN. (2006). The evolution of adaptive immune systems. Cell 124, 815-822 Creswell, P. (1996). Invariant chain structure and MHC class II function. Cell 84, 505507 Crofton RW, Diesselhoff-den Dulk MM, van Furth R. (1978). The origin, kinetics, and characteristics of the Kupffer cells in the normal steady state. J Exp. Med. 148, 1–17. Cua, DJ., Sherlock, J., Chen, Y., Murphy, CA., Joyce, B., Seymour, B., Lucian, L., To, W., Kwan, S., Churakova, T., Zurawski, S., Wiekowski, M., Lira, SA., Gorman, D., Kastelein, RA., Sedgwick, JD. (2003). Interleukin-23 rather than interleukin-12 is the critical cytokine for autoimmune inflammation of the brain. Nature. 421, 744-748 da Silva Correia, J., Soldau, K., Christen, U., Tobias, PS., Ulevitch RJ. (2001). Lipopolysaccharide is in close proximity to each of the proteins in its membrane receptor complex. Transfer from CD14 to TLR4 and MD-2. J. Biol. Chem. 276, 2112921135 De Becker, G., Moulin, V., Tielemans, F., De Mattia, F., Urbain, J., Leo, O., Moser, M. (1998). Regulation of T helper cell differentiation in vivo by soluble and membrane proteins provided by antigen-presenting cells. Eur. J. Immunol. 165, 1877-1881 131 de la Torre, JC. et. al., Dimethyl sulfoxide in the central nervous system trauma. Ann. NY Acad. Sci. 243, 362 DeForge, LE., Fantone, JC., Kenney, JS., Remick, DG. (1992). Oxygen radical scavengers selectively inhibit interleukin 8 production in human whole blood. J Clin. Invest. 90, 2123-2129 Deimann, W., Faihimi, HD. (1978). Peroxidase cytochemistry and ultrastructure of resident macrophgages in fetal rat liver. A developmental study. Dev. Biol. 66, 43-56 Diebold, SS., Kaiso, T., Hemmi, H., Akira, S., Reise e Sousa, C. (2004). Innate antiviral responses by means of TL7-mediated recognition of single-stranded RNA. Science 303, 1529-1531 Dieu, M.C., B. Vanbervliet, A. Vicari, J.M. Bridon, E. Oldham, S. Ait-Yahia, F. Briere, A. Zlotnik, S. Lebecque, C. Caux. (1998). Selective recruitment of immature and mature dendritic cells by distinct chemokines expressed in different anatomic sites. J. Exp. Med. 188, 373–86 Dieu-Nosjean, MC., Massacrier, C., Vanbervliet, B., Fridman, WH., Caux, C. (2001). IL-10 induces CCR6 expression during Langerhans cell development while IL-4 and IFN-gamma suppress it. J. Immunol. 167, 5594-5602 Dijkstra, C. D., Van Vliet, E., Dopp, E. A., van der Lelij, A. A. & Kraal, G. (1985). Marginal zone macrophages identified by a monoclonal antibody: characterization of immuno- and enzyme-histochemical properties and functional capacities. Immunology 55, 23–30 Divanovic, S., Trompette, A., Atabani, SF., Madan, R., Golenbock, DT., Visintin, A., Finberg, RW., Tarakhovsky, A., Vogel, SN., Belkaid, Y., Kurt-Jones, EA., Karp, CL. (2005). Negative regulation of Toll-like receptor 4 signaling by the Toll-like receptor homolog RP105. Nat. Immunol. 6, 571-578 Dunphy, GB., Chen, G., Webster, JM. (2007). The antioxidants dimethylsulfoxide a nd dimethylthiourea affect the immediate adhesion responses of larval haemocytes from 3 lepidopteran insect species. Can. J. Microbiol. 53, 1330-1347 Duramad, O., Coffman, RL. (2005). Nucleic acids of mammalian origin can act as endogenous ligands for Toll-like receptors and may promote systemic lupus erythematosus. J. Exp. Med. 202, 1131-1139 Edelmann, KH., Richardson-Burns, S., Alexpoulou, L., Tyler, KL., Flavell, RA., Oldstone, MB. (2004). Does Toll-like receptor 3 play a biological role in virus infections? Virology 322, 231-238 Edwards, J. P., Zhang, X., Frauwirth, K. A. & Mosser, D. M. (2006). Biochemical and functional characterization of three activated macrophage populations. J. Leukoc. Biol. 80, 1298–1307 132 Elenkov, I. J. (2004). Glucocorticoids and the Th1/Th2 balance. Ann. N. Y. Acad. Sci. 1024, 138–146 Fadok, V. A. et al. (1998). Macrophages that have ingested apoptotic cells in vitro inhibit proinflammatory cytokine production through autocrine/paracrine mechanisms involving TGF-β, PGE2, and PAF. J. Clin. Invest. 101, 890–898 Fanger, NA., Wardwell, K., Shen, L., Tedder, TF., Guyre, PM. (1996). Type I (CD64) and type II (CD32) Fc gamma receptor-mediated phagocytosis by human blood dendritic cells. J. Immunol. 157, 541-548 Farrar, JD., Asnagli, H., Murphy, KM. (2002). T helper subset development: roles of instruction, selection, and transcription. J. Clin. Invest. 109, 431-435 Fearon, DT., Locksley, RM. (1996). The instructive role of innate immunity in the acquired immune response. Science 272, 50-53 Filipe-Santos, O. et al. (2006). Inborn errors of IL-12/23- and IFN-γ-mediated immunity: molecular, cellular, and clinical features. Semin. Immunol. 18, 347–361 Finkelman, FD., Morris, SC., Orekhova, T., Mori, M., Donaldson, D., Reiner, SL., Reilly, NL., Schopf, L., Urban, JF Jr. (2000). Stat6 regulation of in vivo IL-4 responses. J. Immunol. 164, 2303-2310 Fitzgerald, K.A., Rowe, D.C., Barnes, B.J., Caffrey, D.R., Visintin, A., Latz, E., Monks, B., Pitha, P.M., and Golenbock, D.T. 2003. LPS-TLR4 signaling to IRF-3/7 and NFkappaB involves the toll adapters TRAM and TRIF. J. Exp. Med. 198, 1043-1055 Fraser, IP., Koziel, H., Ezekowitz, RAB. (1998). The serum mannose-binding protein and the macrophage mannose receptor are pattern recognition molecules that link innate adaptive immunity. Sem. Immunol. 10, 363-372 Gangloff, M., Weber, AN., GIbbard, RJ., Gay, NJ. (2003). Evolutionary relationships, but functional differences, between the Drosophila and human Toll-like receptor families. Biochem. Soc. Trans. 31, 659-663 Gangloff, M., Weber, AN., Gibbard, RJ., Gay, NJ. (2003). Evolutionary relationships, but functional differences, between the Drosophila and human Toll-like receptor families. Biochem. Soc. Trans. 31, 659-663 Garrett, S., Fitzgerald, MC., Sullivan, KE. (2008). LPS and Poly I:C induce chromatin modifications at a novel upstream region of the IL-23 promoter. Inflammtion. 31, 235246 Gasque, P. (2004). Complement: a unique innate immune sensor for danger signals. Mol. Immunol. 41, 1089-1098 Gately, MK., Renzetti, LM., Magram, J., Stern, S., Adorini, L., Gubler, U., Presky, DH. (1997). The interleukin-12-receptor system: role in normal and pathologic immune responses. Annu. Rev. Immunol. 16, 495-521 133 Gerber JS., Mosser, DM. (2001). Reversing lipopolysaccharide toxicity by ligating the macrophage Fcγ receptors. J. Immunol. 166, 6861-6868 Gewirtz, AT., Navas, TA., Lyons, S., Godowski, PJ., Madara, JL. (2001). Cutting edge: Bacterial flagelline activates basolaterally expressed TLR5 to induce epithelial proinflammatory gene expression. J. Immunol. 167, 1882-1885 Gordon S. (2007). The macrophages: Past, present and future. Eur. J. Immunol. 37, 9-17 Gordon, S., Taylor, PR. (2005) Monocyte and macrophage heterogeneity. Nat. Rev. Immunol. 5, 953-964 Granucci, F., Vizzardelli, C., Pavelka, N., Feau, S., Persico, M., Virzi, E., Rescigno, M., Moro, G., Ricciardi-Castagnoli, P. (2001). Inducible IL-2 production by dendritic cells revealed by global gene expression analysis. Nat. Immunol. 2, 883-888 Grouard, G., Rissoan MC., Filgueira, L., Durand I., Banchereau, J., Liu, YJ. (1997). The enigmatic plasmacytoid T cells develop into dendritic cells with interleukin (IL)-3 and CD40-ligand. J. Exp. Med. 185, 1101-1111 Guermonprez, P., Valladeau, J., Zitvogel, L., Thery ,C., Amigorena, S. (2002). Antigen presentation and T cell stimulation by dendritic cells. Annu. Rev. Immunol. 20, 621-667 Hammond-Kosack, KE., Jones, JD. (1997). Plant Disease Resistance Genes. Annu. Rev. Plant Physiol. Plant Mol. Biol. 48, 575-607 Happel, KI., Dubin, PJ., Zheng, M., Ghilardi, N., Lockhart, C., Quinton, IJ., Odden, AR., Shellito, JE., Bagby, GJ., Nelson, S., Kolls, JK. (2005). Divergent roles of IL-23 and IL-12 in host defense against Klebsiella pneumoniae J. Exp. Med. 202, 761-769 Hart, DN. (1997). Dendritic cells: unique leukocyte populations which control the primary immune response. Blood 90, 3245-3287 Hawn, TR., Verbon, A., Lettinga, KD., Zhao, LP., Li, SS., Laws, RJ., Skerett, SJ., Beutler, B., Schroeder, L., Nachman, A., Ozinsky, A., Smith, KD., Aderem, A. (2003). A common dominant TLR5 stop codon polymorphism abolishes flagellin signaling and is associated with susceptibility to legionnaires’ disease. J. Exp. Med. 198, 1563-1572 Hayashi, F., Smith, KD., Ozinsky, A., Hawn, TR., Yi, EC., Goodlett, DR., Eng, JK., Akira, S., Underhill, DM., Aderem, A. (2001). The innate immune response to bacterial flagellin is mediated by Toll-like receptor 5. Nature 410, 1099-1103 Heckert, RA., Elankumaran, S., Oshop, GL., Vakharia, VN. (2002). Vet. Immunol. Immunopathol. 89, 67-81 Heil, F., Hemmi, H., Hochrein, H., Ampenberger, F., Kirschning, C., Akira, S., Lipford, G., Wagner, H., Bauer, S. (2004). Species-species recognition of single-stranded RNA via Toll-like receptors 7 and 8. Science 303, 1526-1529 134 Hemmi, H., Takeuchi, O., Kawai, T., Kaisho, T., Sato, S., Sanjo, H., Matsumoto, M., Hoshino, K., Wagner, H., Takeda, K., Akira, S. (2000), A Toll-like receptor recognizes bacterial DNA. Nature 408, 740-745 Hemmi, H., Takeuchi, O., Sato, S., Yamamoto, M., Kaisho, T., Sanjo, H., Kawai, T., Hoshino, K., Takeda, K., Akira, S. (2004). The roles of two IkappaB kinase-related kinases in lipopolysaccharide and double stranded RNA signaling and viral infection. J. Exp. Med. 199, 1641-1650 Herschler, R., Jacob, S. (1980). The case of dimethyl sulfoxide. In: Lasagna, L. (Ed.), Controversies in Therapeutics. Philadelphia: W.B. Saunders. Hesse, M. et al. (2001). Differential regulation of nitric oxide synthase-2 and arginase-1 by type 1/type 2 cytokines in vivo: granulomatous pathology is shaped by the pattern of l arginine metabolism. J. Immunol. 167, 6533–6544 Heufler, C., Koch, F., Stanzl, U., Topar, G., Wysocka, M., Trinchieri, G., Enk, A., Steinman, RM., Romani, N., Schuler, G. (1996). Interleukin-12 is produced by dendritic cells and mediates T helper 1 development as well as interferon-γ production by T helper 1 cells. Eur. J. Immunol. 26, 659 Heyman, B. (2000). Regulation of antibody responses via antibodies, complement and Fc receptors. Annu. Rev. Immunol. 18, 709-737 Hoebe, K., Du, X., Georgel, P., Janssen, E., Tabeta, K., Kim, S.O., Goode, J., Lin, P., Mann, N., Mudd, S., Crozat, K., Sovath, S., Han, J., and Beutler, B. (2003). Identification of Lps2 as a key transducer of MyD88-independent TIR signalling. Nature 424, 743-748 Horng, T., Barton, GM., Flavell, RA., Medzhitov, R. (2002). The adaptor molecule TIRAP provides signaling specificity for Toll-like receptors. Bature 420, 329-333 Hoshino, K., Takeuchi, O., Kawai, T., Sanjo, H., Ogawa, T., Takeda, Y., Takeda, K., Akira, S. (1999). Cutting edge: Toll-like receptor 4 (TLR4)-deficient mice are hyporesponsice to lipopolysaccharide: Evidence for TLR4 as the LPS gene product. J. Immunol. 162, 3749-3752 Huang, W., Na, L., Fidel, PL., Schwarzenberger, P. (2004). Requirement of interleukin17A for systemic anti-Candida albicans host defense in mice. J. Infect. Dis. 190,624631 Ifergan I, Kébir H, Bernard M, Wosik K, Dodelet-Devillers A, Cayrol R, Arbour N, Prat Ifergan, I., Kébir, H., Bernard, M., Wosik, K., Dodelet-Devillers, A., Cayrol, R., Arbour, N., Prat, A. (2008). The blood-brain barrier induces differentiation of migrating monocytes into Th17-polarizing dendritic cells. Brain 131, 785-799 Imler, JL., and Hoffmann, JA. (2001). Toll receptors in innate immunity. Trends Cell. Biol. 11, 304-311 135 Inohara, N., Chamaillard, M. McDonald, C., and Nunez, G. 2005. NOD-LRR proteins: Role in host-microbial interactions and inflammatory disease. Annu. Rev. Biochem. 74, 355-383 Ito T, Amakawa R, Inaba M et al. (2004). Plasmacytoid dendritic cells regulate Th cell responses through OX40 ligand and type I IFNs. J. Immunol. 172, 4253-4259. Ito T, Yang M, Wang YH et al. (2007). Plasmacytoid dendritic cells prime IL-10producing T regulatory cells by inducible costimulator ligand. J. Exp. Med. 204, 105115. Ito, T., Inaba, M., Inaba, K., Toki, J., Sogo, S., Iguchi, T., Adachi, Y., Yamaguchi, K., Amakawa, R., Valladeau, J., et. al., (1999). A CD1a+/CD11c+ subset of human blood dendritic cells is a direct precursor Langerhans cells. J. Immunol. 163, 1409-1419 Iwasaki, A., Medzhitov, R. (2004). Toll-like receptor control of the adaptive immune responses. Nat. Immunol. 10, 987-995 Iwatani, M., Ikegami, K., Kremenska, Y., Hattori, N., Tanaka, S., Yagi, S., Shiota, K. (2006). Dimethyl sulfoxide has an impact on epigenetic profile in mouse embryoid body. 24, 2459-2556 Iwatani, M., Ikegami, K., Kremenska, Y., Hattori, N., Tanaka, S., Yagi, S., Shiota, K. (2006). Dimethyl sulfoxide has an impact on epigenetic profile in mouse embryoid body. Stem Cells. 24, 2549-2556 Janeway Jr., C.A., Medzhitov, R. (2002). Innate immune recognition. Annu. Rev. Immunol. 20, 197-216 Janeway, CA Jr. (1992). The immune system evolved to discriminate infectious nonself from noninfectious self. Immunol. Today 13, 11-16 Janeway, CA Jr., Medzhitov, R. (1998). Introduction: the role of innate immunity in the adaptive immune response. Semin. Immunol. 10, 349-350 Jiang, Q., Akashi, S., Miyake, K., Petty, HR. (2000). Lipopolysaccharide induces physical proximity between CD14 and toll-like receptor 4 (TLR4) prior to nuclear translocation of NF-kappa B. J. Immunol. 165, 3541-3544 Jiang, W., Swiggard, WJ., Heuffer, C., Peng, M., Mirza, A., Steinman, RM., Nussenzweig, MC. (1995). The receptor DEC-205 expressed by dendritic cells and thymic epitelial cells is involved in antigen processing. Nature 375, 151-155 Jin, MS., Kim, SE., Heo, JY., Lee, ME., Kim, HM., Paik, SG., Lee, H., Lee, JO. (2007). Crystal structure of the TLR1-TLR2 heterodimer induced by binding of a tri-acetylated lipeptide. Cell 130, 1071-1082 Jin, MS., Lee, LO. (2008). Structures of the Toll-like receptor famliy and its ligand complexes. Immunity 29, 182-191 136 Jones, AL., Millar, JL. (1989). Growth factors in haemopoiesis. In clinical haematology: Aplastic Anaemia, Gordon-Smith EC, ed. (London: Bailliere Tindall). Kalinski, P., Schuitemaker, JH., Hilkens, CM., Wierenga, CA., Kapsenberg, ML. (1999). Final maturation of dendritic cells is associated with impaired responsiveness to IFN-γ and to bacterial IL-12 inducers’ decreased ability of mature dendritic cells to produce IL-12 during the interaction with Th cells. J. Immunol. 162, 3231-3236 Kawai, T., Adachi, O., Ogawa, T., Takeda, K., Akira, S. (1999). Unresponsivenss of Myd88-deficient mice to endotoxin. Immunity 11, 115-122 Keleman, E., Calvo, W., Flieder, TM. (1979). Atlas of human hemopoietic development. (Berlin-Heidelberg: Springer-Verlag). Kelly, KA., Hill, MR., Youkhana, K., Wanker, F., Gimble, JM. (1994). Dimethyl sulfoxide modulates NF-κB and cytokine activation in lipopolysaccharide-treated murine macrophages. Infect. Immun. 62, 3122-3128 Kieran, AR., Michael, FS., Michael KS., Peter, BE. (2004). Reactive oxygen and nitrogen species differentially regulat Toll-like receptor 4-mediated activation of NF-κB and interleukin-8 expression. Infect. Immun. 72, 2123-2130 Kim, HM., Park, BS., Kim, JI., Kim, SE., Lee, J., Oh, SC., Enkhbayar, P., Matshushima, N., Lee, H., Lee, JO. (2007). Crystal structure of the TLR4-MD-2 complex with bound endotoxin antagonist Eritoran. Cell 130, 906-917 Kim, YM., Brinkmann, MM., Paquet, ME., Ploegh, HL. (2008). UNC93B1 delivers nucleotide-sensing Toll-like receptors to endolysosomes. Nature 452, 234-238 Kitamura, H., Iwakabe, K., Yahata, T., Nishimura, S., Ohta, A., Ohmi, Y., Sato, M., Takeda, K., Okumura, K., Van Kaer, L., Kawano, T., Taniguchi, M., Nishimura, T. (1999). The natural killer T (NKT) cell ligand α-galactosylceramide demonstrates its immunpotentiating effect by inducing interleukin (IL)-12 production by dendritic cells and IL-12 receptor expression of NKT cells, J. Exp. Med. 189, 1121-1128 Kleijmeer, MJ., Ossevoort, MA., van Veen, CJ., van Hellemond, JJ., Neefjes, JJ., Kast, WM., Melief, CJ., Geuze, HJ. (1995). MHC class II compartments and the kinetics of antigen presentation in activate dmouse spleen dendritic cells. J. Immunol. 154, 57155724 Kloverpris, H., Fomsgaard, A., Handley, A., Ackland , J., Sullivan, M., Goulder, P. (2010). Dimethyl sulfoxide (DMSO) exposure to human peripheral blood mononuclear cells (PBMCs) abolish T cell responses only in high concentrations and following coincubation for more than two hours. J. Immunol. Methods. Epub ahead of print. Kolb, KH., Jaenicke, G., Kramer, M., Schulze, PE. (1967). Absorption, distribution, and elimination of labeled dimethyl sulfoxide in man and animals. Annu. NY Acad. Sci. 141,085-95 137 Kono, H. & Rock, K. L. (2008). How dying cells alert the immune system to danger. Nature Rev. Immunol. 8, 279–289 Kovacsivics-Bankowski, M., and Rock, KL. (1995). A phagosome-to-cytosol pathway for exogenous antigens presented on MHC class I molecules. Science 267, 243-246 Kovacsivics-Bankowski, M., Clark, K., Benacerraf, B., Rock, KL. (1993). Efficient major histocompatibility complex class I presentation of exogenous antigen upon phagocytosis by macrophages. Proc. Natl. Acad. Sci. USA 90, 4942-4946 Kraal, G. & Janse, M. (1986). Marginal metallophilic cells of the mouse spleen identified by a monoclonal antibody. Immunology 58, 665–669 Kubin, M., Chow, J.M., Trinchieri, G. (1994). Differential Regulation of Interleukin-l2 (IL-l2), Tumor Necrosis Factor cy,and IL-1p Production in Human Myeloid Leukemia Cell Lines and Peripheral Blood Mononuclear Cells. Blood. 83, 1847-1855 Kumar, H., Kawai, T., Akira, S. (2009). Pathogen recognition in the innate immune response. Biochem. J. 420, 1-16 Kumar, M., Carmichael, GG. (1998). Antisense RNA: function and fate of duplex RNA in cells of higher eukaryotes. Microbiol Mol. Rev. 62, 1415-1434 Kurt-Jones, EA., Popova, L., Kwinn, L., Haynes, LM., Jones, LP., Tripp, RA., Walsh, EE., Freeman, MW., Golenbock, DT., Anderson, LJ., Finberg, RW. (2000). Pattern recognition receptors TLR4 and CD14 mediate response to respiratory syncytial virus. Nat. Immunol. 1, 398-401 Kvakovszky G, McKim AS, Moore J. (2007). A Review of Microelectronic Manufacturing Applications Using DMSO-Based Chemistries. ECS Transactions 11, 227–234. Landsman L, Varol C, Jung S. (2007) Distinct differentiation potential of blood monocyte subsets in the lung. J Immunol. 178, 2000–2007. Langerhans, P. (1868). Ueber die Nerven der menschlichen Haut. Archiv fur pathologische Anatomie und Physiologie, und fur Klinische Medicine. Berlin. 44, 325337 Langrish, C. L. et al. (2005). IL-23 drives a pathogenic T cell population that induces autoimmune inflammation. J. Exp. Med. 201, 233–240 Langrish, CL., Chen, Y., Blumenschein, WM., Mattson, J., Basham, B., Sedgwick, JD., McClanahan, T., Kastelein, RA., Cua, DJ. (2005). IL-23 drives a pathogenic T cell population that induces autoimmune inflammation. J. Exp. Med. 201, 233-240 Lanzavecchia, A. (1996). Mechanisms of antigen uptake for presentation. Curr. Opin. Immunol. 8, 348-354 Lau, CM., Broughton, C., Tabor, AS., Akira, S., Flavell, RA., Mamula, MJ., Christensen, SR., Shlomchik, MJ., Viglianti, GA., Rifkin, IR., Marshak-Rothstein, A. 138 (2002) Chromatin-IgG complexes activate B cells by dual engagement of IgM and Tolllike receptors. Nature 416, 603-607 Laura, ED., Angela, MP., Eiji, T., John, K., Laurence, AB., Daniel, GR. (1993). Regulation of interleukin 8 gene expression by oxidant stress. J. Biol. Chem. 268, 25568-25576 Leadbetter, EA., Rifkin, IR., Hohlbaum, AM., Beaudette, BC., Shlomchik, MJ., Marshak-Rothstein, A. (2002). Chromatin-IgG complexes activate B cells by dual engagement of IgM and Toll-like receptors. Nature 416, 603-607 Lin, K., Jacek, T., and Jacek, R. (2009). Dendritic cells heterogeneity and its role in cancer immunity. J. Cancer Res. Ther. 2, 35-40 Liu, L., Botos, I., Wang, Y., Leonard, JN., Shiloach, J., Segal, DM., Davies, DR. (2008). Structural basis of Toll-likd receptor 3 signaling with double-stranded RNA. Science 320, 379-381 Liu, YJ. (2001). Dendritic cell subsets and lineages, and their functions in innate and adaptive immunity. Cell 106, 259-262 Liu, YJ. (2001). Dendritic Celll Subsets and their Lineages, and their functions in innate and adaptive immunity. Cell 106, 259-262 Lockie, LM., Norcress, B. (1967). A clinical study on the effects of dimethyl sulfoxide in 103 patients with acute and chronic musculoskeletal injuries and inflammation. Annu. NY Acad. Sci. 141, 599-602 Loke, P. et al. (2007). Alternative activation is an innate response to injury that requires CD4+ T cells to be sustained during chronic infection. J. Immunol. 179, 3926–3936 Lu, J., The, C., Kishore, U., Reid, KB. (2002). Collectins and ficollins: sugar pattern recognition molecules of the mammalian innate immune system. Biochim. Biophys. Acta 1572, 387-400 Lumeng, C. N., Bodzin, J. L. & Saltiel, A. R. (2007). Obesity induces a phenotypic switch in adipose tissue macrophage polarization. J. Clin. Invest. 117, 175–184 Lund, JM., Alexpoulou, L., Sato, A., Karow, M., Adams, NC., Gale, NW., Iwasaki, A., Flavell, RA. (2004). Recognition of single-stranded RNA viruses by Toll-like receptor 7. Proc. Natl. Acad. Sci. USA. 101, 5598-5603 Lutz, M., Schuler, G. (2002). Immature, semi-mature and fully mature dendritic cells: which signals induce tolerance or immunity? Trends Immunol. 23, 445 Mackie, EJB., Dwyer, NK., Vanier, MT., Sokol, J., Merrick, HF., Comly, ME., Argoff, CE., Pentchev, PG. (1989). Type C Niemann-Pick didease: dimethyl sulfoxide moderates abnormal LDL-cholesterol processing in mutant fibroblasts. Biochim Biophys Acta 1006, 219-226 139 Mahalingam, S., Karupiah, G. (1999). Chomokines and chemokine receptors in infectious diseases. Immunol. Cell Biol. 77, 469-475 Market, E., Papavasiliou, FN. (Primer). V(D)J recombination and the evolution of the adaptive immune system. PLoS Biology 1, 24-27 Marks, PA., Breslow, R. (2007). Dimethyl sulfoxide to vorinostat: development of this histone deacetylase inhibitor as an anticancer drug. Nat. Biotech. 25, 84-90 Marshal-Rothstein, A. (2006). Toll-like receptors in systemic autoimmune disease. Nat. Rev. Immunol. 6, 823-835 Matsumoto, J. (1967). Clinical trials of dimethyl sulfoxide in rheumatoid arthritis patients in Japan. Ann. NY Acad. Sci. 141, 560-568 McConnell, EJ., Wagoner, MJ., Keenan, CE., Taess, DG. (1999). Oxygen radical scavengers inhibit interleukin 8 production in human whole blood. Biochem. Pharmacol. 57, 39-44 Medzhitov, R. (2007). Recognition of microorganisms and activation of the immune response. Nature 449, 819-826 Medzhitov, R., and Janeway, CR Jr. (1997). Innate immunity: impact on the adaptive immune response. Curr. Opin. Immunol. 9, 4-9 Medzhitov, R., Janeway Jr., C. (2000). Innate immune recognition: mechanisms and pathways. Immunol. Rev. 173, 89-97 Medzhitov, R., Janeway Jr., C.A. (1997). Innate immunity: the virtues of a nonclonal system of recognition. Cell 91, 295-298 Medzhitov, R., Janeway Jr., C.A. (1998). Innate immune recognition and control of adaptive immune responses. Sem. Immunol. 10, 351-353 Metcalf, D. (1971). Transformation of granulocytes to macrophages in bone marrow colonies in vitro. J. Cell Physiol. 77, 277-280 Metcalf, D. (1990). The colony stimulating factors: discovery, development and clinical applications. In Accomplishments in cancer research, Fortner, JG and Fhoads, JE, eds. (J.B. Lippincott company), 121-142 Miles, S. A., Conrad, S. M., Alves, R. G., Jeronimo, S. M. & Mosser, D. M. (2005). A role for IgG immune complexes during infection with the intracellular pathogen Leishmania. J. Exp. Med. 201, 747–754 Moser, M., Murphy, KM. (2000). Dendritic cell regulation of Th1-Th2 development. Nat. Immunol. 1, 199-205 Mosser, D. M. (2003). The many faces of macrophage activation. J. Leukoc. Biol. 73, 209–212 140 Mosser, DM and Edwards, JP. (2008). Exploring the full spectrum of macrophage activation. Nat. Rev. Immunol. 8, 958-969 Mudde, GC., Hansel, TT., Von Reijisen, FC., Osterhoff, BF., Brujinzeel-Koomen, CA. (1990). IgE: an immunoglobulin specialized in antigen capture? Immunol. Today 11, 440-443 Munitz, A., Brandt, E. B., Mingler, M., Finkelman, F. D. & Rothenberg, M. E. (2008). Distinct roles for IL-13 and IL-4 via IL-13 receptor α1 and the type II IL-4 receptor in asthma pathogenesis. Proc. Natl. Acad. Sci. USA 105, 7240-7245 Mus, AM., Cornelissen, F., Asmawidjaja, PS., van Hamburg, JP., Boon, L., Hendricks, LW., Lubberts, E. (2010). IL-23 promotes Th17 differentiation by inhibiting T-bet and FoxP3 and is required for IL-22 but not IL-21 in autoimmune experimental arthritis. Arthritis Rheum. 9999, 1-28 Nagai, Y., Akashi, S., Nagafuku, M., Ogata, M., Iwakura, Y., Akira, S., Kitamura, T., Kosugi, A., Kimoto, M., Miyake, K. (2002). Essential role of MD-2 in LPS responsiveness and TLR4 distribution. Nat Immunol. 3, 667-672 Nagai, Y., Shimazu, R., Ogata, H., Akashi, S., Sudo, K., Yamasaki, H., Hayashi, S., Iwakura, Y., Kimoto, M., Miyake, K. (2002). Requirement for MD-1 in cell surface expression of RP105/CD180 and B cell responsivenss to lipopolysaccharide. Blood 99, 1699-1705 Nakata K, Akagawa KS, Fukayama M, Hayashi y, Kodokura M, Tukunaga T. (1991). Granulocyte-macrophage colony-stimulating factor promotes the proliferation of human alveolar macrophages in vitro. J. Immunol. 147, 1266-1272 Ngo, V.N., H.L. Tang, J.G. Cyster. (1998). Epstein-Barr virus-induced molecule 1 ligand chemokine is expressed by dendritic cells in lymphoid tissues and strongly attracts naive T cells and activated B cells. J. Exp. Med. 188,181–91 Nijman, HW., Kleijmeer, MJ., Ossevort, MA., Oorschot, VM., Vierboom, MP., van de Keur, M., Kenemans, P., Kast, WM., Geuze, HJ., Melief, CJ. (1995). Antigen capture and major histocompatibility class II compartments of freshly isolated and cultured human blood dendritic cells. J. Exp. Med. 182, 163-174 Norbury, CC., Chambers, BJ., Prescott, AR., Ljunggren, HG., Watts, C. (1997). Constitutive macropinocytosis allows TAP-dependent major histocompatibility complex class I presentation of exogenous soluble antigen by bone marrow-derived dendritic cells. Eur. J. Immunol. 27, 280-288 O’Shea, J. J. & Murray, P. J. (2008). Cytokine signaling modules in inflammatory responses. Immunity 28, 477–487 Ohashi, K., Burkart, K., Flohe, S., and Kolh, H. (2000). Cutting edge: Heat shock protein 60 is a putative endogenous ligand of the toll-like receptor-4 complex. J. Immunol. 164, 558-561 141 Okamura, Y., Watari, M., Jerud, ES., Young, DW., Ishizaka, ST., Rose, J., Chow, JC., Strauss, JF.3rd. (2001). The extra domain A of fibronectin activates Toll-like receptor 4. J. Biol. Chem. 276, 10229-10233 Ouyang, W., Löhning, M., Gao, Z., Assenmacher, M., Ranganath, S, Radbruch, A., Murphy, KM. (2000). Stat6-independent GATA-3 autoactivation directs IL-4independent Th2 development and commitment. Immunity 12, 27-37 Ouyang, W., Raganath, S., Weindel, K., Bhattacharya, D., Murphy, TL., Sha, WC., Murphy, KM. (1998). Inhibition of Th1 development mediated by GATA-3 through an IL-4-independent mechanism. Immunity 9, 745-755 Ozinsky, A., Underhill, DM., Fontenot, JD., Hajjar, AM., Smith, KD., Wilson, CB., Schroeder, L., Aderem, A. (2000). The repertoire for pattern recognition of pathogens by the innate immune system is defined by cooperation between Toll-like receptors. Proc. Natl. Acad, Sci, USA 97, 13766-13771 Palm, NW., Medzhitov, R. (2009). Pattern recognition receptors and control of adaptive immunity. Immunol. Rev. 227, 221- 233 Pamer, E., Cresswell, P. (1998). Mechanisms of MHC class I-restricted antigen processing. Annu. Rev. Immunol. 16, 323-358 Park, BS., Song, DH., Kim, HM., Choi, BS., Lee, H., Lee, JO. (2009). The structural basis of lipopolysaccharide recognition by the TLR4-MD-2 complex. Nature 458, 11911195 Park, J. S. et al. (2004). Involvement of Toll-like receptors 2 and 4 in cellular activation by high mobility group box 1 protein. J. Biol. Chem. 279, 7370–7377 Pelus, LM., Broxmeyer, HE., Kurland, JI., Moore, MA. (1979). Regulation of macrophage and granulocyte proliferation. Specificities of prostaglandin E and lactoferrin. J. Exp. Med. 150, 277-292 Peng, G., Guo, Z., Kiniwa, Y., Voo, KS., Peng, W., Fu, T., Wang, DY., Li, Y., Wang, HY., Wang, RF. (2005). Toll-like receptor 8-mediated reversal of CD4+ regulatory T cell function. Science 309, 1380-1384 Percelli, SA., Modlin, RL. (1999). The CD1 system: antigen-presenting molecules for T cell recognition of lipids and glycolipids. Annu. Rev. Immunol. 17, 297-329 Perussia, B., Dayton, ET., Fanning, V., Thiagarajan, P., Hoxie, J., Trinchieri, G. (1983). Immune interferon and leukocyte-conditioned medium induce normal and leukemic myeloid cells to differentiate along the monocytic pathway. J. Exp. Med. 158, 20582080 Pfeifer, JD., Wick, MJ., Roberts, RL., Findlay, K., Normark, SJ., Harding, CV. (1993). Phagocytic processing of bacterial antigens for class I MHC presentation to T cells. Nature 361, 359-362 142 Pierre, P., Mellman, I. (1998). Developmental regulation of invariant chain proteolysis controls MHC class II trafficking in mouse dendritic cells. Cell 93, 1135-1145 Platt, N., da Silva, RP., Gordon, S. (1998). Recognizing death: the phagocytosis of apoptotic cells. Trends Biol. 8, 265-372 Pollard, J. W. (2008). Macrophages define the invasive microenvironment in breast cancer. J. Leukoc. Biol. 84, 623–630 Poltorak, A., He, X., Smirnova, I., Liu, MY., Van Huffel, C., Du, X., Birdwell, D., Alejos, E., Silva, M., Galanos, C., Freudenberg, M., Ricciardi-Castagnoli, P., Layton, B., Beutler, B. (1998). Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in Tlr4 gene. Science 282, 2085-2088 Radstake, TRDJ., van Lent, PLEM., Pesman, GJ., Blom, AB., Sweep, FGJ., Rönnelid, J., Adema, GJ., Barrera, P., van den Berg, WB. (2004). High production of proinflammatory and Th1 cytokines by dendritic cells from patients with rheumatoid arthritis, and downregulation upon FcγR triggering. Ann. Rheum. 63, 696-702 Randolph, G. J., Beaulieu, S., Lebecque, S., Steinman, R. M. & Muller, W. A. (1998). Differentiation of monocytes into dendritic cells in a model of transendothelial trafficking. Science 282, 480–483 Randolph, G. J., Sanchez-Schmitz, G., Liebman, R. M. & Schakel, K. (2002). The CD16+ (FcγRIII+) subset of human monocytes preferentially becomes migratory dendritic cells in a model tissue setting. J. Exp. Med. 196, 517–527 Reis de Sousa, C., Stahl, PD., Austyn, JM. (1993). Phagocytosis of antigens by Langerhans cells in vitro. J. Exp. Med. 178, 509-519 Rescigno, M., Borrow, P. (2001). The host-pathogen interaction: new themes from dendritic cell biology. Cell 106, 267-270 Rincón, M., Anguita, J., Nakamura, T., Fikrig, E., Flavell, RA. (1997). Interleukin (IL)6 directs the differentiation of IL-4 producing CD4+ T cells. J. Exp. Med. 185, 461-469 Rissoan, MC., Soumelis, V., Kadowaki, N., Grouard, G., Briere, F., de Waal Malefyt R., Liu, YJ. (2000). Reciprocal control of T helper cell and dendritic cell differentiation. Science. 283, 1183-1186 Rissoan, MC., Soumelis, V., Kadowaki, N., Grouard, G., Briere, F., de Waal Malefyt, R., Liu, YJ. (1999). Reciprocal control of T helper cell and dendritic cell differentiation. Science. 283, 1183-1186 Rock, KL., Goldbert, AL. (1999). Degradation of cell proteins and the generation of MHC class I-presented peptides. Annu. Rev. Immunol 17, 739-779 Rodriguez-Palmero, M., Hara, T., Thumbs, A., Hunig, T. (1999). Triggering of T cell proliferation through CD28 induces GATA-3 and promotes T helper type 2 differentiation in vitro and in vivo. Eur. J. Immunol. 29, 3914-3924 143 Romagnani, S. (1997). The Th1/Th2 paradigm. Immunol. Today. 18, 263-266 Romieu-Mourez, R. et al. (2006). Distinct roles for IFN regulatory factor (IRF)-3 and IRF-7 in the activationof antitumor properties of human macrophages. Cancer Res. 66, 10576–10585 Roncarolo, MG., Levings, MK., Traversari, C. (2001). Differentiation of T regulatory cells by immature dendritic cells. J. Exp. Med. 193, 5-9 Rossi, M. and Young, JW. (2005). Human dendritic cells/; potent antigen-presenting cells at the crossroads of innate and adaptive immunity. J. Immunol. 175, 1373-1381 Rovere, P., Zimmerman, VS., Forquet, F., Demandolx, D., Trucy, J., Ricardi-Castanogli, P., Davoust, J. (1998). Dendritic cell maturation and antigen presentation in the absence of invariant chain. Proc. Natl. Acad. Sci. USA 95, 1067-1072 Saegusa, S., Totsuka, M., Kaminogawa, S., Hosoi, T. (2009). Saccharomyces cerevisiae and Candida albicans stimulate cytokine secretion from human neutrophil-like HL-60 cells differentiated with retinoic acid or dimethylsulfoxide. Biosci. Biotechnol. Biochem. 73, 2600-2608 Sakuragawa, N. (1995). Medicinal therapy for lysosomal disease. Nippon Rinsho 53, 3072-3076 Salim, AS. (1992). Removing oxygen-derived free radicals delays hepatic metastases and prolongs survival in colonic cancer. Oncology. 49, 58-62 Salim, AS. (1992). Role of oxygen-derived free radical scavengers in the management of recurrent attacks of ulcerative colitis: A new approach. J. Lab Clin. Med. 119, 740747 Sallusto F, Lanzavecchia A. (1994). Efficient presentation of soluble antigen by cultured human dendritic cells is maintained by granulocyte/macrophage colonystimulating factor plus interleukin 4 and downregulated by tumor necrosis factor alpha. J Exp. Med. 179, 1109–1118. Sallusto, F. and Lanzavecchia, A. (1994). Efficient presentation of soluble antigen by cultured human dendritic cells is maintained by granulocyte/macrophage colonystimulating factor plus interleukin 4 and downregulated by tumor necrosis factor α. J. Exp. Med. 179, 1109–1118 Sallusto, F., Cella, M., Daniel, C., Lanzavecchia, A. (1995). Dendritic cells use macropinocytosis and the mannose receptor to concentrate macromolecules in the major histocompatibility complex class II compartment: downregulation by cytokines and bacterial products. J. Exp. Med. 182, 389-400 Sallusto, F., Lanzavecchia, A. (1994). Efficient presentation of soluble antigen by cultured human dendritic cells in maintained by granulocyte/macrophage colonystimulating factor plus interleukin 4 and downregulated by tumor necrosis factor alpha. J. Exp. Med. 179, 1109-1118 144 Sallusto, F., P. Schaerli, P. Loetscher, C. Schaniel, D. Lenig, C.R. Mackay, S. Qin, A. Lanzavecchia. (1998). Rapid and coordinated switch in chemokine receptor expression during dendritic cell maturation. Eur. J. Immunol. 28, 2760–69 Sanchez-Torres, C., Garcia-Romo, G. S., Cornejo-Cortes, M. A., Rivas-Carvalho, A. and Sanchez-Schmitz, G. (2001). CD16+ and CD16– human blood monocyte subsets differentiate in vitro to dendritic cells with different abilities to stimulate CD4+ T cells. Int. Immunol. 13, 1571–1581 Sánchez-Torres, C., García-Romo, GS., Cornejo-Cortés, MA., Rivas-Carvalho, A., Sánchez-Schmitz, G. (2001). CD16+ and CD16- human blood monocyte subsets differentiate in vitro to dendritic cells with different abilities to stimulate CD4+ T cells. Int. Immunol. 13, 1571-1581 Santos NC, Prieto MJE, Morna-Gomes A, Betbeder D, Castanho. MARB. (1997)Structural characterization (shape and dimensions) and stability of polysaccharide/lipid nanoparticles. Biopolymers. 41, 511–20. Santos, NC., Figueira-Coelho, J., Martins-Silva, J., Saldanha, C. (2003). Multidisciplinary utilization of dimethyl sulfoxide:pharmacological, cellular, and molecular aspects. Biochem. Pharmacol. 65, 1035-1041 Sato, K., and Fujita, S. (2007). Dendritic Cells-Nature and Classification. Allergology International 56, 183-191 Sawai, M., Takase, K., Teraoka, H., Tsukada, K. (1990). Reversible G1 arrest in the cell cycle of human lymphoid cell lines by dimethyl sulfoxide. Exp. Cell. Res. 187, 4-10 Scherbel., AL., McCormack LJ., Layle, JK. (1967). Further observations on the effects of dimethyl sulfoxide in patients with generalized scleroderma (progressive systemic sclerosis). Ann. NY Acad. Sci. 141, 613-629 Schimtz, J., Theil, A., Kühn, R., Rajewsky, K., Müller, W., Assenmacher, M., Radbruch, A. (1994). Induction of interleukin 4 (IL-4) expression in T helper (Th) cells is not dependent on IL-4 from non-Th-cells. J. Exp. Med. 179, 1349-1353 Schulz, O., Diebold, SS., Chen, M., Naslund, TI., Nolte, MA., Alexpoulou, L., Azuma, YT., Flavell, RA., Liljestrom, P., Reis e Sousa, C. (2005). Toll-like receptor 3 promotes cross priming to virus-infected cells. Nature 433, 887-892 Schwalbe, RA., Dahlback, B., Coe, JE., Nelsestuen, GL. (1992). Pentraxin family of proteins interact specifically with phosphorylcholine and/or phosphorylethanolamine. Biochemistry 31, 4907-4915 Seder, RA., Paul, WE. (1994). Acquisition of lymphokine-producing phenotype by CD4+ T cells. Annu. Rev. Immunol. 12, 635-673 145 Shen, L., Reznikoff, G., Dranoff, G., Rock, KL. (1997). Cloned dendritic cells can present exogenous antigens on both MHC class I and class II molecules. J. Immunol. 158, 2723-2730 Shortman, K. (2002). Mounse and human dendritic cell subtypes. Nat. Rev. Immunol. 2, 151-161 Shortman, K., Naik, SH. (2006). Steady state and inflammatory dendritic cell development. Nat. Rev. Immunol. 7, 19-30 Smith, KD., Andersen-Nissen, E., Hayashi, F., Strobe, K., Bergman, MA., Barrett, SL., Cookson, BT., Aderem, A. (2003). Toll-like receptor 5 recognizes a conserved site on flagellin required for protofilament formation and bacterial motility. Nat. Immunol. 4, 1247-1253 Smythies, L. E. et al. (2005). Human intestinal macrophages display profound inflammatory anergy despite avid phagocytic and bacteriocidal activity. J. Clin. Invest. 115, 66–75 Sougawa, N., Matsui, H., Kuwata, H., Hemmi, H., Coabn, C., Kawai, T., Ishii, KJ., Takeuchi, O., Miyasaka, M., Takeda, K., Akira, S. (2006). Detection of pathogenic intestinal bacteria by Toll-like receptor 5 on intestinal CD11c+ lamina propria cells. Nat. Immunol. 7, 868-874 Sozzani, S., P. Allavena, A. Vecchi, A. Mantovani. (1999). The role of chemokines in the regulation of dendritic cell trafficking. J. Leukocyte Biol. 66,1–9 Srinivas, S., Sironmani, TA., Shanmugam, G. (1991). Dimethyl sulfoxide inhibits the expression of early growth-response genes and arrests fibroblasts at quiescence. Exp. Cell Res. 196, 279-286 Stahl, PD., Ezekowitz, RAB. (1998). The mannose receptor is a pattern recognition receptor in host defense. Curr. Opin. Immunol. 10, 50-55 Stefanie, S., Silvia, A., Sonja, von A., Albrecht, W., Thomas, H., Stefan, F. (2004). Cryopreservation of human whole blood for pyrogenecity testing. J. Immunol. Methods. 294, 89-100 Stein, M., Keshav, S., Harris, N. & Gordon, S. (1992). Interleukin 4 potently enhances murine macrophage mannose receptor activity: a marker of alternative immunologic macrophage activation. J. Exp. Med. 176, 287–292 Steinman RM., Nussenzweig, MC. (2002). Avoiding horror autotoxicus: the importance of dendritic cells in peripheral T cell tolerance. Proc. Natl. Acad. Sci. U.S.A. 99, 351359 Steinman, R.M. (1991). The dendritic cell system and its role in immunogenicity. (Annu. Rev. Immunol. 9, 271-296 146 Steinman, R.M., Turley, S., Mellman, I., Inaba, K. (2000). The induction of tolerance by dendritic cells that have captured apoptotic cells. J. Exp. Med. 191, 411-416 Steinman, RM., (1991). The dendritic cell system and its role in immunogenicity. Annu. Rev. Immunol. 9, 271-296 Steinman, RM., Cohn, ZA. (1973). Identification of a novel cell type in peripheral lymphoid organs of mice. I. Morphology, quantitation, tissue distribution. J. Exp. Med. 137, 1142-1162 Sternberg, E. M. (2006). Neural regulation of innate immunity: a coordinated nonspecific host response to pathogens. Nature Rev. Immunol. 6, 318–328 Stossel, TP. (1999). The early history of phagocytosis. In Phagocytosis: The Host., Gordon, S., ed 3-18. Stamford, CT: JAI Stout, R. D. et al. (2005). Macrophages sequentially change their functional phenotype in response to changes in microenvironmental influences. J. Immunol. 175, 342–349 Strong, DM., Woody, JN., Factor, MA., Ahmed, A., Sell, KW. (1975). Immunological responsiveness of frozen-thawed human lymphocytes. Clin. Exp. Immunol. 21, 442-455 Strunk, D., Egger, C., Leitner, G., Hanau, D., Stingl, G. (1997). A skin homing molecule defines the langerhans cell progenitor in human peripheral blood. J. Exp. Med. 185, 1131-1136 Sutterwala, FS., Noel, GJ., Salgame, P., Mosser, DM. (1998). Reversal of proinflammatory responses by ligating the macrophage Fcγ receptor type 1. J Exp. Med. 188, 217-222 Szabo, SJ., Sullivan , BM., Peng, SL., Glimcher, LH. (2003). Molecular mechanisms regulating Th1 immune responses. Annu. Rev. Immunol. 21, 713-758 Takeda, K., Kaisho, T., Akira, S. (2003). Toll-like receptors. Annu. Rev. Immunol 21, 335-376 Takeda, K., Kaisho, T., Akira, S. (2003). Toll-like receptors. Annu. Rev. Immunol. 21, 335-376 Takeuchi, O., Kawai, T., Muhlradt, PF., Morr, M., Radolf, JD., Zychlinsky, A., Takeda, K., Akira, S. (2001). Discrimination of bacterial lipoproteins by Toll-like receptor 6. Int. Immunol. 13:933-940 Takeuchi, O., Sato, S., Horiuchi, T, Hoshino, K., Takeda, K., Dong, Z., Modlin, RL., Akira, S (2002). Cutting edge: Role of Toll-like receptor 1 in mediating immune response to microbial lipoproteins. J. Immunol. 169, 10-14 Termeer, C., Benedix, F., Sleeman, J., Fieber, C., Voith, U., Ahrens, T., Miyake, K., Freudenberg, M., Galanos, C., Simon, JC. (2002). Oligosaccharides of Hyaluronan activate dendritic cells via toll-like receptor 4. J. Exp. Med. 195, 99-111 147 Thomas, CP., Dunn, MJ., Mattera, R. (1995). Ca2+ signaling in K562 human erythroleukemia cells: effect of dimethyl sulphoxide and role of G-proteins in thrombin and tromboxane A2-activated pathways. Biochem. 312, 151-158 Timmerman, JM., Levy, R. (1999). Dendritic cell vaccines for cancer immunotherapy. Annu. Rev. Med. 50, 507-529 Trayner, I.D., Bustorff, T., Etches, A.E., Mufti, G.J., Foss, Y., Farzaneh, F. (1998). Changes in antigen expression on differentiating HL60 cells treated with dimethylsulphoxide, all-trans retinoic acid, α1 ,25-dihydroxyvitamin D3 or 12-Otetradecanoyl phorbol-13-acetate. Leukemia Research. 22, 537-547 Trinchieri, G. (2003). Interleukin-12 and the regulation of innate resistance and adaptive immunity. Nat. Rev. Immunol. 3, 133-146 Uematsu, S., Jang, MH., Chevrier, N., Guo, Z., Kumagai, Y., Yamamoto, M., Kato, H., Underhill, DM., Bassetti, M., Rudensky, A., Aderem, A. (1999). Dynamic interactions of macrophages with T cells during antigen presentation. J. Exp. Med. 190, 1909-1914 Underhill, DM., Ozinsky, A. (2002). Phagocytosis in microbes: Complexity in action. Annu.Rev. Immunol. 20, 825-852 Vabulas, RM., Ahmad-Nejad, P., da Costa, C., Miethke, T., Kirschning, CJ., Hacker, H., Wagner, H. (2001). Endocytosed HSP60s use Toll-like receptor 2 (TLR2) and TLR4 to activate the Toll/interleukin-1 receptor signaling pathway in innate immune cells. J. Biol. Chem. 276, 31332-31339 van Furth, R., Diesselhoff-Den Dulk, MM. (1970). The kinetics of promonocytes and monocytes in bone marrow. J. Exp. Med. 132, 813-828 Van Furth, R., Sluiter, W. (1986). Distribution of blood monocytes between a marginating and circulating pool. J. Exp. Med. 163, 474-479 Veldhoen, M., Hocking, RJ., Atkins, CJ., Locksley, RM., Stockinger, B. (2006). TGF-β in the context of an inflammatory cytokine milieu supports de novo differentiation of IL-17-producing cells. Immunity 24, 179-189 Vieira, PL., Heystek, HC., Wormeester, J., Wierenga, EA., Kapsenberg, ML. (2003). Glatiramer Acetate (Copolymer-1, Copaxone) promotes Th2 cell development and increased IL-10 production through modulation of dendritic cells. J. Immunol. 170, 4483-4488 Vignes, Robert (2000). Dimethyl Sulfoxide (DMSO) - A “New” Clean, Unique, Superior Solvent." American Chemical Society Annual Meeting. Vollmer, J., Tluk, S., Schmitz, C., Hamm, S., Jurk, M., Forsbach, A., Akira, S., Kelly, KM., Reeves, WH., Bauer, S., Krieg, AM. (2005). Immune stimulation mediated by autoantigen binding sties within small nuclear RNAs involves Toll-like receptors 7 and 8. J Exp. Med. 202, 1575-1585 148 Wang YH, Ito T, Wang YH et al. (2006). Maintenance and polarization of human TH2 central memory T cells by thymic stromal lymphopoietin-activated dendritic cells. Immunity 24, 827-838. Wang, T., Town, T., Alexpoulou, L., Anderson, JF., Fikrig, E., Flavell, RA. (2004). Toll-like receptor 3 mediates West Nile virus entry into the brain causing lethal encephalitis. Nat. Med. 10, 1366-1373 Weaver, CT., Harrington, LE. Mangan, PR., Gavrieli, M., Murphy, KM. (2006). Th17: an effector CD4T cell lineage with regulatory T cell ties. Immunity. 24, 677-688 Winzler, C., Rovere, P., Rescigno, M., Granucci, F., Penna, G., Adorini, L., Zimmerman, VS., Davoust, J., Riccardi-Castanogli, P. (1997). Maturation stages of mouse dendritic cells in growth factor-dependent long term cultures. J. Exp. Med. 185, 317-328 Wyllie, DH., Kiss-Toth, E., Visintin, A., Smith, SC., Boussouf, S., Segal, DM., Duff, GW., and Dower, SK. (2000). Evidence for an accessory protein function for Toll-like receptor 1 in anti-bacterial responses. J. Immunol. 165, 7125-7132 Yamamoto, M., Sato, S., Hemmi, H., Hoshino, K., Kaisho, T., Sanjo, H., Takeuchi, O., Sugiyama, M., Okabe, M., Takeda, K., and Akira, S. (2003a). Role of adaptor TRIF in the MyD88-independent Toll-like receptor signaling pathway. Science 301, 640-643 Yamamoto, M., Sato, S., Hemmi, H., Sanjo, H., Uematsu, S., Kaisho, T., Hoshino, K., Takeuchi, O., Kobayashi, M., Fujita, T., Takeda, K., Akira, S. (2002). Essential role for TIRAP in activation of the signalling cascade shared by TLR2 and TLR4. Nature 420, 324-329 Yamamoto, M., Sato, S., Hemmi, H., Uematsu, S., Hoshino, K., Kaisho, T., Takeuchi, O., Takeda, K., and Akira, S. (2003b). TRAM is specifically involved in the Toll-like receptor 4-mediated MyD88-independent signaling pathway. Nat. Immunol. 4, 11441150. Yang, J., Murphy, TL., Ouyang, W., Murphy, KM. (1999). Induction of interferon-γ production in Th1 CD4+ T cells: evidence for two distinct pathways for promoter activation. Eur. J. Immunol. 29, 548-555 Yoneyama, M., Kikuchi, M., Natsukawa, T., Shinobu, N., Imaizumi, T., Miyagishi, M., Taira, K., Akira, S., and Fujita, T. 2004. The RNA helicase RIG-I has an essential function in double-stranded RNA-induced innate antiviral responses. Nat. Immunol. 5, 730-737 Yoshida, Y., Maruyama, M., Fujita, T., Arai, N., Hayashi, R., Araya, J., Matsui, S., Yamashita, N., Sugiyama, E., Kobayashi, M. (1999). Reactive oxygen intermediates stimulate interleukin-6 production in human bronchial epithelial cells. Zeyda, M. and Stulnig, T. M. (2007). Adipose tissue macrophages. Immunol. Lett. 112, 61–67 149 Zhang XQ, Eyzaguirre C. (1999) Effects of hypoxia induced by Na2S2O4 on intracellular calcium and resting potential of mouse glomus cells. Brain Res. 18,118– 126. Zhao, A. et al. (2008). Th2 cytokine-induced alterations in intestinal smooth muscle function depend on alternatively activated macrophages. Gastroenterology 135, 217– 225 Zhou, LJ., Teddler, TF. (1996). CD14+ blood monocytes can differentiate into functionally mature CD83+ dendritic cells. Proc. Natl. Acad. Sci. U.S.A. 93, 2588-2592 Zhu, J., Yamane, H., Paul, WE. (2010). Differentiation of Effector CD4 T cell populations. Annu.Rev. Immunol. 28, 445-489 Zuniga, EI., McGavern, DB., Pruneda-Paz, JL., Teng, C., Oldstone, MB. (2004). Bone marrow plasmacytoid dendritic cells can differentiate into myeloid dendritic cells upon virus infection. Nat. Immunol. 5, 1227-1234 150 [...]... integrity of the immune system Cells of the immune system originate from their hemapoietic progenitors in the bone marrow Some cells leave the bone marrow after they were created, migrate to other sites such as the thymus and mature into effector cells Many of the immune cells mature in the bone marrow before migration to their respective sites in the body where they guard against invading pathogens An immune. .. from the invading foreign microorganisms via the effective interplay of the both arms in the immune system 1.2 Innate Immunity 1.2.1 Overview of Innate Immunity The innate immunity is known as the front line of host defence against invading pathogens It is an ancient and universal host defence system (Janeway Jr et al., 2002) The innate immune system alone is often sufficient to clear the source of infection... found in the host’s body also form the innate immune system Together, these components identify, contain and remove the invading pathogen 1.2.2 Myeloid Cells form a Major Arm of Innate Immunity The cellular component in innate immunity formed by myeloid cells is a major arm of the innate immune system The generation of immune cells through hematopoiesis is divided to lymphopoeisis which generates the. .. thus the subsets of DCs in humans and mice are currently defined by linage-MHC II+ cells in combination with various cell surface markers (Sato and Fujita, 2007) Most of the knowledge about the developmental pathway of DCs was based on results obtained by cell culture studies Cells with characteristics of Langerhans cells and DCs can be generated in vitro by culturing CD34+ cells in the presence of GM-CSF... Classically activated macrophages therefore play an important role in protecting the host against invading pathogens as the pro-inflammatory cytokines produced would result in the killing and elimination of the invading pathogens Mice deficient in IFN-γ production were found to be more susceptible to bacterial infection (Felipe-Santos et a.l., 2006) However, the pro-inflammatory cytokines can also contribute... cause lysis of microbial pathogens; (ii) pattern recognition molecules such as cell surface receptors or soluble molecules; and (iii) cytokines and chemokines regulating immune responses Lastly, the cellular components refer to all the cells that play an active role in innate immunity These cells include epithelial cells, eosiniphils, DCs, mast cells, phagocytic cells, NK cells and γδ T cells The natural... the induction of primary immune responses and the regulation of T cell-mediated immune response (Liu, 2001; Shortman and Liu, 2002; and Banchereau et al., 2001) DCs also serve as sentinels by recognizing the invading pathogens through the various patternrecognition receptors (PPRs) DCs activated by microbial products secrete proinflammatory cytokines involved in host defense, providing a crucial link... properties according to the characteristics of the tissues they reside i.e alveolar macrophages in the lung, microglia cells in the brain and kupffer cells in the liver Monocytopoiesis can be influenced by various growth factors and cytokines Interleukin 3 (IL-3), granulocyte macrophage colony-stimulating factor (M-CSF) and macrophage colony-stimulating factor (M-CSF) stimulate the mitotic activity of monocyte... 2008) 16 1.2.2.4 Dendritic Cells Dendritic cells were first observed by Paul Langerhans in 1868 as he mistakenly classified the stellate-shaped epidermal cells as cutaneous nerve cells (Langerhans, 1868) A century later, Steinman and Cohn discovered dendritic cells in mouse spleen and named them dendritic cells based on the unique morphology of DCs when they observed these cells (Steinman and Cohn,... the host The immune system has also been recognized as an important defense mechanism against tumour development and cancer leading to the research and development of immunotherapy in cancer treatment The immune system is built up by a variety of cell types and molecules with distinct but unique functional properties Nevertheless, the cells and molecules are able to act in concert to maintain the integrity ... macrophages therefore play an important role in protecting the host against invading pathogens as the pro-inflammatory cytokines produced would result in the killing and elimination of the invading pathogens... effective interplay of the both arms in the immune system 1.2 Innate Immunity 1.2.1 Overview of Innate Immunity The innate immunity is known as the front line of host defence against invading pathogens... cytokines and chemokines regulating immune responses Lastly, the cellular components refer to all the cells that play an active role in innate immunity These cells include epithelial cells, eosiniphils,