... 5'-gaaagaacgagcccgattaTTCAAGAGAtaatcgggctcgttctttcTTTTT-3' for hDlg1-1, 5'gtgttcagtctgtacgagaTTCAAGAGAtctcgtacagactgaacacTTTTT-3' for hDlg1-3, 5'gagtggatgccacgacggtttGTGTGCTGTCCaaatcgtcgtggtattcactcTTTTT-3' ... respectively The sequences of these oligonucleotides are 5'-ggatggcgagctttaggttggGTGTGCTGTCCccaatctgaagcttgccatccTTTTT-3' for Dlg1-1, 5'ggatgtttaggagtataagttGTGTGCTGTCCaacttatgctcctgaatatccTTTTT-3' for ... CAT, 5'-ggcctttcactgctcctgcgaGTGTGCTGTCCtcgtaggagtagtgaaaggccTTTTT-3' for LUC, and 5'gcctttcactactcctacgTTCAAGAGAcgtaggagtagtgaaaggcTTTTT-3' for Rluc The oligonucleotides Dlg1-1, Dlg1-3, CAT,...
Ngày tải lên: 13/08/2014, 09:20
... of antibodies, at a concentration of 25 μg/mL, were pre-incubated with the target cells for 30 minutes before addition of the stimulated T- cells K562 cells were used as targets to observe natural ... Acknowledgements This project was supported by the Institutional Research Program of the Texas Tech University Health Sciences Center, the Southwest Cancer Treatment and Research Center Program, the Laura ... product identified to elicit CTL responses in mice [22] The role of IE1-recognizing CD8+ T cells will be an interesting subject to study DCs are professional antigen presenting cells that are critical...
Ngày tải lên: 18/06/2014, 15:20
CD8 t cell mediated induction of interleukin 12p70 production by dendritic cells
... the elimination of infected and tumor cells CD8 T cells start off as naïve T cells that circulate the body after development in the thymus CD8 T cells are activated by encounter with antigen, which ... Lambrecht, 2008) Stimulation of epithelial cells via PRRs results in the production of thymic stromal lymphopoietin (TSLP) that directly activates DCs to prime CD4 T cells to differentiate into Th2 cells ... in Th1 cells, suggesting that CD8 T cells were important for the development of Th1 cells During retroviral infection, CD8 T cells are also involved in the generation of protective CD4 Th1 responses...
Ngày tải lên: 11/09/2015, 09:11
Báo cáo y học: " Systems-level comparison of host responses induced by pandemic and seasonal influenza A H1N1 viruses in primary human type I-like alveolar epithelial cells in vitro" pdf
... infectious viral titres were detected in the cell supernatant by viral titration Genes of particular interest indentified in the microarray analysis were verified using real time quantitative ... with the appropriate growth medium The infected cells were harvested for mRNA collection at h post-infection and viral M gene was quantified using real-time PCR Total RNA was extracted from cells ... study, they observed that IFN responses were triggered early after infection by both H1N1 viruses However, in contrast to our data, they report that the range and magnitude of ISGs induced by seasonal...
Ngày tải lên: 12/08/2014, 11:22
Báo cáo y học: " Proinflammatory cytokine responses induced by influenza A (H5N1) viruses in primary human alveolar and bronchial epithelial cells" ppt
... RANTES attracts monocytes, eosinophils, basophils and T cells, and selectively CD4+ T cells Its production from the bronchial epithelial cells contributes to the infiltration of the inflammatory ... Aliquots of culture supernatant were collected and frozen at -80°C for subsequent virus titration and cytokine analysis The supernatants were titrated on MDCK cells and the viral titre was quantitated ... Dako Diagnostics Ltd, Ely, UK) to determine the proportion of cells infected Quantification of cytokine mRNA by real-time quantitative RT-PCR DNase-treated total RNA was isolated by means of...
Ngày tải lên: 12/08/2014, 18:20
Báo cáo y học: "Viral suppression of multiple escape mutants by de novo CD8+ T cell responses in a human immunodeficiency virus-1 Infected elite suppressor" ppt
... to wild type TW10 peptide, but not to autologous variants Representative dot plot and histogram shown for stimulation with one of the autologous mutants, TSTLTEQVAW (top left) and wild type TW10 ... infected PHA activated CD4 +T cells from ES8 with the replication competent viruses constructed to express these TW10 variants, and co-cultured the infected cells with each CD8 +T cell population that ... fitness further This may suggest that compensatory mutations exist in the plasma variants which partially rescue fitness defects caused by the TW10 mutations, but that these compensatory mutations...
Ngày tải lên: 13/08/2014, 01:21
THE ROLE OF DMSO IN THE REGULATION OF IMMUNE RESPONSES BY DENDRITIC CELLS
... Surfactant protein SR Scavenger receptor STAT - protein Signal Transducers and Activators of Transcription protein TAP Transport associated protein TBS Tris-buffered saline TCR T cell receptor TCR ... T cell receptor TEMED N,N,N’,N’-tetramethylethylenediamine TGF-β Transforming growth factor beta Th T helper THP Human acute monocytic leukemia cell line TIR Toll-interleukin receptor (TIR) TIRAP ... contributes not only to the microbial immunity but to autoimmunity and antitumour response CD1-restricted antigen presentation also appears to regulate γ/δ T cells and intestinal intraepithelial...
Ngày tải lên: 16/10/2015, 11:59
Báo cáo khoa học: Pathways involved in testicular germ cell apoptosis induced by H2O2 in vitro doc
... GCAATGCTTCTCTCTGTGACCACT Reverse: GCTGTTGTGCTCGATCTCATCG Forward: GGAATGGGAAGACACATATGGAACTGC Reverse: CATATCTGGCCAGTAGTGCAGTAATTC Forward: CTGTGCCCATCTATGAGGGTTAC Reverse: AATCCACACAGAGTACTTGCGCT ... sequence (5¢- to 3¢) Forward: CTTCAGCCTGCACTGAAGTTCAAT Reverse: CTGAAGATAGTAAGCGTGCTCCC Forward: GAGCATGGGTTCCATGTCCAT Reverse: ACTTTCTTCATTTCCACCTTTGCC Forward: CCGACGAGATGGCACACTTTGACA Reverse: ... following H2O2 treatment C, control *P < 0.01 A H2O2 treatment of testicular germ cells not only activates the intrinsic and extrinsic pathways, but also other pathways of apoptotic induction Tumour...
Ngày tải lên: 16/03/2014, 04:20
Báo cáo hóa học: " Non-monotonic changes in clonogenic cell survival induced by disulphonated aluminum phthalocyanine photodynamic treatment in a human glioma cell line" pot
... that facilitate cells to recover from potentially lethal damage The results obtained in the present studies indicate that at least two pathways may contribute competitively or additively to phototoxicity ... made to overcome the limitations by the use of a) better sensitizers and b) strategies that target the sensitizer preferentially to the tumor and also to the more sensitive intracellular sites Towards ... intervals of time Floating cells were collected separately before harvesting attached cells by trypsinization Flow-cytometric measurements of cellular DNA contents were performed with the ethanol (70%)...
Ngày tải lên: 18/06/2014, 16:20
Báo cáo sinh học: " Motavizumab, A Neutralizing Anti-Respiratory Syncytial Virus (Rsv) Monoclonal Antibody Significantly Modifies The Local And Systemic Cytokine Responses Induced By Rsv In The Mouse Model" pdf
... despite treatment with the mAb suggests that some viral particles still escaped the effect of the enhanced neutralizing antibody This interpretation of the results is further supported by our ... previous studies showed that no treatment or treatment with either PBS or an IgG1 isotypematched control antibody, MEDI-507, at the same time of the administration of the anti-RSV antibody had ... both viral replication and the exaggerated immune response to RSV infection are closely interrelated In fact, studies suggest that the pattern of cytokine production elicited by RSV affects the...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo hóa học: " Motavizumab, A Neutralizing Anti-Respiratory Syncytial Virus (Rsv) Monoclonal Antibody Significantly Modifies The Local And Systemic Cytokine Responses Induced By Rsv In The Mouse Model" potx
... despite treatment with the mAb suggests that some viral particles still escaped the effect of the enhanced neutralizing antibody This interpretation of the results is further supported by our ... previous studies showed that no treatment or treatment with either PBS or an IgG1 isotypematched control antibody, MEDI-507, at the same time of the administration of the anti-RSV antibody had ... both viral replication and the exaggerated immune response to RSV infection are closely interrelated In fact, studies suggest that the pattern of cytokine production elicited by RSV affects the...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo hóa học: " Characterization of the IFN-γ T-cell responses to immediate early antigens in humans with genital herpes" doc
... significant cross contamination of T- cells in the two different IFN-γ ELISPOT assays is very low To evaluate the activity of T- cells that were bound to magnetic beads, PBMC samples were depleted of either ... cells Total ELISPOTs from all wells was 92 for the bead-bound CD4 cells and 288 for the free CD4 cells, indicating that CD4 cells positively selected onto magnetic beads not have the same activity ... these assay conditions The ability of CD8 cells to respond to peptide when bound to beads suggests that antigen presenting cells are not required or are not limiting under the conditions of the...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo y học: " Multiple functions for CD28 and cytotoxic T lymphocyte antigen-4 during different phases of T cell responses: implications for arthritis and autoimmune disease" pot
... target cells; on the other, blockade of CTLA-4 abrogates the inhibitory function of Treg cells [72] Interestingly, naive T cells, converted to Treg cells by retroviral transduction with the transcription ... online http://arthritis-research.com/content/6/2/45 Responses of already activated T cells The control of T cells after a successful stimulation – whereby T cells accumulate rafts at the cell surface, ... A -induced blasts or anti-CD3-stimulated T cells has been suggested to induce apoptosis, thus terminating the T cell response [16,64] This would mean that activated T cells are stopped by CTLA-4...
Ngày tải lên: 09/08/2014, 01:23
Báo cáo y học: " The intracellular detection of MIP-1beta enhances the capacity to detect IFN-gamma mediated HIV-1-specific CD8 T-cell responses in a flow cytometric setting pro" ppsx
... determination of the total IFN-γ+ cells, we were able to detect positive responses that were missed by the ELIPOT, but the ELISPOT was able to detect responses missed by the ICS Of note, out ... evaluation equivalent to the measurement of the total IFN-γ producing T- cells with the relevant advantage of a consistent decrease of the background that in turn increases the sensitivity of the ... detected positive responses Number of detected positive responses (A) The histogram plots show the number of positive CD8, CD4 or total T- cell responses detected with the IFN-γ+ MIP-1β+ and the...
Ngày tải lên: 10/08/2014, 05:21
Báo cáo y học: "Differential induction of inflammatory cytokines by dendritic cells treated with novel TLR-agonist and cytokine based cocktails: targeting dendritic cells in autoimmunity" potx
... conventional methods The treatment with a drug candidate in our setting correlates to the potential treatment at the monocyte or steady state immature DCs level in the periphery of the patient, ... vertical bars indicate (SD) values not indicate if the T- cells has differentiated into Th1, Th2 or Th17 T- cells when the DCs are cocultured with CD4+ T cells In order to evaluate whether the ... to chemoattraction of these cells from the circulation into the site of inflammation The treatment in our in vitro model with cocktails containing Th1 inducing or inflammatory cytokines and TLR...
Ngày tải lên: 11/08/2014, 06:22
Báo cáo y học: "Identification of proteases employed by dendritic cells in the processing of protein purified derivative (PPD)" pdf
... inhibits cathepsin D/E activity relatively selectively [35] Thus, it appears that cathepsin D/E is the primary target of pepstatin A, with the implication that these proteases play important roles ... whereas it did not affect the presentation of PPD fragments; b) pepstatin A pretreatment inhibited cathepsin D/E activity selectively among the DC-associated protease activities; and c) all tested ... [3-6,12] Thus, it will be interesting to compare DC from different tissues and in different states of maturation for their protease profiles and susceptibilities to pepstatin A treatment We believe that...
Ngày tải lên: 11/08/2014, 10:23
Báo cáo y học: "Mycobacterial immune reconstitution inflammatory syndrome in HIV-1 infection after antiretroviral therapy is associated with deregulated specific T-cell responses: Beneficial effect of IL-2 and GM-CSF immunotherapy" pptx
... patients Patient CD4 T cell count before ART cells/ µl CD4 T cell count at presentation of IRIS cells/ µl Fold change in CD4 T cell counts from baseline to IRIS presentation CD4 T cell count after ... robust T cell responses [29]; in addition CMV does not target the antigen presenting cells such as dendritic cells and macrophages hence enabling the uninfected antigen presenting cells to efficiently ... possibly reflect thymic dysfunction/inactivity Our data suggests that the degree of immune reconstitution achieved with potent ART alone is dependent on the clinical stage of the patient when therapy...
Ngày tải lên: 11/08/2014, 10:23
Báo cáo y học: "IMP321 (sLAG-3), an immunopotentiator for T cell responses against a HBsAg antigen in healthy adults: a single blind randomised controlled phase I study" ppt
... addition to the TLR agonists that are innate immunity ligands, the immune response involves two adaptive immunity ligands that are expressed on activated T cells and bind to non-TLR receptors ... subsets being induced (e.g IL-2 for the memory phenotype) gen-specific T cells) Its ability to orientate the immune response to Th1/Tc1 was confirmed by the greater increase in the cellular than the ... antigen-specific T cells was determined by flow cytometry after IFN-γ, TNF-α, and IL-2 intracellular staining in CD3+CD4+ and CD3+CD8+ cells The percentage of CD4+ T cells expressing these Th1-type...
Ngày tải lên: 11/08/2014, 10:23
Báo cáo y học: "Effects of recombinant human growth hormone on HIV-1-specific T-cell responses, thymic output and proviral DNA in patients on HAART: 48-week follow-up" ppt
... Figure treated patients at baseline in response 12, 24 in HAART IFN-γ production by T cells and at weeksto PHA and 48 IFN-γ production by T cells in response to PHA in HAART treated patients at baseline ... rhGH treatment promotes the restoration of Tcell responses against HIV-1, a restoration that declines with cessation of treatment Since HIV-1+ patients commonly develop growth hormone abnormalities, ... and after by CD8+ T cells IFN-γ productionrhGH therapy in response to rVV HIV-1 constructs and peptide pools in HAART treated HIV+ patients IFN-γ production by CD8+ T cells in response to rVV...
Ngày tải lên: 11/08/2014, 10:23
Báo cáo y học: "Isoniazid prophylaxis differently modulates T-cell responses to RD1-epitopes in contacts recently exposed to Mycobacterium tuberculosis: a pilot study" pdf
... therapy (table 3) INH-treated subjects The IFN-gamma response to PPD, QTF-G, RD1 intact proteins and selected peptides of the 24 TST+ individuals that started therapy, and that did not report ... history of past exposure to a patient with contagious TB, and on whether or not they were receiving treatment for LTBI The study was approved by the ethics committee at our institution and all enrolled ... Until recently, the tuberculin skin test (TST) has been the only tool used to detect LTBI, but this test is flawed operationally and in terms of specificity and sensitivity [3] Lately, in vitro assays...
Ngày tải lên: 12/08/2014, 15:20