Báo cáo khoa học: Pathways involved in testicular germ cell apoptosis induced by H2O2 in vitro doc

Pathways involved in testicular germ cell apoptosis induced by H 2 O 2 in vitro Ankur Maheshwari 1 , Man M. Misro 1 , Archana Aggarwal 1 , Rajnesh K. Sharma 2 and Deoki Nandan 1 1 Department of Reproductive Biomedicine, National Institute of Health and Family Welfare, New Delhi, India 2 Department of Zoology, Kurukshetra University, India Seminiferous epithelium harbours a large number of germ cells in the spermatogenic cycle, which are at dif- ferent stages of development and maturation until they are released into the tubular lumen as fully fledged sperms. Earlier studies have indicated that spermato- genic cells undergo spontaneous degeneration at specific stages during development, and such degenera- tion of different types of spermatogonia (A 2 –A 4 ) and meiotic cells in rats has been reported to result in the depletion of up to 75% of the mature sperm pool [1,2]. The plasma membrane of testicular cells is rich in polyunsaturated fatty acids and therefore prone to oxidation by H 2 O 2 and other reactive oxygen species (ROS) [3]. H 2 O 2 constitutes the main ROS form in sperms but its effective role as an endogenous messen- ger in germ cell apoptosis is largely unknown [4]. How- ever, H 2 O 2 is known to modulate a variety of cell functions. It is a potent ROS, but its lower biological activity compared to many ROS, combined with its capacity to cross membranes and diffuse away from the site of generation, makes it an ideal molecule in signal transduction, and lower doses are known to induce apoptosis [5]. As reviewed previously [6], H 2 O 2 is synthesized endogenously in certain cell systems in response to specific cytokines or hormones ⁄ growth factors and such endogenous H 2 O 2 can then either act Keywords apoptosis; germ cell; H 2 O 2 ; pathways; testis Correspondence M. M. Misro, Department of Reproductive Biomedicine, National Institute of Health and Family Welfare, Baba Gang Nath Marg, New Delhi 110067, India Fax: +91 11 2610 1623 Tel: +91 11 2616 5959 E-mail: mm_misro@yahoo.com (Received 17 October 2008, revised 28 November 2008, accepted 3 December 2008) doi:10.1111/j.1742-4658.2008.06831.x H 2 O 2 induces apoptosis in variety of cells; however, the sensitivities of testicular germ cells to H 2 O 2 are not known. In the present study, H 2 O 2 ,at concentrations in the range 1–10 lm, was found to induce apoptosis in testicular germ cells in vitro. Following 1 h of treatment with 10 lm H 2 O 2 , a 10-fold rise in the percentage of apoptotic cells was observed. Induction of germ cell apoptosis was directly associated with a significant (P < 0.01) increase in lipid peroxidation and a concomitant decrease in superoxide dismutase and catalase activity. Examination of apoptotic signalling path- ways revealed an increased expression of extrinsic (Fas, FasL and caspase- 8) and intrinsic (Bid, Bak, Bad, Bax and caspase-9) markers, as well as p53, along with a simultaneous decrease in the Bcl-2 protein at the highest concentration of H 2 O 2 exposure. Both, c-jun N-terminal kinase and p38 phosphorylated forms were found to be up-regulated. Interestingly, up-reg- ulation of the nuclear transcription factor kappa B was also observed. The respective transcripts for many of the above proteins followed an identical trend. Caspase-3 activity was also estimated to be 30-fold higher. Taken together, the above data indicate that testicular germ cells are prone to apoptosis at very low concentrations of H 2 O 2 , the mechanism of which involves extrinsic and intrinsic as well other regulatory pathways. Abbreviations ABTS, 2,2-azino-di-(3-ethylbenzthiazoline sulfonate; DAB, diaminobenzidine; GST, glutathione S-transferase; HBSS, Hank’s balanced salt solution; hCG, human chorionic gonadotrophin; HRP, horseradish peroxidase; ISEL, in situ end labelling; JNK, c-Jun N-terminal kinase; MAP, mitogen-activated protein; NF-jB, nuclear factor-kappa B; PARP, poly-(ADP)-ribose polymerase; ROS, reactive oxygen species; TAC, total antioxidant capacity 870 FEBS Journal 276 (2009) 870–881 ª 2009 The Authors Journal compilation ª 2009 FEBS as a second messenger to stimulate protein kinase cascades coupled with apoptosis or participate in regu- latory control of the cell cycle. Apoptosis involves a cascade of signals and there are different pathways involved in testicular germ cell apoptosis pertaining to specific treatments. As previ- ously shown [7], testicular cell apoptosis follows both extrinsic and intrinsic pathways. The extrinsic pathway involves the activation of death receptors, namely Fas ⁄ tumour necrosis factor receptor, leading to activa- tion of initiator caspase-8, followed by activation of executioner caspases-3, 6, 7 and, subsequently, apopto- sis [8]. The intrinsic or the mitochondrial pathway involves Bcl-2 family members, leading to changes in the mitochondrial membrane permeability and release of cytochrome c into the cytosol [9]. Cytochrome c sequesters with the apoptotic protease activating fac- tor-1 and the complex activates initiator caspase-9, which in turn activates executioner caspases, leading to apoptosis [10]. We have previously reported that H 2 O 2 at physiological concentrations modulates Leydig cell function and induces oxidative stress and apoptosis [11]. However, the sensitivities of isolated germ cells to H 2 O 2 are not known. Furthermore, chronic human chorionic gonadotrophin (hCG) treatment has been reported to be associated with the rise in testicular H 2 O 2 and germ cell apoptosis [12]. Therefore, in the present study, the effects of H 2 O 2 inflicting oxidative and apoptotic damage on the isolated testicular germ cells, as well as the pathways associated with the signal transduction of the apoptotic stimulus, were investi- gated. Results H 2 O 2 treatment is associated with rise in oxidative stress Testicular germ cells demonstrated a significant (P < 0.01) rise in lipid peroxidation following H 2 O 2 exposure at a 2 lm concentration and above (Fig. 1A). However, the effect was not significant at the lowest concentration of H 2 O 2 (1 lm). Both, superoxide dismutase (SOD) and catalase from treated cells showed a significant (P < 0.01) decline in their activi- ties above a 2 lm concentration of H 2 O 2 (Fig. 1C,D). Parallel to the decrease in enzyme activities, mRNA expressions of Mn SOD and catalase were also down- A B C D Fig. 1. Evaluation of oxidative stress in rat testicular germ cells treated with H 2 O 2 . (A) Dose-dependent increase in lipid peroxidation as measured by thiobarbituric acid reactive substance formation. (B) Transient rise followed by a steep decline in GST activity at the highest concentration of H 2 O 2 . (C) Significant decline in SOD activity coinciding with transcript levels representing Mn SOD but not Cu ⁄ Zn SOD. (D) Catalase activity along with its transcripts. C, control. *P < 0.01, **P < 0.001. A. Maheshwari et al. H 2 O 2 and testicular cell apoptosis FEBS Journal 276 (2009) 870–881 ª 2009 The Authors Journal compilation ª 2009 FEBS 871 regulated. On the other hand, Cu ⁄ Zn SOD transcripts were found to be unaltered in all the treatment groups. Interestingly, the decline in the activity of glutathione S-transferase (GST) (Fig. 1B) matched perfectly well with the total antioxidant capacity (TAC), which was found to be significantly (P < 0.05) lower only in cells treated with the highest concentration (10 lm)ofH 2 O 2 (Fig. 2). Low concentrations of H 2 O 2 induce germ cell apoptosis In situ end labelling (ISEL) positive cells were recorded out of each 100 cells examined from five randomly selected sites on each slide. A significant (P < 0.01) and dose-dependent increase in ISEL positive cells was observed in cells treated with H 2 O 2 at concentrations of 2 lm and above. Approximately, 52% of the treated cells were found apoptotic with the highest concentra- tion of H 2 O 2 , which was ten-fold higher compared to controls (Fig. 3A,B). Germ cell apoptosis in all the experimentally exposed groups was further supported by the inter-nucleosomal degradation of genomic DNA depicting a ladder-like pattern on agarose gel electrophoresis (Fig. 3C). Also, H 2 O 2 treated cells revealed a three- to 30-fold rise in caspase-3 activity compared to controls and a demonstrable increase in poly-(ADP)-ribose polymerase (PARP) cleavage (Fig. 4A,B). H 2 O 2 induced germ cell apoptosis follows both extrinsic and intrinsic pathways To determine whether H 2 O 2 -induced redox imbalance and subsequent testicular germ cell apoptosis were associated with changes in pro- ⁄ anti-apoptotic and other proteins, the expression of these proteins and their mRNAs were studied by western blotting and RT-PCR analysis, respectively. Bax protein ⁄ mRNA expression was low in control cells compared to H 2 O 2 treated cells (Fig. 5A,B). As expected, the anti-apopto- Fig. 2. Assessment of TAC in testicular germ cells with or without H 2 O 2 (10 lM). C, control. *P < 0.05. A B C Fig. 3. ISEL of testicular germ cells treated with H 2 O 2 . (A) A marked rise in percentage of ISEL positive cells was observed in (B) the treated (right panel) compared to untreated cells (left panel); ·400. (C) Ladder assay showing DNA fragmentation in H 2 O 2 exposed testicular germ cells. C, control. *P < 0.01, **P < 0.001. H 2 O 2 and testicular cell apoptosis A. Maheshwari et al. 872 FEBS Journal 276 (2009) 870–881 ª 2009 The Authors Journal compilation ª 2009 FEBS tic Bcl-2 protein ⁄ mRNA levels were found to be dras- tically lowered in the highest treatment group (Fig. 5A,B). However, an opposite trend was encoun- tered when the cells were treated with 1–5 lm H 2 O 2 . Simultaneously, there was an increase in the expression of other Bcl-2 member pro-apoptotic proteins such as Bid, Bad and Bak (Fig. 5A). Besides the release of cytochrome c, caspase-9 protein and its mRNA were found to be up-regulated, supporting the involvement of an intrinsic ⁄ mitochondrial pathway of apoptosis (Fig. 6A,B). The active caspase-9 was also resolved in the cells exposed with 2–10 lm of H 2 O 2 . On the other hand, marginal rise in FasL, Fas and caspase-8 protein expression coincided well with the elevated levels of their specific transcripts in the treated cells, indicating the course of signal transduction through an extrinsic ⁄ death receptor pathway (Fig. 6C,D). Activation of other pathways in H 2 O 2 induced germ cell apoptosis H 2 O 2 treatment of testicular germ cells not only acti- vates the intrinsic and extrinsic pathways, but also other pathways of apoptotic induction. Tumour suppressor, p53 protein and mRNA expression was up-regulated in all the treatment groups in a dose-dependent manner (Fig. 7A,B). Western blots for mitogen-activated pro- tein (MAP) kinases, c-Jun N-terminal kinase (JNK) or phosphorylated forms of JNK and p38 depicted a rise in expressions ⁄ phosphorylation compared to untreated controls (Fig. 7C). A dose-dependent upward expres- sion of nuclear factor-kappa B (NF-jB) was also observed in the treated cells (Fig. 7C). Discussion The results of the present study indicate that H 2 O 2 , even at a concentration of 1 lm, has the ability to induce apoptosis in testicular germ cells in vitro after 1 h of exposure. The mechanism takes the usual routes of extrinsic and intrinsic as well as other designated pathways of metazoan apoptosis, signifying the possi- ble role of this biomolecule in the process of germ cell development in the testis and its regulation through apoptosis. H 2 O 2 is a by-product of cell metabolism; its cellular levels and maintenance are constantly under homeo- static regulation. The cells can sense sublethal doses of H 2 O 2 and activate peroxide-detoxifying mechanisms; alternatively, various H 2 O 2 producing mechanisms can be activated by different cell death stimuli. As a result of this deliberate H 2 O 2 production, a self-destructive programmed cell death can be triggered [13]. However, different organisms or cells have variations in their sensitivities to H 2 O 2 . In the study of caspase-depen- dent ⁄ independent events of apoptosis in MCF-7 breast A B Fig. 4. (A) A rise (three- to 30-fold) in caspase-3 activity and (B) PARP cleavage in testicular germ cells following H 2 O 2 treatment. C, control. *P < 0.01 A B Fig. 5. Expression levels of Bcl-2 family members. An increase in pro-apoptotic proteins (Bax, Bid, Bak and Bad) and a decrease in anti-apoptotic protein Bcl-2 at the highest (10 l M H 2 O 2 ) concentra- tion (A) was observed. (B) Expression of Bax and Bcl-2 as detected by RT-PCR. C, Control. A. Maheshwari et al. H 2 O 2 and testicular cell apoptosis FEBS Journal 276 (2009) 870–881 ª 2009 The Authors Journal compilation ª 2009 FEBS 873 carcinoma cells, H 2 O 2 in the optimal range 250– 1000 lm was used [14]. However, in Jurkat T-cells, H 2 O 2 -induced apoptosis required 100 lm or more of H 2 O 2 [15]. It is also reported that 50 lm of H 2 O 2 was sufficient to induce apoptosis in rat germ cells [16]. Although a higher concentration in the medium is toxic and affects cell survival, H 2 O 2 , even at physio- logical concentrations (30–50 lm), was shown to induce apoptosis in testicular Leydig cells in vitro [11]. Germ cells constitute the major inner seminiferous tubular cell mass and the role of H 2 O 2 as a signalling molecule in apoptotic induction among germ cells is not yet known. In the present study, we attempted to test germ cell sensitivity to H 2 O 2 with reference to apoptotic induction. The findings also clearly estab- lished that testicular germ cells are much more sensi- tive to H 2 O 2 and would require a five- to 30-fold lower concentration of H 2 O 2 in vitro for induction of apopto- sis compared t o their interstitial counterparts [11]. In experimentally induced conditions of ischaemia or cryptorchidism in rats, the major pathway of cell removal from the testis was mainly through apoptosis [17,18]. However, the role of intratesticular H 2 O 2 dur- ing such conditions is not yet known. In the rat testis, however, hormonal alterations due to chronic hCG treatment were reported to raise H 2 O 2 levels and induce germ cell apoptosis [12]. Therefore, it is reason- able to assume that H 2 O 2 might constitute a specific physiological link to germ cell apoptosis in the testis, A B C Fig. 7. Other pathways of signal transduction in H 2 O 2 induced tes- ticular germ cell apoptosis. (A) Dose-dependent increase in expres- sion of p53 protein coinciding with (B) a marked rise in transcript levels in all treated groups and (C) a change in expression levels of other proteins (JNK, p-JNK, p-p38, NF-jB). C, Control. A B C D Fig. 6. Pathways of signal transduction in H 2 O 2 induced testicular germ cell apoptosis. Western blots showing expression of (A) (intrinsic) caspase-9 and cytochrome c and (C) (extrinsic) caspase-8, FasL and Fas, which are supported by RT-PCR analysis of (B) caspase-9 and (D) caspase-8, FasL and Fas. C, control. H 2 O 2 and testicular cell apoptosis A. Maheshwari et al. 874 FEBS Journal 276 (2009) 870–881 ª 2009 The Authors Journal compilation ª 2009 FEBS for which the modalities need to be further worked out. The redox status inside the cell is crucial to the correct functioning of many enzymes, and can be used to alter enzyme activity; thus, alteration of redox status could act as a signalling mechanism. It may either trigger or block the apoptotic death program depending on the severity of the oxidative stress [4]. However, H 2 O 2 was found to trigger apoptosis possibly by modulating the oxidative stress and functioning of different antioxidant enzymes, as observed in the present study (Fig. 1). Germ cells trea- ted with H 2 O 2 (10 lm) for 1 h demonstrated a significant (P < 0.001) increase in lipid peroxidation, and a decrease in antioxidant enzyme activity and TAC (Figs 1 and 2). With the rise in lipid peroxidation, a fall in enzyme (SOD, catalase) activities was observed, and was statistically significant (P < 0.01) even at 2 lm of H 2 O 2 (Fig. 1). Mn SOD demonstrated a downward trend and the unaltered transcript levels of Cu ⁄ Zn SOD, as pres- ently observed, need to be investigated further (Fig. 1C). Because Mn SOD mostly represents mitochondrial frac- tion, its down-regulation at the transcriptional level probably contributes to the overall insufficient avail- ability of the enzyme. The increase in transcript levels at 5 lm may be considered as an aberration of the decreas- ing trend of Mn SOD expression with respect to the increase in H 2 O 2 concentration. However, the expression was significantly low (P < 0.01) compared to untreated cells. A slight deviation in GST activity (Fig. 1B) was noted, which declined significantly (P < 0.01) only in cells exposed to the highest concentration of H 2 O 2 .By contrast, a moderate increase in GST activity was observed at lower concentrations of H 2 O 2 (1–2 lm). Such an increase in GST activity may be considered as one of the measures to counteract the oxidative stress induced by H 2 O 2 at lower, but not at the highest, concentrations. In the present study, ‘laddering’ of the DNA in the exposed cells was seen in all the treatment groups in a dose-dependent manner (Fig. 3C). Furthermore, ISEL positive cells in different treatment groups increased from 8% to 52% in a dose-dependent manner (Fig. 3A,B). An increase in caspase-3 activity (from three- to 30-fold compared to controls) and PARP cleavage (Fig. 4A,B) in the treated cells is associated with DNA fragmentation and supported by the fact that PARP is essential in rat germinal cells for repair of DNA damage induced by either gamma-irradiation or H 2 O 2 [16]. Spermatocytes and spermatids constitute the bulk of the germ cells isolated and H 2 O 2 was seen to mediate the up-regulation of Fas protein and its transcripts in these cells (Fig. 6C). Interestingly, H 2 O 2 was found to up-regulate FasL mRNA expression, irrespective of the concentration used, whereas only a marginal increase in protein was observed (Fig. 6C,D) and the significance of this increase in FasL expression is yet to be explored. Following the binding of FasL with Fas, activation of caspase-8 occurs, ensuring the direct activation of cas- pase-3 [8,19]. The present findings depicted a marked rise in caspase-8 transcripts, with a marginal increase in its protein expression. Caspase activation is often con- sidered principally at the protein level with respect to controlling proteolytic cascades, but some studies have reported increases in caspase mRNA subsequent to apoptotic stimuli [20,21]. This suggests that H 2 O 2 expo- sure to testicular germ cells probably induces the extrin- sic pathway of apoptotic induction. The Bcl-2 family of proteins is a widely recognized group of apoptotic regulators. This family consists of both pro-(Bax, Bad, Bak, Bid) and anti-apoptotic (Bcl-2, Bcl-xL, Bcl-2l2) proteins that modulate the execution phase of the cell death pathway, and the expression of these proteins changes in testicular germ cell apoptosis [22–24]. Evidence for the role of these proteins in spermatogenesis is provided by studies con- ducted in different ‘knockout mice’ models in which the expression of selected members of Bcl-2 family is disrupted [25]. Transgenic mice over-expressing bcl-2 or bax-deficient male mice are infertile, which is attrib- uted to the disruption of spermatogenesis leading to accumulation of gem cells [23]. The pro-apoptotic Bid ⁄ Bax ⁄ Bad moves from the cytosol to the outer- mitochondrial membrane following an apoptosis inducing signal and the interaction between these Bcl-2 family proteins induces a conformational change, which results in cytochrome c release from the mito- chondria. Cytochrome c association with Apaf-1 and procaspase-9 promotes the activation of caspase-9, followed by downstream events leading to apoptosis [7–10]. We have shown that all the pro-apoptotic proteins, Bax, Bid, Bak and Bad, are up-regulated (Fig. 5) along with caspase-9 mRNA and protein, indi- cating the involvement of the intrinsic pathway in the H 2 O 2 -induced testicular germ cell apoptosis (Fig. 6A,B). The ability of Bcl-2 (an anti-apoptotic protein) as an antioxidant to prevent apoptosis has been reported previously [26,27]. Bcl-2 appeared to prevent lipid peroxidation associated with apoptosis without reduc- ing intracellular ROS levels, suggesting that Bcl-2 may indirectly regulate antioxidant defences to prevent cell death. H 2 O 2 induces oxidative stress in cells and appears to be responsible for the decrease of Bcl-2 pro- tein and mRNA levels in the highest treatment group (10 lm). Static expression in the lower treatment groups (1–5 lm) possibly indicates its involvement as an intra- cellular antioxidant to counteract the oxidative stress. A. Maheshwari et al. H 2 O 2 and testicular cell apoptosis FEBS Journal 276 (2009) 870–881 ª 2009 The Authors Journal compilation ª 2009 FEBS 875 The down-regulation of Bcl-2 in the group exposed to 10 lm H 2 O 2 probably reflects the collapse of the anti- apoptotic measure beyond a critical concentration. As already discussed, H 2 O 2 exposure leads to redox alterations with elevated oxidative stress, and this geno- toxic stress may affect p53 tumour suppressor gene ⁄ protein. As noted previously [28], p53 represents the sensor of DNA damage whose activation provides the cell with an opportunity to repair any cellular dam- age prior to commitment to undergo apoptosis, and p53-induced apoptosis results from cellular redox alter- ations. The absence of p53 expression correlates with an attenuation of germ cell apoptosis after mono- (2-ethylhexyl)-phthalate exposure [29]. A dose-depen- dent increase in p53 protein and its transcript was observed in germ cells after H 2 O 2 exposure in the pres- ent study (Figs 7A,B). Previous data have suggested a potential role for the nuclear transcription factor, NF-jB, in regulating rodent spermatogenesis, but its physiological significance in the testis still remains elu- sive [30]. However, during testicular stress in humans, Sertoli cell NF-jB proteins exert pro-apoptotic effects on germ cells, which raises the possibility that the phar- macological inhibition of NF-jB could be a therapeutic target in transient stress situations involving excessive germ cell death [31]. NF-jB activation in the present study was consistent with the increase in concentration of H 2 O 2 exposure, which may act as a proapoptotic factor (Fig. 7C). Our findings are also in agreement with similar studies in Jukat and HeLa cells, where it was demonstrated that increased p53 expression was dependent on the functional activation of NF-jB because the apoptosis-inducing ability of NF-jB pre- sumably relies on an induced elevated expression of death effector genes such as p53 [15]. This is supported by the fact that radiation induced NF-jB activation is proapoptotic because c-irradiation preferentially targets rapidly dividing cells towards apoptosis [32]. MAP kinases are also activated primarily by cyto- kines or exposure to extracellular stress including H 2 O 2 . JNK and p38 MAP kinases are important medi- ators of stress-inducing signals and oxidative stress may be responsible for activation of MAP kinases, leading to apoptosis [33–35]. The results obtained in the present study also demonstrate that H 2 O 2 induces the activation of JNK and p38 in the treated testicular germ cells. This is in agreement with the previously reported evidence indicating that p38 MAP kinase plays an important role in the regulation of mitochon- dria-dependent apoptosis, which is crucial with respect to male germ cell death in rats after hormonal deprivation by potent gonadotrophin-releasing hor- mone antagonist treatment [36,37]. In conclusion, the present study is the first to dem- onstrate that H 2 O 2 induces germ cell apoptosis and triggers all the possible pathways of metazoan apop- tosis, a representative model of which is depicted in Fig. 8. The death signal triggered by H 2 O 2 at very low concentrations signifies its importance as a regulatory biomolecule in testicular germ cell apoptosis, although Fig. 8. A proposed model depicting the pathways of H 2 O 2 -induced germ cell apoptosis. The metazoan apoptosis model as proposed by Hengartner [10] has now been updated to include the findings on the pathways leading to testicular germ cell apoptosis, as observed in the present study. H 2 O 2 and testicular cell apoptosis A. Maheshwari et al. 876 FEBS Journal 276 (2009) 870–881 ª 2009 The Authors Journal compilation ª 2009 FEBS its role and interactions in normal testicular physiology need to be explored further. Experimental procedures Animals Adult male albino rats (Holtzman strain) weighing 180– 200 g were used. The animals were maintained under con- trol temperature (25 ± 2 °C) and constant photoperiod (12 : 12 h light ⁄ dark cycle) with food and water available ad libitum. Animal experiments were carried out in strict compliance with the Institutional Guidelines for Animal Care. Isolation of testicular cells A two-step enzymatic method was used with a few modifi- cations [38]. Briefly, Hank’s balanced salt solution (HBSS) containing 0.44 mm KH 2 PO 4 , 137 mm NaCl, 5.36 mm KCl, 4.2 mm NaHCO 3 , 0.44 mm KH 2 PO 4 and 5 mm glucose was prepared and sterilized by passing through a 0.22 lm filter (Millipore, Billerica, MA, USA). The excised testis was rinsed in HBSS and the tunica albuginea along with other visible connective tissues were removed. The seminiferous tubule mass was transferred to fresh HBSS containing 0.25 mgÆmL )1 collagenase and kept for 15 min at 34 °C with constant shaking. The dispersed seminiferous tubules were allowed to sediment and washed three times in the fresh HBSS, which largely removed contamination from interstitial and blood cells. The isolated tubules were sub- jected to trypsin (1.25 mgÆmL )1 ) and DNaseI (50 lgÆmL )1 ) treatment for 10 min. The resultant crude cell suspension was filtered through organza, washed after centrifugation at 500 g for 5 min at room temperature and resuspended in medium-199 containing 100 lgÆmL )1 streptomycin sulfate and 100 IUÆmL )1 penicillin. The cell viability of the final crude population that contained mostly maturing germ cells was in excess of 95%. H 2 O 2 treatment The isolated testicular germ cells (5 · 10 6 cellsÆmL )1 per tube) were incubated for 1 h at 34 °C with or without H 2 O 2 in medium-199. Incubations with H 2 O 2 were made at final concentrations of 0, 1, 2, 5 and 10 lm. The treated cells were washed in NaCl ⁄ P i and stored at )20 °C until further use. Approximately 75% cells were viable in the group exposed to 10 lm H 2 O 2 . DNA ladder assay To determine the inter-nucleosomal DNA fragments gener- ated during cell death, total cellular DNA was isolated by treating the cell pellet with 500 lL of lysis buffer (50 mm Tris–Cl, pH 8.0, 20 mm EDTA, 10 mm NaCl and 1% SDS) for 30 min at 4 °C. The suspension was centrifuged at 12 000 g for 10 min and the supernatant was extracted with phenol ⁄ chloroform ⁄ isoamyl alcohol (25 : 24 : 1) and centri- fuged at 12 000 g for 5 min. The upper phase was collected, treated with a 1 : 10 volume of 3 m sodium acetate (pH 5.2) and an equal volume of absolute ethanol for 2 h at )20 °C to precipitate DNA, and centrifuged at 15000 g at 4 °C for 30 min. The pellet was washed with 70% etha- nol, air dried and resuspended in TE buffer containing RNase (20 lgÆmL )1 ) for 30 min at 37 °C. Equal amount of samples were loaded to 1.5% agarose gel containing 0.5 lgÆmL )1 of ethidium bromide and visualized through gel documentation system (UVP Inc., Upland, CA, USA). ISEL assay ISEL was carried out in accordance with the manu- facturer’s instructions (R&D Systems, Minneapolis, MN, USA). Briefly, pre-washed cells were smeared on poly-l- lysine coated slides and fixed in 4% formaldehyde. Cells were treated with cytonin for 10 min followed by quenching with H 2 O 2 . Biotinylated nucleotides were incorporated into the 3¢-OH ends of the DNA fragments by TdT, and detected by using streptavidin-horseradish peroxidase (HRP). The colour was developed by diaminobenzidine (DAB) solution and later counter stained with methyl green. ISEL positive cells were examined using a Nikon microscope (Nikon, Tokyo, Japan) and the percentage apoptosis was calculated. Lipid peroxidation and antioxidant enzymes activity Treated or untreated testicular germ cells were sonicated for 30 s and divided into two equal parts. One part was assayed for lipid peroxidation through the formation of thiobarbituric acid reactive substances in the reaction mixture, as described previously [39]. The second part was centrifuged at 10 000 g for 5 min and the supernatant was assayed for antioxidant enzyme activity. SOD was mea- sured as described previously [40]. Catalase was estimated by the degradation of hydrogen peroxide (6 mm), as described previously [41]. GST activity towards 1-chloro- 2,4-dinitrobenzene was measured in accordance with the method of Habig et al. [42]. Protein was estimated by the Bradford assay. TAC Testicular germ cells treated with or without H 2 O 2 were assessed for TAC in accordance with the manufacturer’s instructions (Cayman Chemical Company, Ann Arbor, MI, A. Maheshwari et al. H 2 O 2 and testicular cell apoptosis FEBS Journal 276 (2009) 870–881 ª 2009 The Authors Journal compilation ª 2009 FEBS 877 USA). The assay relies on the ability of combined antioxi- dants (vitamin, protein, lipids, glutathione, uric acid, etc.) present in the cell lysate to inhibit the oxidation of 2,2-azi- no-di-(3-ethylbenzthiazoline sulfonate) (ABTS) to the oxi- dized form of ABTS by metmyoglobin. The amount of oxidized ABTS produced was measured at 750 nm. Trolox standards were used and total antioxidant capacity (mm) was estimated using the standard value. Caspase-3 activity Activity of caspase-3 was assayed in accordance with the manufacturer’s instructions supplied with the caspase-3 col- orimetric assay kit (Alexis, San Diego, CA, USA). Briefly, germ cells were resuspended in cold lysis buffer and incu- bated for 10 min. Cell lysates were centrifuged for 2 min at 10 000 g at 4 °C. Supernatant (75 lg of protein per 50 lL) was added to 50 lL of reaction buffer containing 200 lm of chromogen (Ac-DEVD-pNA), kept at 37 °C for 2 h and terminated. The increase in A 405 due to the release of p-nitroanilide was measured using micro-titre plate reader (BioTek Inc., Winooski, VT, USA). Western blot analysis Primary antibodies (rabbit polyclonal) for anti-PARP, anti-caspase-9, anti-Bid, anti-Bak, anti-Bad, anti-JNK, anti-NF-jB, anti-cytochrome c, anti-Fas, anti-FasL and anti-p53-HRP and primary antibodies (mouse monoclonal) for anti-caspase-8, anti-pJNK, anti-Bcl-2 and anti-b-actin (Santa Cruz Biotechnology, Santa Cruz, CA, USA) were utilized. Anti-phospho-p38, a rabbit polyclonal primary antibody was obtained from R&D Systems. Goat anti-rab- bit ⁄ mouse-HRP conjugate secondary serum was obtained from Santa Cruz Biotechnology. Whole cell lysates were prepared in 200 lL of lysis buffer containing 20 mm Hepes (pH 7.4), 2 mm EDTA, 50 mm b-glycerophosphate, 1% Triton X-100, 150 mm NaCl, 10% glycerol and protease inhibitor cocktail (Roche, Basel, Switzerland). Lysates were clarified by centrifugation at 15 000 g at 4 °C for 20 min and the protein concentration of the supernatant was deter- mined by the Bradford assay. For SDS ⁄ PAGE, protein lysates were mixed with Laemmli sample buffer (Bio-Rad, Herculus, CA, USA) and boiled for 10 min. Total protein was separated on a 12 ⁄ 15% gel and transferred to nitrocel- lulose membrane (Millipore). After blocking in NaCl ⁄ Tris- T (20 mm Tris–HCl, 137 mm NaCl, 0.1% Tween 20, pH 7.6) with 5% skimmed milk, membranes were incubated with the primary antibodies (1 : 1000) diluted in NaCl ⁄ - Tris-T for 2 h at room temperature. Next, membranes were washed three times with NaCl ⁄ Tris-T, and incubated for an additional 2 h with HRP linked secondary antibody (1 : 2000) diluted in NaCl ⁄ Tris-T. Again, membranes were washed three times with NaCl ⁄ Tris and labelled protein bands were visualized with the DAB system (Bangalore Genei, Bangalore, India). b-actin was used to monitor equal loading of protein. Densitometric analysis (see Table S1) was performed with the help of Image analysis software (lab works image analysis software, version 4.0; UVP Inc.). Table 1. Primer-specific conditions used for PCR amplification of candidate genes. Name Primer sequence (5¢-to3¢) Reference ⁄ accession no. Mg 2+ concentration (m M) Annealing temperature ( o C) Product size (bp) Mn SOD Forward: CTTCAGCCTGCACTGAAGTTCAAT Reverse: CTGAAGATAGTAAGCGTGCTCCC [43] 2.5 65 326 Cu ⁄ Zn SOD Forward: GAGCATGGGTTCCATGTCCAT Reverse: ACTTTCTTCATTTCCACCTTTGCC [43] 2.5 62 277 Catalase Forward: CCGACGAGATGGCACACTTTGACA Reverse: CGCGAGCACGGTAGGGACAGTTC [26] 2.5 62 972 Bax-a R&D Systems (RDP-43) U49729 2.5 62 482 Bcl-2 R&D Systems (RDP-44) U34964 2.5 60 293 p53 R&D Systems (RDP-144) X13058 2.5 62 397 Caspase-8 Forward: CTGGGAAGGATCGACGATTA Reverse: CATGTCCTGCATTTTGATGG [20] 2.5 62 123 Caspase-9 Forward: AGCCAGATGCTGTCCCATAC Reverse: CAGGAGACAAAACCTGGGAA [20] 2.5 65 132 Fas Forward: GCAATGCTTCTCTCTGTGACCACT Reverse: GCTGTTGTGCTCGATCTCATCG [44] 3.5 65 351 FasL Forward: GGAATGGGAAGACACATATGGAACTGC Reverse: CATATCTGGCCAGTAGTGCAGTAATTC [45] 1.5 65 238 b-Actin Forward: CTGTGCCCATCTATGAGGGTTAC Reverse: AATCCACACAGAGTACTTGCGCT [46] 2.5 60 539 H 2 O 2 and testicular cell apoptosis A. Maheshwari et al. 878 FEBS Journal 276 (2009) 870–881 ª 2009 The Authors Journal compilation ª 2009 FEBS RNA isolation and RT-PCR analysis Total RNA was extracted using TRI-Reagent (Ambion, Austin, TX, USA). cDNA was synthesized from 2 lgof total RNA using the omniscript RT kit (Qiagen, Hilden, Germany). Two microliters of the RT reaction was then used for PCR using the HotStar HiFidelity DNA poly- merase (Qiagen). The PCR reactions were carried out under the temperature profile: (a) denaturation at 95 °C for 15 min; (b) 30 cycles of 95 °C for 30 s, 60–65 °C for 1 min and 72 °C for 1 min; and (3) a final extension for 10 min at 72 °C. The sequence, source, annealing temper- ature, Mg 2+ concentration and product size of primers are shown in Table 1. After amplification, the products were separated on 1.5% agarose and documented with the help of a gel documentation system (UVP Inc.). b-actin was used as an internal control. Densitometric analysis was performed as previously described (see Table S2). Statistical analysis All the experiments were repeated three times. Error bars represent the SD. Statistical analysis was performed using an unpaired Student’s t-test. P < 0.05 was considered statistically significant. Acknowledgements A Junior Research Fellowship to Ankur Maheshwari from the Council of Scientific and Industrial Research (CSIR), New Delhi, India, is greatly acknowledged. References 1 Kerr JB (1992) Spontaneous degeneration of germ cells in normal rat testis: assessment of cell types and fre- quency during the spermatogenic cycle. J Reprod Fertil 95, 825–830. 2 Tapanainen JS, Tilly JL, Vihko KK & Hsueh AJW (1993) Hormonal control of apoptotic cell death in the testis: gonadotropins and androgens as testicular cell survival factors. Mol Endocrinol 7, 643–650. 3 Peltola V, Huhtaniemi I & Ahutopa M (1992) Antioxi- dant enzyme activity in the maturing rat testis. J Androl 13, 450–455. 4 Aitken RJ, Gordon E, Harkiss D, Twigg JP, Milne P, Jennings Z & Irvine DS (1998) Relative impact of oxi- dative stress on the functional competence and genomic integrity of human spermatozoa. Biol Reprod 59, 1037– 1046. 5 Hampton MB & Orrenius S (1997) Dual regulation of caspase activity by hydrogen peroxide:implications for apoptosis. FEBS Lett 414, 552–556. 6 Genestra M (2007) Oxyl radicals, redox-sensitive signal- ling cascades and antioxidants. Cell Signal 19, 1807– 1919. 7 Sinha-Hikim AP, Lue Y, Diaz-Romero M, Yen PH, Wang C & Swerdloff RS (2003) Deciphering the path- ways of germ cell apoptosis in the testis. J Steroid Bio- chem Mol Biol 85, 175–182. 8 Nagata S & Golstein P (1995) The Fas death factor. Science 267, 1449–1456. 9 Cory S & Adams JM (2002) The Bcl2 family: regulators of the cellular life-or-death switch. Nat Rev Cancer 2, 647–656. 10 Hengartner MO (2000) The biochemistry of apoptosis. Nature 407, 770–776. 11 Gautam DK, Misro MM, Chaki SP & Sehgal N (2006) H 2 O 2 at physiological concentrations modulates leydig cell function inducing oxidative stress and apoptosis. Apoptosis 11, 39–46. 12 Gautam DK, Misro MM, Chaki SP, Kaushik M & Sehgal N (2007) hCG treatment increases H 2 O 2 levels and induces germ cell apoptosis in the rat testis. Apop- tosis 12(7), 1173–1182. 13 Gechev TS & Hille J (2005) Hydrogen peroxide as a signal controlling plant programmed cell death. J Cell Biol 168, 17–20. 14 Kim DK, Cho ES & Um HD (2000) Caspase dependent and independent events in apoptosis induced by hydro- gen peroxide. Exp Cell Res 257, 82–88. 15 Dumont A, Hehner SP, Hofmann TG, Ueffing M, Droge W & Schmitz ML (1999) Hydrogen peroxide- induced apoptosis is CD95-independent, requires the release of mitochondria-derived reactive oxygen species and the activation of NF-kB. Oncogene 18, 747–757. 16 Atorino L, Di Meglio S, Farina B, Jones R & Quesada P (2001) Rat germinal cells require PARP for repair of DNA damage induced by gamma-irradiation and H 2 O 2 treatment. Eur J Cell Biol 80, 222–229. 17 Chaki SP, Ghosh D & Misro MM (2003) Simultaneous increase in germ cell apoptosis and oxidative stress under acute unilateral testicular ischemia in rats. Intl J Androl 26, 319–328. 18 Chaki SP, Misro MM, Ghosh D, Gautam DK & Srinivas M (2005) Apoptosis and cell removal in the cryptorchid rat testis. Apoptosis 10, 395–406. 19 Eid NAS, Shibata M-A, Ito Y, Kusakabe K, Ham- mad H & Otsuki Y (2002) Involvement of Fas system and active caspases in apoptotic signaling in testicular germ cells of ethanol-treated rats. Int J Androl 25, 159–167. 20 Huang W, Dobberfuhl A, Filippopoulos T, Ingelsson M, Fileta JB, Poulin AR & Grosskreutz CL (2005) Transcriptional up regulation and activation of initiat- ing caspases in experimental glaucoma. Am J Pathol 167, 673–681. A. Maheshwari et al. H 2 O 2 and testicular cell apoptosis FEBS Journal 276 (2009) 870–881 ª 2009 The Authors Journal compilation ª 2009 FEBS 879 [...]... during testicular development in the rat and pro-survival effect of stem cell factor on germ cells in vitro Mol Cell Endocrinol 165, 115–129 25 Richburg JH (2000) The relevance of spontaneousand chemically -induced alterations in testicular germ cell apoptosis to toxicology Toxicol Lett 112, 113, 79– 86 26 Jang JH & Surh YJ (2004) Bcl-2 protects against Ab25– 35 -induced oxidative PC12 cell death by. .. Oltvai ZN, Yin XM, Milliman CL & Korsmeyer SJ (1993) Bcl-2 functions in an antioxidant pathway to prevent apoptosis Cell 75, 241–251 28 Carmody RJ & Cotter TG (2001) Signalling apoptosis: a radical approach Red Report 6, 77–90 29 Chandrasekaran Y & Richburg JH (2005) The p53 protein in uences the sensitivity of testicular germ cells to mono-(2-ethylhexyl) phthalate -induced apoptosis by increasing the membrane... synthase in apoptotic signaling of murine and human male germ cells after hormone deprivation Mol Endocrinol 20, 1597– 1609 Ikeda M, Kodama H, Fukuda J, Shimizu Y, Murata M, Kumagai J & Tanaka T (1999) Role of radical oxygen species in rat testicular germ cell apoptosis induced by heat stress Biol Reprod 61, 393–399 Ohkawa H, Ohishi N & Yagi K (1979) Assay for lipid peroxidation in animal tissues by thiobarbituric... membrane levels of Fas and DR5 and decreasing the intracellular amount of c-FLIP Biol Reprod 72, 206–213 30 Delfino F & Walker WH (1999) Hormonal regulation of the NF-jB signaling pathway Mol Cell Endocrinol 157, 1–9 31 Pentikainen V, Suomalainen L, Erkkila K, Martelin E, Parvinen M, Pentikainen MO & Dunkel L (2002) Nuclear factor-kappa B activation in human testicular apoptosis Am J Pathol 160, 205–218 32... following androgen withdrawal: changes in apoptosis related genes Biol Reprod 60, 461–470 23 Rodriguez I, Ody C, Araki K, Garcia I & Vassalli P (1997) An early and massive wave of germinal cell apoptosis is required for the development of functional spermatogenesis EMBO J 16, 2262–2270 24 Yan W, Suominen J, Samson M, Jegou B & Toppari J (2000) Involvement of Bcl-2 family proteins in germ cell apoptosis. .. 2009 FEBS A Maheshwari et al Supporting information The following supplementary material is available: Table S1 Densitometric analysis showing the ratio of different protein expression to b-actin Table S2 Densitometric analysis of RT-PCR the showing the ratio of the gene to b-actin H2O2 and testicular cell apoptosis This supplementary material can be found in the online version of this article Please... Suppression of extracellular signal-related kinase and activation of p38 MAPK are two critical events leading to caspase-8- and mitochondria-mediated cell death in phytosphingosine-treated human cancer cells J Biol Chem 278, 50624–50634 Vera Y, Erkkila K, Wang C, Nunez C, Kyttanen S, Lue Y, Dunkel L, Swerdloff RS & Sinha-Hikim AP (2006) Involvement of p38 mitogen-activated protein kinase and inducible nitric... P, & Daval JL (2001) Intracellular generation of free radicals and modifications of detoxifying enzymes in cultured neurons from the developing rat forebrain in response to transient hypoxia Neuroscience 105, 287–297 Tolba RH, Schildberg FA, Schnurr C, Glatzel U, Decker D & Minor T (2006) Reduced liver apoptosis after venous systemic oxygen persufflation in non-heartbeating donors J Invest Surg 19, 219–227... Invest Surg 19, 219–227 Lee J, Richburg JH, Younkin SC & Boekelheide K (1997) The Fas system is a key regulator of germ cell apoptosis in the testis Endocrinology 138, 2081–2088 Ohsako S, Kubota K, Kurosawa S, Takeda K, Qing W, Ishimura R & Tohyama C (2003) Alterations of gene expression in adult male rat testis and pituitary shortly after subacute administration of the antiandrogen flutamide J Reprod... 38 39 40 41 42 43 44 45 46 indole-3-acetic acid ⁄ horshradish peroxidase -induced apoptosis FEBS Lett 580, 1439–1446 Lee MW, Park SC, Yang YG, Yim SO, Chae HS, Bach JH, Lee HJ, Kim KY, Lee WB & Kim SS (2002) The involvement of reactive oxygen species (ROS) and p38 mitogen activated protein (MAP) kinase in TRAIL ⁄ Apo2L -induced apoptosis FEBS Lett 512, 313–318 Park MT, Choi JA, Kim MJ, Um H-D, Bae S, . Pathways involved in testicular germ cell apoptosis induced by H 2 O 2 in vitro Ankur Maheshwari 1 , Man M. Misro 1 ,. there are different pathways involved in testicular germ cell apoptosis pertaining to specific treatments. As previ- ously shown [7], testicular cell apoptosis follows