bài tập 4 lập bảng các niên đại về thắng lợi của ta trong chiến tranh đặc biệt
kiểm tra 45 phút lần 4 -k 10
... If we miss the bus, we a taxi ( will take, are going to take, are taking, take) 13.This kind of music was very in the 1 940 s.(loked, popular, preferred, favourite) 14 Look at that big black cloud ... bike d I’m fine, thanks 42 For the past five years she a lot of things a have done b c did d has done 43 .How long does it to get there? a cost b lose c make d take 44 He was completely with ... have to C will D am going to 53.It's possible a train across Canada a take b to take c taking d to be taken 54 I saw horrible car accident on the way to work yesterday a one b the c...
- 12
- 419
- 2
Mẫu báo cáo đánh giá hồ sơ dự thầu đối với gói thầu dịch vụ tư vấn
... lễ mở HSĐX kỹ thuật [Đại diện bên mời thầu, đại diện nhà thầu, đại diện quan liên quan tham dự lễ mở HSĐX kỹ thuật ký] Mẫu số KIỂM TRA VỀ TÍNH HỢP LỆ VÀ SỰ ĐẦY ĐỦ CỦA HSĐX KỸ THUẬT HSĐX kỹ ... HSĐX tài [Đại diện bên mời thầu, đại diện nhà thầu, đại diện quan liên quan tham dự lễ mở HSĐX tài ký] Mẫu số ĐÁNH GIÁ VỀ ĐÁP ỨNG CÁC ĐIỀU KIỆN TIÊN QUYẾT CỦA HSĐX TÀI CHÍNH HSĐX tài nhà thầu ... nhân (nếu có) lý thay đổi b) Cách thức làm việc tổ chuyên gia đấu thầu Phần nêu rõ cách thức làm việc tổ chuyên gia đấu thầu theo nhóm hay độc lập trình đánh giá cách thức đánh giá HSDT trường...
- 21
- 412
- 1
báo cáo khoa học: " Seroprevalence of HIV, hepatitis b, and hepatitis c among opioid drug users on methadone treatment in the netherlands" ppt
... 13 (11%) - 40 - 49 19 (61%) 14 (70%) 47 (50%) 170 (49 %) 65 (57%) - ≥50 (29%) (25%) 37 (40 %) 1 24 (35%) 33 (29%) *Data of 2006-2008, **Data of 2003-2008, ***Data of 20 04- 2008 ξ No data on demographics ... vaccination coverage N (%) Amsterdam* 20 24 680 ( 34% ) 225 (33%) 146 9 (92%)*** Heerlen** 287 197 (69%) 93 (48 %) 130 (45 %) *Data of 2006-2008, **Data of 2003-2008, ***Data of 2002-2008 Schreuder et al ... substitution treatment started in Heerlen around 1997 [ 24] Amsterdam started voluntary screening for HIV, HBV and HCV at its methadone posts in 2002 For this study, data from the HIV and HBV...
- 7
- 340
- 0
Tài liệu Báo cáo khoa học: Effect of deletion of the DNase I hypersensitive sites on the transcription of chicken Ig-b gene and on the maintenance of active chromatin state in the Ig-b locus docx
... Clayton AL, Thorne AW & Crane-Robinson C (2001) Targeted and extended 43 2 H Matsudo et al 38 39 40 41 42 43 44 45 46 47 48 acetylation of histones H4 and H3 at active and inactive genes in chicken ... DNA ( )4. 6 kb to )3.7 kb; nucleotides 849 –1751 in accession number AB066568) (A,B) [ 34] , 1.2 kb Ig-b cDNA (nucleotides 312–1 542 ; PmaCI ⁄ EcoRI) [ 34] (C) or 0.2 kb GH exon (nucleotides 3515–3 744 in ... Cell Biol 23, 52 34 5 244 Durrin LK, Weber JL & Gorski J (19 84) Chromatin structure, transcription, and methylation of the prolactin gene domain in pituitary tumors of Fischer 344 rats J Biol Chem...
- 11
- 638
- 0
Tài liệu An Account of the Proceedings on the Trial of Susan B. Anthony doc
... was for Representatives in the Congress of the United States, to-wit: a Representative in the Congress of the United States for the State of New York at large, and a Representative in the Congress ... was for Representatives in the Congress of the United States, to-wit: a Representative in the Congress of the United States for the State of New York at large, and a Representative in the Congress ... representative in the Congress of the United States, to represent the 29th Congressional District of this State, and also for a representative at large for the State of New York, to represent the State...
- 122
- 442
- 0
Tài liệu Báo cáo Y học: The effects of ring-size analogs of the antimicrobial peptide gramicidin S on phospholipid bilayer model membranes and on the growth of Acholeplasma laidlawii B ppt
... order GS 14 > GS10 > GS12 Moreover, GS 14 decreases the enthalpy of the main phase transition of Myr2Gro-PGro substantially whereas GS12 and GS10 actually appear to slightly increase the total enthalpy ... decrease in the order GS12 > GS 14 > GS10, based on the ratios of the number of charged polar Lys residues to hydrophobic Val and Leu residues (4 : 4, : and : 4, respectively), the actual measured ... grants from the Alberta Heritage Foundation for Medical Research MK was supported in part by a Hungarian Eotvos Fellowship ¨ ¨ REFERENCES Gause, G.G & Brazhnikova, M.G (1 944 ) Gramicidin S and...
- 10
- 683
- 0
Báo cáo khoa học: Structures of type B ribose 5-phosphate isomerase from Trypanosoma cruzi shed light on the determinants of sugar specificity in the structural family ppt
... 250 262 259 260 259 255 257 168 0.9 0.9 0. 94 0.86 0. 84 0. 84 0.82 0. 84 0.85 1.17 43 42 45 40 40 39 40 40 42 28 149 0 2 940 , 1320a 1611 1990 SpRpiB 1NN4 2VVR 1O1X 1USL 2BES 2BET 2VVP 2VVQ 2VVO 2PPW ... Glycerol 159 148 – 258 0.0 0.72 100 48 1700 1939 1200 973 3HEE R5P 148 262 0.73 48 1938 986 Pi –b MPD Pi 4PEH 4PEA R5P ⁄ Ru5P 4PRH All6P SO4 150 149 155 170 172 172 162 162 162 216 255 2 64 250 262 ... 29 .4 2.15 (2.27–2.15) 131 7 84 20 303 6.5 (6.5) 90.3 (92.8) 0.108 (0.283) 15.9 (4. 3) 23.5 TcRpiB-C69A ⁄ All6P Using the parameters of Engh and ESRF ID 14: 2 ⁄ ADSC Q4 CCD P42212 92 .4, 92 .4, 94. 0...
- 16
- 401
- 0
Báo cáo khoa học: NMR studies on the interaction of sugars with the C-terminal domain of an R-type lectin from the earthworm Lumbricus terrestris pot
... dimensions were referenced to internal 4, 4-dimethyl -4- silapentane-1-sulfate, and 13C and 15 N were indirectly referenced to 4, 4-dimethyl -4- silapentane-1-sulfate [46 ] All multidimensional NMR spectra ... High-resolution crystal structures of the lectin-like xylan binding domain from Streptomyces lividans xylanase 10A with bound substrates reveal a novel mode of xylan binding Biochemistry 41 , 42 46– 42 54 Li M, ... Microbiology 149 , 3361–3370 ´ Nesˇ ic D, Hsu Y & Stebbins CE (20 04) Assembly and function of a bacterial genotoxin Nature 42 9, 42 9 43 3 Yamada T, Komoto J, Saiki K, Konishi K & Takusagawa F (2006)...
- 11
- 458
- 0
Báo cáo khoa học: Effect of magnesium ions on the activity of the cytosolic NADH/cytochrome c electron transport system pptx
... [7]) NADH oxidation was determined spectrophotometrically at 340 –3 74 nm (e = 4. 28 mm)1Æcm)1) and the redox state of cyto-c at 548 – 540 nm (e = 21 mm)1Æcm)1) to minimize the interference of cyto-b5 ... to the findings obtained when Mg2+ is added after the mitochondria ([7] and Fig 2), and the oxidation rate of NADH is also decreased from 45 49 to 24 nmolÆmin)1Æmg)1 (Fig 1) Tentatively, it could ... 4, trace e) and magnesium decreases this rate only when present in the medium (Fig 4, trace f), but has no effect when added after the mitochondria (Fig 4, trace e) The data reported in Fig 4B...
- 12
- 441
- 0
Báo cáo khóa học: CD38 is expressed as noncovalently associated homodimers on the surface of murine B lymphocytes doc
... CD38-G68E, primer 2: 5¢-(CCCTCTAGACCAGATCCTTCACGTATTAAGTC TACACG)-3¢; CD38-G68E, primer 3: 5¢-(GATGAGGC AGCGCTCGagGAAGATGTC)-3¢; CD38-G68E, primer 4: 5¢-(GGGGAATTCATGGCTAACTATGAATTTAGC CAG)-3¢ The E150L ... Mutant Vmax (nmolÆmin)1Æmg)1 protein) Protein per cell (mg protein per cell · 10)7) CD38 per cell arbitrary units CD38 per cell (1/MFI · 10 )4) WT E150L G68E lATG 843 .2 5. 54 56.9 2 84. 1 1. 54 1. 54 ... presented in Table 1, indicates that CD38 homodimers were present in the lysates of most of the transfectants expressing CD38 mutants, including, CD38-E150L, a CD38 active site mutant (Table 2, [ 34] )...
- 10
- 448
- 0
Báo cáo khoa học: Structural and serological studies on a new 4-deoxy-D-arabino-hexosecontaining O-specific polysaccharide from the lipopolysaccharide of Citrobacter braakii PCM 1531 (serogroup O6) pptx
... fi3 ,4) -b-L-Rhap-(1fi fi3)-a-D-FucpII-(1fi a-D-ara4dHexp-(1fi H1 5.07 4. 97 4. 98 5.10 H2 3.85 5.66 3. 84 3 .47 H3 4. 10 4. 06 3. 84 4.06 H4 3.96 3. 94 3.98 1.76a H5 4. 26 3.58 4. 02 3.97 H6 1.21 1 .40 1.26 3. 64 ... protons: FucII H1/Rha H3, Rha H1/FucI H3 and ara4dHex H1/Rha H4 at d 4. 98 /4. 06, 4. 97 /4. 10 and 5.10/ 3. 94, respectively FucI H1 gave a cross-peak at d 5.07/3. 84, which could be assigned to a superposition ... 15 04, PCM 1505 and PCM 148 7 were obtained following treatment with proteinase K [11] The LPS from strains PCM 148 7, PCM 148 8 and PCM 1525 were as isolated previously [12– 14] In order to obtain...
- 7
- 478
- 0
Báo cáo hóa học: " Effect of Interfacial Bonds on the Morphology of InAs QDs Grown on GaAs (311) B and (100) Substrates" potx
... 10.1016/j.jcrysgro.2006.05. 046 17 B.A Joyce, D.D Vvedensky, Mater Sci Eng Rep 46 , 127 (20 04) doi:10.1016/j.mser.20 04. 10.001 18 S Sanguinetti et al., Europhys Lett 47 , 701 (1999) doi:10.1209/ epl/i1999-0 044 6-x 19 ... height, lateral size, and the standard statistics error of height and lateral size of these two samples are 4. 4 1010 cm-2 and 3.6 1010 cm-2; 10.3(±2.58)nm and 6.2(±0 .46 )nm; 145 (±6.58)nm and 130(±5.8)nm ... Res Lett (2009) 4: 689–693 Z.M Ye et al., J Appl Phys 92, 41 41 (2002) doi:10.1063/ 1.15 041 67 M.T Todaro et al., IEEE Photon Technol Lett 19, 191 (2007) doi:10.1109/LPT.2006.890 045 E.T Kim et al.,...
- 5
- 326
- 0
Báo cáo lâm nghiệp: "The effects of lifting on mobilisation and new assimilation of C and N during regrowth of transplanted Corsican pine seedlings. A dual 13C and 15N labelling approach" docx
... 1.05 ± 0. 04 1.22 ± 0.07 1.22 ± 0.07 * ns ns 35.5 ± 1 .4 42.8 ± 2 .4 42.0 ± 2.1 42 .7 ± 2.2 44 .3 ± 2.8 40 .4 ± 2 .4 ns ns ns C:N ratio Needles 41 .4 ± 1.7 Old stem 82.0 ± 4. 4 71.6 ± 6.0 77.6 ± 4. 0 63.5 ... 2 .4 *** ns ns New roots 22.7 ± 1.3 19.8 ± 2 .4 22.0 ± 0.3 17.5 ± 1.6 15.7 ± 0.5 17.8 ± 1.3 15.5 ± 0.6 *** ns ns Whole seedling 46 .0 ± 2.0 45 .8 ± 2 .4 45.3 ± 1.8 44 .6 ± 2.7 46 .2 ± 2.0 40 .4 ± 2 .4 40.9 ... 5.7 74. 3 ± 4. 8 66.0 ± 5.3 53.2 ± 2.8 * ns ns Old roots 57.2 ± 3.9 44 .7 ± 2.6 42 .4 ± 2.2 43 .7 ± 3.9 42 .4 ± 2.3 39.2 ± 1.6 40 .7 ± 1.3 *** ns ns New shoot 18.0 ± 1.2 21.9 ± 0.9 22.0 ± 0.7 34. 0 ±...
- 11
- 399
- 0
Báo cáo y học: "Alterations in peripheral blood memory B cells in patients with active rheumatoid arthritis are dependent on the action of tumour necrosis factor" potx
... DAS 44 5.2 ± 0 .4 4 .4 ± 0 .4* 5.8 ± 0.5 3.9 ± 0.5* RF (IU) 210.1 ± 117.9 146 .4 ± 80 .4 396.2 ± 178 .4 257.3 ± 142 .8* CRP (mg/dl) 0.8 ± 0.3 0.6 ± 0.2 1.8 ± 0.5 1.1 ± 0.3 ESR (mm/hour) 36.9 ± 5 .4 31.9 ... 36.9 ± 5 .4 31.9 ± 5.0 60.2 ± 8.1 44 .2 ± 5.5* SJC 19.6 ± 4. 6 14. 0 ± 3.0 21.9 ± 3.1 11.6 ± 2 .4* TJC 25.8 ± 4. 9 16.0 ± 4. 3* 27.0 ± 4. 5 12.1 ± 3 .4* Data are means ± standard error of the mean * P < ... separately T cells (CD3+) were gated, and the precentages of CD4+ (total helper), CD8+ (total cytotoxic), CD4+CD45RA+ (total naïve helper) and CD4+CD45R0+ (total memory helper) populations within the T...
- 12
- 349
- 0
Báo cáo y học: "Early Characterization of Toll-like receptors in primary lung epithelial cells: strong impact of the TLR3 ligand poly(I:C) on the regulation of Toll-like receptors, adaptor proteins and inflammatory response" ppt
... 5'-CCCGGTGTGGCCATTGCTGC-3' 5'-GCACTTTTATCAATTGGCTTAATCAC-3' 5'-AACGAGTCAGGGTACACACAATATATG-3' 5'-CAATGTCACTATAGCTGGGCCTCCTGCAG-3' 5'-CAGTGCTCTTACCCAGATGGA-3' 5'-TCTGATAATCGATGACAGACTTCA-3' 5'-CTGCCTGTGTTTCAATTCACGAAGCT-3' ... 5'-CCTGGTTTGTTAATTGGATTAACGA-3' 5'-GAGGTGGAGTGTTGCAAAGGTAGT-3' 5'-CCCATACCAACATCCCTGAGCTGTCAA-3' 5'-AGCTCTGCCTTCACTACAGAGACTT-3' 5'-GCTTTTATGGAAACCTTCATGGA-3' 5'-CCCGGTGTGGCCATTGCTGC-3' 5'-GCACTTTTATCAATTGGCTTAATCAC-3' ... 275:23 340 -5 Hatao F, Muroi M, Hiki N, Ogawa T, Mimura Y, Kaminishi M, Tanamoto K: Prolonged Toll-like receptor stimulation leads to down-regulation of IRAK -4 protein J Leukoc Biol 20 04, 76:9 04- 8...
- 15
- 374
- 0
Báo cáo y học: "Potential role and mechanism of IFN-gamma inducible protein-10 on receptor activator of nuclear factor kappa-B ligand (RANKL) expression in rheumatoid arthritis" pptx
... Hasegawa M, Takehara K, Kamatain N: Serum levels of a Th1 chemoattractant IP-10 and Th2 chemoattractants, TARC and MDC, are elevated in patients with systemic sclerosis J Dermatol Sci 20 04, 35 :43 -51 ... Hospital ( 04- 2007-1010) Author details Division of Rheumatology, Department of Internal Medicine, Seoul National University College of Medicine, 28 Yongon-Dong, Chongno-Gu, Seoul, 110 744 , Republic ... Rheumatoid arthritis (n = 18) 67.20 ± 7.35 57.17 ± 9.51 10:1 17:1 79. 64 ± 62.66 1 14. 85 ± 49 . 54 Treatment, number (percentage) Prednisolone 15 (83%) DMARDs 18 (100%) Methotrexate 16 (89%) Sulfasalazine...
- 8
- 176
- 0
Báo cáo y học: "Endogenous plasma activated protein C levels and the effect of enoxaparin and drotrecogin alfa (activated) on markers of coagulation activation and fibrinolysis in pulmonary embolism." ppt
... 133.7 ± 25 .4 (100.0 to 181.0) Diastolic blood pressure (mmHg) 66 .4 ± 10 .4 (57.0 to 80.0) 86 .4 ± 17.5 (62.0 to 120.0) 82 .4 ± 12.7 (70.0 to 1 04. 0) 68.9 ± 12.0 (50.0 to 85.0) 76.6 ± 14. 3 (60.0 to ... (60.0 to 110.0) Highest heart rate (1/ minute) 83.5 ± 14. 2 (60.0 to 100.0) 95.2 ± 19 .4 (80.0 to 140 .0) 94. 4 ± 17.3 (75.0 to 127.0) 105 .4 ± 21.6 (70.0 to 130.0) 106.6 ± 9.9 (95.0 to 130.0) Earlier ... Table Baseline characteristics of patients included (means ± standard deviation, range) Variable DAA μg/kg/h DAA 12 μg/kg/h DAA 18 μg/kg/h DAA 24 μg/kg/h Placebo n 9 15 Age (years) 70.8 ± 4. 4...
- 10
- 335
- 0
BDHSG TOÁN LỚP 2,3
- 26
- 412
- 1
- bài tập mẫu lập bảng cân đối kế toán
- giải bài tập 4 quản trị rủi ro đại học thương mại
- sach bai tap tai chinh doanh nghiep hien dai ve dinh gia co phan thuong cua tran van tho
- bai tap ket cau thep chuong 3 dai hoc thuy loi
- bai tap hinh khong gian luyen thi dai hoc co loi gia
- bài tập 4 lập một file mới đặt tên sheet 1 là bangdg và điền bảng dữ liệu sau đây
- bài tập 4 tắt bật các lớp trên màn hình
- bài tập 2 lập bảng thống kê các từ đã học
- bài tập 4 gạch bỏ các từ không phù hợp
- đồ dùng dạy học viết sẵn một số tổng tích trong các bài tập 1 lên bảng các tấm bìa ghi sẵn
- bµi tëp bài tập 3 em có nhận xét gì về biểu hiện của một số thanh niên học sinh hiện nay như đua xe máy lười học nghiện ma tuý đua đòi ăn chơi
- bài tập 3 lập bảng cân đối biết
- bài tập 4 lập phương trình hóa học biểu diễn các phản ứng hóa hợp sau
- bài tập 4 chỉ ra các trường từ vựng các trường từ vựng có liên quan đến nhau không ý nghĩa trong bài thơ
- bài 2 hãy viết một đoạn văn nói về ích lợi của một loài cây mà em biết
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25