application of atomic force microscopy as a nanotechnology tool in food science
Báo cáo khoa học: The proximity between C-termini of dimeric vacuolar H+-pyrophosphatase determined using atomic force microscopy and a gold nanoparticle technique ppt
... height values of thecytosolic and luminal sides. In addition, the theoreti-cal ratio of the total amount of amino acids on thecytosolic and luminal sides was calculated as 2.31 : 1(data not ... deduced amino acid identity) [1,3,4]. V-PPaserequires Mg2+ as a cofactor, and the binding of Mg2+Keywords atomic force microscopy; protontranslocation; tonoplast; vacuolarH+-pyrophosphatase; ... The volume of reconstituted V-PPase wasmeasured as 332.9 ± 46.9 nm3(n = 17). The Vprot of a V-PPase homodimer with a molecular mass of 145 kDa, calculated on the basis of the amino acidcomposition,...
- 14
- 332
- 0
Tài liệu Báo cáo khoa học: Dimers of light-harvesting complex 2 from Rhodobacter sphaeroides characterized in reconstituted 2D crystals with atomic force microscopy docx
... ultrasoft tapping-mode AFM was applied in combination with the choice of appropriate buffer forelectrostatic balancing of the AFM tip and thesubstrate. Electrostatically balanced tapping-modeAFM ... zig-zag (areas 1 and 2), disordered (area 3) and dimer (area 4) lattices. (B) Zig-zag lattice (area 2), square lattice (area 5) and dimers(area 6). (C) Zig-zag lattice (area 1) and dimers (area 6). ... different square-packing lattices (Fig. 6A, B). As seen in Fig. 6F, as compared to the zig-zag, 90° square-packing latticesrepresent a less packed configuration, indicating thatdense packing may induce...
- 10
- 526
- 0
Báo cáo Y học: Structural heterogeneity of pyrimidine/purine-biased DNA sequence analyzed by atomic force microscopy potx
... AFM imaging procedure has beendescribed elsewhere [14]. Images were acquired by MMSPM NanoScope III system (Veeco/Digital Instruments,Santa Barbara, CA, USA) operating in Tapping Mode in airFig. ... of genome regulation such as replication rate and timing,recombination and chromosome folding by modulatingthe local structure of DNA regions and the globaltopology of chromatin domains.ACKNOWLEDGEMENTSThis ... Lyubchenko21Department of Life Science, Osaka Prefecture University College of Integrated Arts and Sciences, Sakai, Japan;2Department of Microbiology, Arizona State University, Tempe, USA;3Department of...
- 5
- 284
- 0
báo cáo hóa học: " Comparison of immature and mature bone marrow-derived dendritic cells by atomic force microscopy" potx
... that LPS activated the p38mitogen-activated protein kinase (p38 MAPK), ERK1/2,phosphoinositide 3-OH kinase (PI3 kinase)/Akt, and NF-kappaB pathways in the process of D C maturation. PI3kinase/Akt ... PI3kinase/Akt signaling pathways are important in maintain-ing survival of L PS-stimulated DCs. Inhibiting p38MAPK prevented activation of the transcription factorATF-2 and CREB, and significantly ... Assaf-Vandecasteele H, Larangé A, Azouri H, Pallardy M: Metallic haptens induce differential phenotype of human dendritic cells through activation of mitogen-activated proteinkinase and NF-kappaB pathways....
- 9
- 469
- 0
Báo cáo hóa học: " Evaluation of the nanotube intrinsic resistance across the tip-carbon nanotube-metal substrate junction by Atomic Force Microscopy" pptx
... catalysts in different geometrical configurations as straight or helical shapes. The catalytic activity realizedwith a mixture of ferrocene and xylene (as carbonsource) was obtained by heating ... mechanical for-mula of contact area and the Sharvin’ s ballistic resis-tance model [20,21]. The functionalization of CNTswith gold nanoparticles (AuNPs) is also investigated as a possible mean ... 2001,45(2):74-82[http://www.platinummetalsreview.com/pdf/pmr-v45-i2-074-082.pdf].doi:10.1186/1556-276X-6-335Cite this article as: Dominiczak et al.: Evaluation of the nanotubeintrinsic resistance across the tip-carbon nanotube-metal substratejunction by Atomic Force Microscopy. Nanoscale Research Letters...
- 10
- 415
- 0
Báo cáo hóa học: " Optimizing atomic force microscopy for characterization of diamond-protein interfaces" docx
... thetip-surface interaction can change also AFM topogra-phy. Nevertheless the e ffect is not as pronounced as in thecaseofAFMphase.ItiswellknownthattheAFMphase contrast depends on such scanning parameters as ... solutionwhere it can reveal different protein conformatio ns thatare not detectable in air [8,12]. Combinat ion of advanced AFM regimes (including phase imaging andnanoshav ing) has shown that the FBS ... dissipation and change of the phasecontrast. Therefore, change of the tip by releasing andcapturing proteins from the surf ace changes the phasecontrast as shown in Figure 5. Different quality of...
- 10
- 445
- 0
A study of using english songs as a type of supplementary material in teaching listening for first year non major students of english at phuong dong university
... marking was done with the same way of assessment and then was analyzed in turn. The class with English songs in teaching process was called class A, the other was B. The same test design was ... types of knowledge involve in understanding language are not applied in any fixed order. They can be used in any order or even simultaneously, and they are all capable of interacting and influencing ... That was the reason why the author would like to conduct this research of using songs as a type of supplementary material in teaching listening skill in order to erase their prejudice against...
- 39
- 1,125
- 3
Tài liệu The Value of the Case Study as a Research Strategy doc
... important if other researchers are to be able to repeat a research programme: It is for this reason that researchers like Yin are especially adamant that a case database be created and maintained ... \allow repetition and re-evaluation of cases. Reliability is most important during the data collection phase, and involves the use of case study protocol as well as the case study database already ... the value of case study research programmes has been ruled out as a major threat because of inconsistencies in the application of the philosophical basis to the practical methodology, especially...
- 15
- 587
- 0
Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx
... hnRNP A1 CUAGACUAGA 5428–5437ESE2 SC35, SRp40 CCAGUAGAUCCUAGACUAGA 5418–5437 A5 ESE GAR ASF ⁄ SF2, SRp40 GAAGAAGCGGAGACAGCGACGAAGA 5558–5582 [7] A7 ESS3 hnRNP A1 ,hnRNP E1 ⁄ E2AGAUCCAUUCGAUUAGunknown8047–8062 ... 32]ISS hnRNP A1 UAGUGAAUAGAGUUAGGCAGGGA 7928–7950ESE3 ASF ⁄ SF2 GAAGAAGAA 8016–8025hnRNP A1 UAGAAGAAGAA 8018–8025HIV-1 alternative splicing regulation J. Tazi et al.872 FEBS Journal 277 (2010) ... [10].Optimization of the 5Âss D2 signal results in increasedsplicing at the upstream 3Âss A1 , increased inclusion of exon 2 into viral mRNA, decreased accumulation of unspliced viral mRNA and decreased...
- 10
- 434
- 0
Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt
... CGGAAACGCCTTAAGTCCAG GCCACAATCCAGTCATTCCA 83MT 2A AATAAGCTTCCGACTCTAGCCGC GATAAGCTTGTGGAAGTCGCGT 259CD237904 AGCTGGTGCAGGAGGAAGTA TCTCACTGGCCCTAAACTGG 92AL707095 CCGAGAACCGAACTTACCAA CTGATAGGGGTTGGGTGATG ... (5Â-to3Â)Size(bp)MDR1 GAAGAAGGGCCAGACGC CTCCTGGGACACGATGC 178MRP1 CCTTCGCTGAGTTCCTGC CTGCGGTGCTGTTGTGG 246BCRP ACATCAGCGGATACTACAGAG CACCATCATAAGGGTAAACAT 173CA9 TTTGAATGGGCGAGTGATTG ACAGCAAAAAGGAGGCCAAA 138BMP2 ... carcinomas, ovarian carcinomas,colorectal carcinomas, esophageal carcinomas, bladdercarcinomas and non-small cell lung carcinomas. CA9is strongly induced by hypoxia via the transcriptionfactor...
- 13
- 563
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008