Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt

Identification of carbonic anhydrase as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells Guopei Zheng1,*, Min Zhou1,*, Xinrong Ou2, Bo Peng1, Yanhui Yu1, Fangren Kong1, Yongmei Ouyang1 and Zhimin He1 Cancer Research Institute, Xiangya School of Medicine, Central South University, Changsha, Hunan, China Department of Stomatology, Xiangya Hospital, Central South University, Changsha, Hunan, China Keywords CA9; cDNA microarray; drug resistance; pingyangmycin; tongue cancer Correspondence Zhimin He, Cancer Research Institute, Xiangya School of Medicine, Central South University, Xiangya Road #110, 410078 Changsha, Hunan, China Fax: +86 0731 82355043 Tel: +86 0731 82355041 E-mail: hezhimin2005@yahoo.com *These authors contributed equally to this work (Received 20 June 2010, revised August 2010, accepted 31 August 2010) doi:10.1111/j.1742-4658.2010.07836.x Drug resistance is the major obstacle to successful cancer treatment To understand the mechanisms responsible for drug resistance in tongue cancer, Tca8113 cells derived from moderately differentiated human tongue squamous cell carcinoma were exposed to stepwise escalated concentrations of pingyangmycin (PYM) to develop the resistant cell line called Tca8113 ⁄ PYM, which showed over 18.78-fold increased resistance to PYM as compared with Tca8113 cells, and cross-resistance to cisplatin, pirarubicin, paclitaxel, adriamycin, and mitomycin We found that the resistance was not associated with multidrug resistance transporter (p170, p-gp), multidrug resistance-associated protein and breast cancer resistance protein overexpression, so we hypothesized that Tca8113 ⁄ PYM cells must have some other resistance mechanism selected by PYM To test this hypothesis, the global gene expression profiles between Tca8113 and Tca8113 ⁄ PYM cells were compared by cDNA microarray Eighty-nine genes and thirteen expressed sequence tags with differential expression levels between the two cell lines were identified Some differential expression levels were validated with real-time PCR and western blot Furthermore, the functional validation showed that both carbonic anhydrase (CA) inhibitor acetazolamide application and CA9 silencing with CA9 antisense oligonucleotides contribute to the medium pH increase of Tca8113 ⁄ PYM cells and enhanced PYM chemosensitivity Moreover, both acetazolamide and CA9 antisense oligonucleotides significantly increased PYM-induced caspase activation in Tca8113 ⁄ PYM cells Thus, our study suggests that the resistance of Tca8113 ⁄ PYM cells is probably associated with CA9 and other differential expression molecules, and that CA9 may be an important marker for prediction of PYM responsiveness in tongue cancer chemotherapy Introduction Squamous cell carcinoma of the head and neck is the fifth most common cancer worldwide, and is a significant source of cancer morbidity and mortality More than 500 000 new cases are estimated to occur worldwide every year [1,2] Tongue cancer is the most common type of squamous cell carcinoma of the head and Abbreviations ADM, adriamycin; ASO, antisense oligonucleotide; Atz, acetazolamide; BCRP, breast cancer resistance protein; BMP2, bone morphogenetic protein 2; CA, carbonic anhydrase; cDDP, cisplatin; DKK1, dickkopf homolog 1; EST, expressed sequence tag; HIF, hypoxia-inducible factor; MDR, multidrug resistance; MDR1, multidrug resistance transporter (p170, p-gp); MMC, mitomycin; MRP1, multidrug resistanceassociated protein 1; MT, metallothionein; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide; PARP, poly(ADP-ribose) polymerase; pHe, extracellular pH; pHi, intracellular pH; pNA, p-nitroaniline; PYM, pingyangmycin; VP-16, etoposide; 5-FU, fluorouracil 4506 FEBS Journal 277 (2010) 4506–4518 ª 2010 The Authors Journal compilation ª 2010 FEBS G Zheng et al neck, and the incidence is increasing every year It is found to be rapidly progressing, to frequently metastasize, and to have a poorer prognosis than carcinoma of other sites in the oral cavity [3] Chemotherapy plays a very important role in tongue cancer treatment, especially for patients who are detected at a late stage or have potential recurrence after surgical procedures The benefits of chemotherapy include reduction of the distant metastasis rate, improved survival rate, and preservation of organ function, whether or not combined with local ⁄ regional treatment [4] In the clinic, pingyangmycin (PYM), cisplatin (cDDP) and fluorouracil (5-FU) are mostly used in chemotherapy of tongue cancer, but the effectiveness of monotherapy with PYM for preoperative chemotherapy is only about 67% [5,6] Moreover, the therapeutic benefits of chemotherapy can be attenuated because of intrinsic and ⁄ or acquired drug resistance, especially multidrug resistance (MDR) ATP-binding cassette transporters such as MDR transporter (p170, p-gp) (MDR1) have been reported in some primary tongue squamous cell carcinomas, and they are chemotherapy-inducible, showing relevance to drug resistance [7] Accumulating evidence suggests that multiple complex mechanisms may be involved, simultaneously or complementarily, in the emergence and development of drug resistance in cancers Although some advances in cancer drug resistance research have been made, indicating that ATP-binding cassette transporters play important roles in cancer drug resistance but cannot fully explain the resistance phenomenon, there are still only a few studies focusing on tongue cancer PYM, a water-soluble glycopeptide produced by Streptomyces pingyangensin, is a new type of cytotoxic glycopeptide antitumor antibiotic developed in China in the 1980s It is a member of the bleomycin family, and is also known as bleomycin A5 It has been found to reduce the DNA synthesis of cancer cells and cut off the DNA chain [8] With its wide antitumor spectrum and lower toxicity in chemotherapy of malignant tumors [9], PYM plays a particular curative role in chemotherapy for treatment of squamous cell carcinoma, malignant lymphoma, Hodgkin’s disease, and lymphangioma [10] It is fairly extensively used in chemotherapy for the treatment of neoplasms in the head and neck region [10] However, the therapeutic benefits of PYM can be attenuated in the clinic, because of intrinsic and ⁄ or acquired drug resistance, which is the major limitation of PYM-based chemotherapy The mechanism of cellular resistance to PYM is not fully understood, but it is extremely important to understand it for successful treatment of tongue carcinoma In this study, we established a cellular model, Role of CA9 in PYM resistance Tca8113 ⁄ PYM cells, with acquired resistance induced by PYM, expecting to reveal new molecules related to PYM resistance, and to provide candidate biomarkers to predict the clinical response to PYM-based chemotherapy in tongue cancers Results Biological characteristics of Tca8113 ⁄ PYM cells In order to explore the mechanism responsible for PYM resistance in tongue cancer, in the first step of the present study we established a PYM-resistant cell line, Tca8113 ⁄ PYM The Tca8113 ⁄ PYM cell line was obtained by stepwise selection from its sensitive parent cell line with PYM over a period of years At the beginning of induction, cell growth was strongly suppressed However, at the end of induction, Tca8113 ⁄ PYM cells exhibited a stable growth pattern in medium with 0.2 mgỈL)1 PYM After further maintenance for weeks in PYM-free medium, the mean population doubling time was found to be 35.76 ± 4.62 h for Tca8113 ⁄ PYM cells, as compared with 35.12 ± 4.18 h for Tca8113 cells (no statistically significant difference; P > 0.05) (Fig 1A) After cells had been treated with different concentrations of PYM from to 800 mgỈL)1 for 48 h, dose–response curves were plotted, as shown in Fig 1B The IC50 values for PYM treatment in Tca8113 and Tca8113 ⁄ PYM cells were 27.16 ± 1.78 mgỈL)1 and 509.47 ± 37.71 mgỈL)1, respectively (P < 0.01) The resistance index was 18.78, indicating that the PYM-resistant cell line was successfully established The antiapoptotic activity of Tca8113 ⁄ PYM cells was also measured with Hoechst33258 stain (Fig 1C) Twenty-four hours after treatment with 300 mgỈL)1 PYM, despite increased numbers of apoptotic cells, typically identified as those cells that possess significantly smaller, condensed and fragmented nuclei under a fluorescence microscope, in both cell lines, the rate of apoptosis in Tca8113 cells was much higher than that in Tca8113 ⁄ PYM cells: 88.10± 7.96% and 15.86± 2.75%, respectively (P < 0.01) In addition, in order to determine whether the resistance was associated with the overexpression of well-documented resistance-related molecules MDR1, multidrug resistance-associated protein (MRP1), and breast cancer resistance protein (BCRP), RT-PCR was performed (Fig 1D) There was no significant difference in MDR1 or BCRP mRNA level between Tca8113 and Tca8113 ⁄ PYM cells, and there was no detectable expression of MRP1, indicating that resistance to PYM may be associated with some other molecules FEBS Journal 277 (2010) 4506–4518 ª 2010 The Authors Journal compilation ª 2010 FEBS 4507 Role of CA9 in PYM resistance G Zheng et al Fig Biological characteristics of Tca8113 ⁄ PYM cells (A) Growth curves for both cell lines were obtained in three independent experiments, and showed no difference in the mean doubling time (B) Responses of Tca8113 and Tca8113 ⁄ PYM cells to PYM Tca8113 ⁄ PYM cells were more resistant to the antiproliferative activity of PYM Each point represents the mean of six independent experiments (C) The effects of PYM-induced apoptosis on both cell lines were observed with Hoechst33258 stain The results represent three independent experiments, and show that Tca8113 ⁄ PYM cells are much more resistant to PYM-induced apoptosis (D) Relative mRNA expression levels of MDR1, MRP1 and BCRP between both cell lines after normalization to b-actin mRNA levels were determined by RT-PCR RT-PCR analysis was repeated three times, and showed no significant expression difference between the two cell lines for MDR1 or BCRP, and no detectable expression of MRP1 Cell number/well (×104) A Days Cross-resistance profiles of Tca8113 ⁄ PYM cells Inhibition rate (%) B Concentration of PYM (mg·L–1) C The sensitivities of both cell lines to cDDP, pirarubicin, paclitaxel, mitomycin (MMC), adriamycin (ADM), etoposide (VP-16) and 5-FU were determined by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide (MTT) assay, and the IC50 for each agent was calculated Both cell lines were treated with different concentrations of each agent, and the IC50 values are summarized in Table The results revealed Tca8113 ⁄ PYM cells showed resistance to cDDP, pirarubicin, paclitaxel, ADM and MMC, but not to VP-16 or 5-FU, indicating that Tca8113 ⁄ PYM was a typical MDR model, and that studies on the mechanism of resistance in this cell line have potential significance Differential gene expression profiles between Tca8113 ⁄ PYM and Tca8113 cells Because there were no differences in expression of the well-known resistance-related genes MDR1, MRP1 or BCRP, to identify genes generally involved in PYM Table IC50 values (mgỈL)1) for selected agents (mean ± standard deviation, n = 3) The results show MDR characteristic of Tca8113 ⁄ PYM cells RI, resistance index, representing IC50Tca8113 ⁄ PYM ⁄ IC50Tca8113 Agent D PYM cDDP Paclitaxel MMC Pirarubicin ADM VP-16 5-FU 27.16 2.27 11.07 0.32 3.33 0.48 17.50 10.68 Tca8113 ⁄ PYM Tca8113 ± ± ± ± ± ± ± ± 1.78 0.50 1.63 0.03 0.55 0.14 6.21 2.54 RI 509.47 7.92 23.68 0.64 6.72 0.87 27.29 10.78 18.78 3.49 2.14 1.99 1.88 1.81 1.56 1.01 ± ± ± ± ± ± ± ± 37.71** 0.60** 3.63* 0.15* 0.87* 0.14* 8.73 2.39 **P < 0.01 and *P < 0.05 versus Tca8113 4508 FEBS Journal 277 (2010) 4506–4518 ª 2010 The Authors Journal compilation ª 2010 FEBS G Zheng et al Role of CA9 in PYM resistance resistance we compared gene expression profiles between Tca8113 ⁄ PYM and Tca8113 cells by cDNA microarray We excluded genes whose expression was increased or decreased by less than two-fold in PYMresistant cells (as compared with the parent cells) A total of 89 genes were selected, among which 41 genes were upregulated (Table 2) and 48 genes were downregulated (Table 3) in the Tca8113 ⁄ PYM cell line In addition, 13 expressed sequence tags (ESTs) were also selected, four of which were upregulated and nine of which were downregulated (Table 4) Interestingly, in our microarray data, there were also no significant differences in expression of MDR1, MRP1 or BCRP between these two cell lines, in agreement with the results of RT-PCR, so we considered that the resistance may be related to a number of other differential genes associated with a variety of cellular functions, such as those encoding carbonic anhydrase (CA) 9, metallothionein (MT) 2A, bone morphogenetic protein (BMP2), and dickkopf homolog (DKK1) Table Genes with upregulated expression in Tca8113 ⁄ PYM cells No Gene name GenBank ID Ratio Gene product 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 CA9 BMP2 PARN LYPD3 ITPR1 MT2A ITGA5 NOL5A SDC4 C20orf139 PPP2R2B ITGB5 METRN NOL5A EIF4G1 MAN1B1 ENO2 DDIT4 SGK TSC22D1 NCBP2 RUVBL1 HNRPAB NDRG1 GCLC PGRMC2 FKBP1A MT1K FRS3 NM_001216 NM_009309 NM_002582 NM_014400 NM_002222 NM_175617 NM_002205 NM_006392 NM_002999 NM_080725 NM_004576 NM_002213 NM_024042 NM_006392 NM_182917 NM_016219 NM_001975 NM_019058 NM_005627 NM_183422 NM_007362 NM_003707 NM_031266 NM_006096 NM_001498 NM_006320 NM_000801 NM_176870 NM_006653 4.993 4.933 3.644 3.208 2.98 2.955 2.881 2.71 2.623 2.621 2.618 2.604 2.546 2.524 2.386 2.382 2.377 2.371 2.353 2.307 2.277 2.268 2.258 2.249 2.235 2.222 2.215 2.215 2.188 30 31 32 33 34 35 RAB31 MCM2 RSL1D1 EHD4 C20orf30 SFPQ NM_006868 NM_004526 NM_015659 NM_139265 NM_014145 NM_005066 2.147 2.102 2.097 2.075 2.072 2.06 36 37 38 39 MT1B CUL4A MYC P4HA1 NM_005947 NM_003589 NM_002467 NM_000917 2.028 2.022 2.021 2.018 40 41 TPM4 SOCS3 NM_003290 NM_003955 2.006 2.004 Carbonic anhydrase Bone morphogenetic protein Poly(A)-specific ribonuclease LY6 ⁄ PLAUR domain containing Inositol 1,4,5-trisphosphate receptor, type Metallothionein 2A Integrin a5 precursor Nucleolar protein 5A (56 kDa with KKE ⁄ D repeat) Syndecan (amphiglycan, ryudocan) Sulfiredoxin-1 b-Isoform of regulatory subunit B55, protein phosphatase isoform a Integrin b5 Meteorin, glial cell differentiation regulator Nucleolar protein 5A (56 kDa with KKE ⁄ D repeat) Eukaryotic translation initiation factor 4c, a-1,2-Mannosidase Enolase RTP801 Serum ⁄ glucocorticoid-regulated kinase TSC22 domain family, member Nuclear cap-binding protein subunit Similar to RuvB (E coli homolog)-like Homo sapiens heterogeneous nuclear ribonucleoprotein A ⁄ B N-myc downstream-regulated gene Glutamate-cysteine ligase, catalytic subunit Progesterone membrane-binding protein FK506-binding protein 1A Metallothionein-1k suc1-associated neurotrophic factor target (fibroblast growth factor receptor substrate 2) Small GTP-binding protein rab22b Minichromosome maintenance protein homolog Ribosomal L1 domain containing Hepatocellular carcinoma-associated protein HCA10 Chromosome 20 ORF 30 Splicing factor proline ⁄ glutamine rich (polypyrimidine tract-binding protein associated) Metallothionein 1B Cullin 4A v-myc myelocytomatosis viral oncogene homolog Procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), a-polypeptide I Tropomyosin Suppressor of cytokine signaling FEBS Journal 277 (2010) 4506–4518 ª 2010 The Authors Journal compilation ª 2010 FEBS 4509 Role of CA9 in PYM resistance G Zheng et al Table Genes with downregulated expression in Tca8113 ⁄ PYM cells No 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 Gene name GenBank ID Ratio Gene product PTGES FBN2 MAGEB2 RBP4 GALNT10 NM_198797 NM_001999 NM_002364 NM_006744 NM_198321 3.356 3.279 3.086 2.941 2.653 UPP1 HLA-C HIST1H2BK HOXB7 COX7B SCNN1A AMACR GSTK1 CASP1 DKK1 IDI1 RPS4X USP37 H2bk MYST4 GNG11 PQBP1 FKBP9 PSPHL C15orf24 HSPC016 DPYSL2 ARF4 SLTM TCP1 SIGLEC5 CAS1 DHCR24 PGD IDH3A ABHD10 MED11 TMEM85 UXT NRD1 MUCDHL PKN3 HSPH1 ALG12 B2M ZNF541 NOLA3 PDGFA NM_181597 NM_002117 NM_080593 NM_004502 NM_001866 NM_001038 NM_014324 NM_015917 NM_033292 NM_012242 NM_004508 NM_001007 NM_020935 NM_080593 NM_012330 NM_004126 NM_005710 NM_007270 NM_003832 NM_020154 NM_015933 NM_001386 NM_001660 NM_024755 NM_030752 NM_003830 NM_022900 NM_014762 NM_002631 NM_005530 NM_018394 NM_001001683 NM_016454 NM_153477 NM_002525 NM_021924 NM_013355 NM_006644 NM_024105 NM_004048 NM_032255 NM_018648 NM_002607 2.625 2.618 2.577 2.5 2.475 2.457 2.451 2.375 2.37 2.32 2.299 2.242 2.242 2.242 2.237 2.232 2.232 2.212 2.212 2.198 2.141 2.132 2.132 2.123 2.119 2.119 2.105 2.105 2.079 2.066 2.058 2.037 2.033 2.028 2.024 2.02 2.02 2.016 2.016 2.012 2.008 2.004 2.004 Prostaglandin E synthase Fibrillin Melanoma antigen family B PRO2222 UDP-N-acetyl-a-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 10 Uridine phosphorylase HLA class I histocompatibility antigen H2B histone family, member T Homeobox B7 Cytochrome c oxidase subunit VIIb precursor Amiloride-sensitive sodium channel subunit a a-Methylacyl-CoA racemase Glutathione S-transferase j1 Caspase Dickkopf homolog Isopentenyl-diphosphate d isomerase Ribosomal protein S4, X-linked Desmuslin isoform B; desmuslin isoform A Histone cluster MYST histone acetyltransferase (monocytic leukemia) Guanine nucleotide-binding protein (G protein), c11 Polyglutamine-binding protein FK506-binding protein Phosphoserine phosphatase-like Chromosome 15 ORF 24 Coiled-coil domain-containing protein 72 Dihydropyrimidinase-like ADP-ribosylation factor SAFB-like, transcription modulator t-complex 1, transcript variant Sialic acid-binding Ig-like lectin O-acetyltransferase 24-Dehydrocholesterol reductase Phosphogluconate dehydrogenase Isocitrate dehydrogenase (NAD+) a Abhydrolase domain containing 10 Mediator complex subunit 11 Transmembrane protein 85 Ubiquitously expressed transcript isoform Nardilysin (N-arginine dibasic convertase) l-Protocadherin isoform Protein kinase N3 Heat shock 105 kDa Asparagine-linked glycosylation 12 homolog b2-Microglobulin Zinc finger protein 541 Nucleolar protein family A, member Platelet-derived growth factor a isoform ⁄ Confirmation of differential expression by real-time PCR and western blot To confirm the results of the microarray, we carried out quantitative real-time PCR and western blot, each 4510 been repeated three times Eight differential expression genes and ESTs were examined at the mRNA level (Fig 2A) A good correlation between the real-time PCR results and the microarray data was seen For example, the mean fold changes in upregulation as FEBS Journal 277 (2010) 4506–4518 ª 2010 The Authors Journal compilation ª 2010 FEBS G Zheng et al Role of CA9 in PYM resistance Table ESTs with downregulated ⁄ upregulated expression in Tca8113 ⁄ PYM cells No GenBank ID UniGene Cluster ID Fold downregulation ⁄ upregulation 10 11 12 13 CD237904 AL707095 AK095731 BU540113 AK026328 BC037851 AF150180 BG928109 KIAA0218 AK026818 BX647692 ARHGAP11A AK128436 Hs.661577 Hs.475334 Hs.634213 Hs.460089 Hs.232604 Hs.385499 Hs.571467 Hs.669957 NM_014760 Hs.605083 Hs.639904 NM_014783 Hs.371680 3.722 2.544 2.434 2.025 )2.584 )2.415 )2.217 )2.174 )2.132 )2.024 )2.016 )2.008 )2 A B Fig Validation of microarray results (A) Real-time PCR: relative expression levels of selected transcripts are shown in a fold scale between Tca8113 ⁄ PYM and Tca8113 by normalizing against b-actin Bars and standard errors representing relative expression of tested genes normalized against b-actin in the data were obtained from three independent experiments (B) Using western blot, we validated the protein expression levels of MT2A and CA9, using a-tubulin as a loading control The figure represents three independent experiments determined by microarray analysis and by real-time PCR were, respectively, 4.993 and 5.584 for CA9, 4.933 and 4.291 for BMP2, 3.772 and 4.815 for CD237904, and 2.544 and 2.884 for AL707095 The mean fold changes in downregulation as determined by microarray analysis and by real-time PCR were, respectively, 2.320 and 2.794 for DKK1, and 2.415 and 2.895 for BC037851 Also, the expression of MT2A and CA9 was further tested by western blot (Fig 2B), exploring their functional linkages to biochemical mechanisms that could be related to PYM resistance Both real-time PCR and western blot analyses confirmed the microarray results CA9 interference sensitizes Tca8113 ⁄ PYM cells to PYM Recent studies have demonstrated that CA9 overexpression represents biological tumor aggressiveness, and is associated with poor clinical outcome in several tumors, including head and neck, cervix, kidney and lung cancers However, the nature and mechanism of CA9 involvement are not well established; in particular, direct evidence in drug resistance is lacking In our present study, CA9 expression was upregulated in Tca8113 ⁄ PYM cells, and we conducted two series of experiments to investigate its role in PYM resistance In the first series of experiments, the CA function inhibitor acetazolamide (Atz) was used First, we determined 800 lm as the concentration of Atz to be used for the follow-up experiments (data not shown) Then we measured the pH of the culture medium affected by Atz The pH of Tca8113 ⁄ PYM cells, 6.37 ± 0.11, is much lower than that of Tca8113 cells, 6.65 ± 0.16, indicating that CA9 does actually play a role After Atz administration, the medium pH of Tca8113 ⁄ PYM cells was significantly increased, by about 0.36 units (Fig 3A) We found that 800 lm Atz enhanced the sensitivity of Tca8113 ⁄ PYM cells to PYM, with an IC50 reduction from 509.47 ± 37.71 mgỈL)1 to 89.41 ± 9.33 mgỈL)1 (P < 0.01), but had no effect on their parent cell line, Tca8113 (Fig 3B) In addition, we observed the effect of Atz on PYM-induced apoptosis with Hoechst33258 stain, and found that Atz combined with 100 mgỈL)1 PYM increased the proportion of apoptotic Tca8113 ⁄ PYM cells by about 56% (Fig 3C) The observation of apoptosis was validated by the detection of the functional states of caspase and poly(ADP-ribose) polymerase (PARP) at the protein level 24 h after the respective treatments, suggesting that Atz can significantly enhance 100 mgỈL)1 PYM-induced caspase and PARP cleavage (Fig 3D) To further validate the functional role of CA9 upregulation in Tca8113 ⁄ PYM cells, in the second series of experiments inhibition of CA9 gene expression FEBS Journal 277 (2010) 4506–4518 ª 2010 The Authors Journal compilation ª 2010 FEBS 4511 Role of CA9 in PYM resistance G Zheng et al A B C D Fig The effect of inhibition of CA9 function by Atz on PYM activity Every experiment was repeated three times, and bars and standard errors in the data were obtained from three independent experiments (A) The pH change of Tca8113 and Tca8113 ⁄ PYM cells with or without Atz treatment The pH of the culture medium for Tca8113 ⁄ PYM cells was much lower than that for Tca8113 cells Atz clearly increased the pH of culture medium for Tca8113 ⁄ PYM cells, but not for Tca8113 cells 4, versus Tca8113, P < 0.05; q, versus Tca8113, P > 0.05; h, versus Tca8113 ⁄ PYM, P < 0.01 (B) The dose–inhibition rate curve plotted from MTT assay results Atz significantly enhanced the effect of PYM on Tca8113 ⁄ PYM cells, with a marked reduction in IC50 value, but not on Tca8113 cells (C) Atz significantly enhanced PYM-induced apoptosis of Tca8113 ⁄ PYM cells as shown by Hoechst33258 stain, and indicated with arrows, representing three independent experiments (D) Caspase and PARP cleavage represent molecular effects of Atz combined with PYM on Tca8113 ⁄ PYM cells with CA9 antisense oligonucleotides (ASOs) was employed Tca8113 ⁄ PYM cells were transfected with CA9 ASOs, and western blot analysis showed that ASO 2# markedly downregulated CA9 expression, so the ASO 2# was selected for further study (Fig 4A) CA9 ASO transfection elevated the medium pH of Tca8113 ⁄ PYM cells by  0.3 units (P < 0.01) (Fig 4B) and enhanced PYM chemosensitivity, with a significant decrease in the IC50 value from 509.47 ± 37.71 mgỈL)1 to 94.78 ± 9.62 mgỈL)1 (P < 0.01) (Fig 4C), and an increase of  52% in the proportion of apoptotic cells induced by 100 mgỈL)1 PYM (Fig 4D); the control scrambled ASO had no signifi4512 cant effects on the induction of antiproliferation or apoptosis by 100 mgỈL)1 PYM Caspase and PARP cleavage was also detected (Fig 4E), suggesting that silencing of CA9 expression could suppress the antiapoptotic activity of Tca8113 ⁄ PYM cells to enhance the PYM effect To further observe the enhanced effect of CA9 interference on PYM-induced Tca8113 ⁄ PYM apoptosis, caspase activity was investigated Tca8113 ⁄ PYM cells were pretransfected with scrambled ASO and CA9 ASO, and then incubated in 100 mgỈL)1 PYM Simultaneously, Tca8113 ⁄ PYM cells were treated with 100 mgỈL)1 PYM alone or combined with Atz After FEBS Journal 277 (2010) 4506–4518 ª 2010 The Authors Journal compilation ª 2010 FEBS G Zheng et al Role of CA9 in PYM resistance A C B Fig The effect of CA9 ASO on PYM Every experiment was repeated three times, and bars and standard errors in the data were obtained from three independent experiments (A) The CA9 expression change mediated by ASO showed that CA9 ASO2# significantly reduced the CA9 protein level So the CA9 ASO 2# was selected for the follow-up experiments (B) CA9 ASO increased the medium pH of Tca8113 ⁄ PYM cells, but scrambled ASO did not *:versus Tca8113 ⁄ PYM, P < 0.01 (C, D) CA9 ASO significantly decreased cell viability, with a marked reduction in IC50 value, and increased the apoptotic activity induced by PYM on Tca8113 ⁄ PYM cells (E) Western blot analysis revealed that CA9 ASO could enhance PYM-induced caspase activation and subsequent PARP cleavage (F) Effect of CA9 ASO on PYM-induced caspase activation on Tca8113 ⁄ PYM cells The relative activation of caspase shown was calculated from the average of three experiments Each value is expressed as ratio of caspase activation level to untreated level, and the untreated level was set to *versus untreated, P > 0.05; **versus untreated, P < 0.01 E D 24 h of treatment, caspase activity was determined As shown in Fig 4F, Atz and CA9 ASO significantly increased PYM-induced caspase activity in Tca8113 ⁄ PYM cells (P < 0.01) as compared with untreated cells Discussion A major problem in the clinical chemotherapeutic treatment of cancer is intrinsic or acquired resistance to current chemotherapeutic agents [11], particularly the acquisition of MDR This underlines the critical importance of exploring the molecular mechanisms involved in the drug resistance of cancer cells for improving current treatments in the clinic F PYM is widely used in the treatment of various squamous cell tumors, including tongue cancer This stresses the need to elucidate the mechanism of drug resistance induced by PYM Here, we established an isogenic PYM-resistant variant, Tca8113 ⁄ PYM, from the tongue cancer cell line Tca8113 to compare their gene expression profiles directly cDNA microarray analysis, which is a powerful technology for the identification of well-documented and novel genes associated with response or resistance to chemotherapeutic agents, was used [12], and revealed that 41 genes were upregulated and 48 genes were downregulated in the Tca8113 ⁄ PYM cell line However, there were no differences in the expression of MDR1, MRP1 or BCRP FEBS Journal 277 (2010) 4506–4518 ª 2010 The Authors Journal compilation ª 2010 FEBS 4513 Role of CA9 in PYM resistance G Zheng et al between the two cell lines, revealing that the drug resistance of tongue cancer induced by PYM may be related to some other molecules, such as CA9 CA9 is a zinc metalloenzyme catalyzing the reversible conversion of CO2 to bicarbonate and a proton, is a cell surface glycoprotein, and reduces local extracellular pH [13] CA9 overexpression has been identified in a number of solid tumors, including renal carcinomas and, particularly, clear cell adenocarcinomas, cervical squamous carcinomas, ovarian carcinomas, colorectal carcinomas, esophageal carcinomas, bladder carcinomas and non-small cell lung carcinomas CA9 is strongly induced by hypoxia via the transcription factor hypoxia-inducible factor (HIF)-1 or by an HIFindependent pathway, such as the activation of oncogenes (Ras, SRC, and PI3K) or inactivation of tumor suppressor genes (PTEN and p53), and is thought to play a role in the regulation of cancer cell proliferation, cell transformation and survival under normoxia or hypoxia, making it a potential target for cancer therapy [14–16] However, the array analysis showed no significant differences in expression of the above genes between Tca8113 and Tca8113 ⁄ PYM cells, and the western blot analysis of HIF-1a also showed no difference (data not shown) These negative data imply that a different mechanism, such as methylation or microRNA, is responsible for the upregulation of CA9 expression Michael et al suggested that CA9 expression in squamous cell head and neck tumor had a significant relationship with resistance to chemoradiotherapy [17], in support of our study, but there was a lack of direct evidence for the mechanism In our present study, CA9 expression was much higher in Tca8113 ⁄ PYM cells and the extracellular pH was much lower in the same incubation conditions Generally, solid tumors maintain a high intracellular pH (pHi) but a low extracellular pH (pHe) Adaptation of tumor cells to hypoxia and acidosis is a critical driving force in tumor progression and metastasis [18,19] Tumor cells have developed key strategies to regulate their pHi, because a pHi variation of 0.1 can disrupt multiple biological functions, including ATP production, protein synthesis, cell proliferation, migration, and apoptosis [20–22] Whether the adaptation correlates with the drug resistance needs further investigation Here, both CA9 function inhibition and CA9 expression silencing elevated the pHe of Tca8113 ⁄ PYM cells, suggesting that CA9 function really contributed to the regulation of pHe Moreover, CA9 interference significantly decreased the IC50 of PYM in Tca8113 ⁄ PYM cells, and enhanced the effect of PYM-induced cell apoptosis and caspase activity However, the exact mechanism is still unclear Chiche 4514 et al [23] showed that forced expression of CA9 contributed to extracellular acidification and to the maintenance of a more alkaline resting pHi Importantly, the efficiency of caspase activation by cytC was found to be pH-sensitive, and lower pH contributed to more caspase activation [24] The change in cytosolic pH may play a very important role in regulating the apoptotic process, but whether CA9-mediated drug resistance is associated with the maintenance of cytosolic pH, what happens inside cells after Atz or CA9 ASO is administered in combination with PYM, and how the overexpression of CA9 occurrs during PYM induction will be investigated in further studies CA9 plays a very important role in PYM-induced drug resistance, but CA9 interference cannot completely reverse resistance Most of the other genes with altered expression are correlated with tumorigenesis, and some reports have also suggested a role for them in the drug response For example, MTs, which are known to participate in fundamental cellular processes such as cell proliferation and apoptosis [25,26], have been suggested to protect against toxic and carcinogenic events mediated by a broad range of nonmetal toxicants [27] Several lines of evidence suggest that MTs are chemotherapy inducible [28], and their expression constitutes a protective mechanism that prevents the apoptosis induced by cisplatin and doxorubicin [29,30] In addition, irinotecan-induced changes in MT expression correlated with clinical response in gastric cancer patients, and MT overexpression modestly increased the resistance of AGS cells to irinotecan [31] In our previous study, we established a human MT2A recombinant with soluble high-yield expression, and demonstrated its hydroxyl radical-scavenging ability and significant protective role against DNA damage caused by UVC radiation [32] In the present study, the expression of MT2A was upregulated in Tca8113 ⁄ PYM cells MT2A, as the main isoform of MTs, may closely mediate the resistance of Tca8113 ⁄ PYM cells to PYM BMP2 is a member of the transforming growth factor superfamily, and is now recognized as a multipurpose cytokine that stimulates migration and induces the proliferation and differentiation of many different cell types BMP2 is expressed in a variety of carcinoma cell lines, especially tumors originating from the head and neck [33] Recombinant BMP2 caused an  50% increase in early tumor growth of A549 cells in athymic nude mice, whereas BMP2 antagonists inhibited tumor growth by 50% [34] Elaine et al found that BMP2 greatly enhanced blood vessel formation in tumors formed by A549 cells in nude mice, and that, in vitro in endothelial cells, BMP2 stimulated Smad1 ⁄ 5, FEBS Journal 277 (2010) 4506–4518 ª 2010 The Authors Journal compilation ª 2010 FEBS G Zheng et al Erk1 ⁄ 2, and Id1 expression, which was associated with an increase in tube formation and proliferation, and suggested that BMP2 could promote tumor growth by stimulating angiogenesis [35] BMP2 is closely related to cancer, but its role in chemotherapy has not been reported Our data showed that expression of BMP2 in Tca8113 ⁄ PYM cells is 4.933-fold higher than in Tca8113 cells, so further investigations should be performed It is well known that the Wnt–b-catenin pathway is aberrantly activated in many carcinomas [36] As one of the natural Wnt antagonists, DKK1 simultaneously binds to LRP5 ⁄ and the transmembrane proteins Kremen ⁄ 2, and induces LRP endocytosis, which prevents the formation of Wnt–Frizzled–LRP5 ⁄ receptor complexes and blocks Wnt–b-catenin signaling [37,38] DKK1 seems to have antitumor effects independently of the antagonism of b-catenin–TCF transcriptional activity in H28 and MS-1 mesothelioma and HeLa cervical cancer cells [39,40] Some studies have demonstrated that DKK1 is downregulated in colon cancer [41] and medulloblastoma cells, perhaps because of the methylation of the promoter, and restoration of DKK1 expression can induce apoptosis and suppress colony formation [42] As a suppressor of cancer, the downregulated expression of DKK1 is associated with chemoresistance, consistent with previous studies However, whether its downregulation is the result of methylation of the promoter in Tca8113 ⁄ PYM cells and its precise effects in suppressing cancer or reversing of PYM resistance will be investigated in future studies In addition, among the ESTs, we have identified a novel gene termed TCRP1 (tongue cancer drug resistance associated protein; Genebank:EF363480) that particularly mediates cDDP resistance, and a related study is being performed (data not shown) In conclusion, the Tca8113 ⁄ PYM and Tca8113 cell lines are useful models for identifying candidate targets responsible for the mechanism of PYM-induced drug resistance in tongue cancer Using cDNA microarray technology, we have identified 89 genes and 13 ESTs that may be related to PYM-inducible resistance In particular, CA9 seems to be a potential biomarker, and its interference may be promising in drug resistance reversion Role of CA9 in PYM resistance serum (Gibco, Carlsbad, CA, USA) at 37 °C in a humidified atmosphere containing 5% CO2 The Tca8113 ⁄ PYM cell line was established by intermittent stepwise selection in vitro with PYM (Harbin Bolai Pharmaceutical, Harbin, China) over a period of 24 months, starting at mgỈL)1 and ending at 30 mgỈL)1 Despite massive cell death among the sensitive Tca8113 cells under treatment, the cultures were maintained by regular changes of medium, with intermittent increases in the PYM concentration until the surviving cells recovered a normal growth pattern in medium with 0.2 mgỈL)1 PYM Before experiments were performed, Tca8113 ⁄ PYM cells were maintained in PYM-free medium for at least weeks To investigate the cell growth curve, cells were seeded in a six-well plate at · 104 cells per well, and the culture medium was replaced with fresh medium without PYM Four wells were trypsinized each time after 1, 2, 3, 4, and days of incubation, and the cell number was determined The average cell count obtained at each time point was plotted against the time, and the doubling time was calculated for the exponential growth phase MTT assay Cells were seeded in 96-well plates at a density of · 103 cells per well (200 lL per well) for 24 h before use The culture medium was replaced with fresh medium containing anticancer drug for 48 h Water-soluble MTT (Sigma-Aldrich, St Louis, MO, USA) was added (20 lL) After h of incubation, the supernatant was discarded and the purple crystals were resuspended in 200 lL of dimethylsulfoxide The absorbance of each well was read at 570 nm on an ELISA XL (BIOHIT, BP800, Helsinki, Finland) The growth rate was calculated as the ratio of the absorbance of the experimental well to that of a blank well, and the IC50 was also calculated Hoechst stain Cells in exponential growth were cultured with fresh medium in a six-well plate in which the coverslips had been placed After incubation for 24 h, cells were treated with or without agent for 48 h Then, Hoechst33258 was used to detect apoptosis according to a standard procedure, a fluorescence microscope was used to observe apoptotic cells, which were typically identified as cells possessing significantly smaller, condensed and fragmented nuclei, the apoptotic cell number was determined under at least three views for every treated group, and the rate of apoptosis was calculated The experiments were repeated three times Experimental procedures RT-PCR and real-time PCR Establishment of the Tca8113 ⁄ PYM cell line Tca8113 cells obtained from the China Center for Type Culture Collection (Wuhan, China) were cultured in RPMI-1640 (Gibco, Carlsbad, CA, USA) containing 10% fetal bovine Total RNA was extracted with a Trizol protocol, and cDNAs from the mRNAs were synthesized with the SuperScript first-strand synthesis system (Fermentas Life Science, FEBS Journal 277 (2010) 4506–4518 ª 2010 The Authors Journal compilation ª 2010 FEBS 4515 Role of CA9 in PYM resistance G Zheng et al Table Primers used for PCR Gene Forward primer (5¢- to 3¢) Reverse primer (5¢- to 3¢) Size (bp) MDR1 MRP1 BCRP CA9 BMP2 MT2A CD237904 AL707095 AK095731 DKK1 BC037851 b-Actin GAAGAAGGGCCAGACGC CCTTCGCTGAGTTCCTGC ACATCAGCGGATACTACAGAG TTTGAATGGGCGAGTGATTG CGGAAACGCCTTAAGTCCAG AATAAGCTTCCGACTCTAGCCGC AGCTGGTGCAGGAGGAAGTA CCGAGAACCGAACTTACCAA AGGAAGCACCCAGCAATACCA CACCTTGGATGGGTATTCCA CACAGCTCCCATTCATTCCA TCCTCCCTGGAGAAGAGCTA CTCCTGGGACACGATGC CTGCGGTGCTGTTGTGG CACCATCATAAGGGTAAACAT ACAGCAAAAAGGAGGCCAAA GCCACAATCCAGTCATTCCA GATAAGCTTGTGGAAGTCGCGT TCTCACTGGCCCTAAACTGG CTGATAGGGGTTGGGTGATG GCATTTCCATTTCCCTAAGCAC CAACACAATCCTGAGGCACA TCCCTTTGCCTCCTGTTGTT GTACTTGCGCTCAGGAGGAG 178 246 173 138 83 259 92 128 109 114 107 312 Glen Brunie, MA, USA) The primer sets were synthesized by Invitrogen Biotechnology (Shanghai, China), and product lengths are listed in Table MDR1, MRP1, BCRP and b-actin products were analyzed on a 1.5% agarose gel Real-time PCRs of CA9, BMP2, MT2A, CD237904, AL707095, AK095731, DKK1 and BC037851 were carried out according to the standard protocol on a Roche LightCycler (Roche, Florence, CA, USA) with SYBR Green detection (TaKaRa SYBR Green Supermix) b-Actin was used as an internal (no differential expression) control The fold change in relative expression of the target gene relative to b-actin was then calculated with the formula described by Livak et al [43] The real-time PCR for all selected genes was repeated three times cDNA microarray A high-density oligonucleotide microarray (GeneChip_ Human 14K-Gene expression profile V2.0; Biochip Co., Shanghai, China) containing 15 553 probe sets was used to compare the gene expression profiles, according to the manufacturer’s instructions After hybridization, the signal intensity of the gene expression level was calculated with genechip operating software imagene (Affymetrix, Santa Clara, CA, USA) A number of housekeeping genes, as well as spike-in control transcripts were used to determine hybridization efficiency, including Homo sapiens glyceraldeh yde-3-phosphate dehydrogenase, b-actin, tubulin, lactate dehydrogenase, CYC1, H2be, EIF4A2, UBB, and NUP98 Genes whose expression levels were increased or decreased by more than two-fold in PYM-resistant cells (as compared with parent cells) were considered to be differentially expressed was carried out with antibodies against MT2A (rabbit polyclonal antibody produced by our laboratory), CA9 and HIF-1a (Santa Cruz Biotechnology, Santa Cruz, CA, USA), caspase and PARP (Cell Signal, Danvers, MA, USA), respectively, followed by incubation with a horseradish peroxidase-conjugated secondary antibody Protein bands were detected with an ECL detection system (Amersham Biosciences, Beijing, China) The a-tubulin was detected with mAb (Santa Cruz Biotechnology) simultaneously as a loading control All western blot analyses were repeated at least three times Administration of CA9 ASOs to Tca8113 ⁄ PYM cells The three sequences of CA9 ASOs corresponding to different sites of human CA9 (1, 5¢-CCTCTCTGGGTGAAT CCTCTT-3¢; 2, 5¢-CAACTGCTCATAGGCACTGTT-3¢; and 3, 5¢-AATGAGCAGGACAGGACAGTT-3¢) were selected, and a scrambled oligonucleotide (5¢-TTCTCCTA AGTGGGTCTCTCC-3¢) was used as a control The cells were transfected according to the instructions provided by the manufacturer of oligofectamine, a cationic lipid (Invitrogen) Briefly, the day before transfection, Tca8113 ⁄ PYM cells were plated into six-well plates When the cells were 30–50% confluent, they were transfected with 50 nm CA9 ASO or scrambled ASO after a preincubation for 20 with oligofectamine in serum-free medium Six hours after the beginning of the transfection, the medium was replaced with RPMI-1640 medium containing 10% fetal bovine serum Two days later, CA9 expression was determined by western blot, the cell viability after PYM treatment was examined by MTT assay, and apoptosis was detected with Hoechst33258 stain Western blot analysis Total proteins were extracted from cells, and then separated by 10% SDS ⁄ PAGE The proteins were then transferred to a poly(vinylidene difluoride) membrane, and immunoblotting 4516 Caspase activity assay Caspase activity was determined with a caspase activity kit (Beyotime), through cleavage of a colorless substrate FEBS Journal 277 (2010) 4506–4518 ª 2010 The Authors Journal compilation ª 2010 FEBS G Zheng et al specific for caspase [Ac-DEVD-p-nitroaniline (pNA)], releasing the chromophore pNA Assays were carried out according to the manufacturer’s instructions To evaluate the activity of caspase 3, cell lysates were prepared after their respective treatments with various designated procedures Assays were performed on 96-well microtiter plates by incubating 10 lL of protein from cell lysate per sample in 80 lL of reaction buffer and 10 lL of caspase substrate (Ac-DEVD-pNA, mm) Lysates were incubated at 37 °C for h Samples were measured with an ELISA reader at an absorbance of 405 nm Statistical analyses Quantitative results were expressed as the mean ± standard deviation Statistical analyses were carried out with spss for Windows, Version 11.0 (Chicago, IL, USA) Student’s t-test was used to evaluate the statistical significance A P-value < 0.05 or < 0.01 was set as the criterion for statistical significance Acknowledgements This study was supported by grants from the National Natural Science Foundation of China (30873088) and the Doctoral Fund of the Ministry of Education of China (200805330009) References Landis SH, Murray T, Bolden S & Wingo PA (1999) Cancer statistics 1999 CA Cancer J Clin 49, 8–31 Chin D, Boyle GM, Porceddu S, Theile DR, Parsons PG & Coman WB (2006) Head and neck cancer: past, present and future Exp Rev Anticancer Ther 6, 111–118 Moore SR, Johnson NW, Pierce AM & Wilson DF (2000) The epidemiology of tongue carcinoma: a review of global incidence Oral Dis 6, 75–84 ´ Pignon JP, Bourhis J, Domenge C & Designe L (2000) Chemotherapy added to locoregional treatment for head and neck squamous-cell carcinoma: three metaanalyses of updated individual data MACH-NC Collaborative Group Mete-Analysis of Chemotherapy on Head and Neck Cancer Lancet 355, 949–955 Chen XQ, Jian XC & Guo F (2002) Retrospective study on the patients with tongue squamous cell carcinoma to pinyangmycin preoperative chemotherapy Lin Chuang Kou Qiang Yi Xue Za Zhi 18, 126–127 Zhang Y (2003) Therapeutic efficacy of adjuvant pinyangmycin for preoperative chemotherapy in treatment of 77 patients with tongue cancer Tian Jin Yi Ke Da Xue Xue Bao 9, 511–513 Role of CA9 in PYM resistance Leng WD, Wang DZ, Feng G & He J (2004) Expression and implication of Pgp, MRP, LRP, GST-p, Top-a in tongue squamous cell carcinoma West China J Stomatol 1, 23–25 Tai KW, Chang YC, Chou LSS & Chou MY (1998) Cytotoxicity effect of pingyangmycin on cultured KB cells Oral Oncol 34, 219–223 Li XT (1990) Anticancer spectrum of pingyangmycin in vitro Zhongguo Yi Xue Ke Xue Yuan Xue Bao 12, 182–186 10 Zhong PQ, Zhi FX, Li R, Xue JL & Shu GY (1998) Long-term results of intratumorous bleomycin-A5 injection for head and neck lymphangioma Oral Surg Oral Med Oral Pathol Oral Radiol Endod 86, 139–144 11 Dean M, Fojo T & Bates S (2005) Tumour stem cells and drug resistance Nat Rev Cancer 5, 275–284 12 Zembutsu H, Ohnishi Y, Tsunoda T, Furukawa Y, Katagiri T, Ueyama Y, Tamaoki N, Nomura T, Kitahara O, Yanagawa R et al (2002) Genome-wide cDNA microarray screening to correlate gene expression profiles with sensitivity of human cancer xenografts to anticancer drugs Cancer Res 62, 518–527 13 Pastorekova S, Zatovicova M & Pastorek J (2008) Cancer associated carbonic anhydrases and their inhibition Curr Pharm Des 14, 685–698 14 Murakami Y, Kanda K, Tsuji M, Kanayama H & Kagawa S (1999) MN ⁄ CA9 gene expression as a potential biomarker in renal cell carcinoma BJU Int 83, 743–747 15 Wykoff CC, Beasley NJ, Watson PH, Turner KJ, Pastorek J, Sibtain A, Wilson GD, Turley H, Talks KL, Maxwell PH et al (2000) Hypoxia-inducible expression of tumor-associated carbonic anhydrases Cancer Res 60, 7075–7083 16 Robertson N, Potter C & Harris AL (2004) Role of carbonic anhydrase IX in human tumor cell growth, survival, and invasion Cancer Res 64, 6160–6165 17 Koukourakis MI, Giatromanolaki A, Sivridis E, Simopoulos K, Pastorek J, Wykoff CC, Gatter KC & Harris AL (2001) Hypoxia-regulated carbonic anhydrase-9 (CA9) relates to poor vascularization and resistance of squamous cell head and neck cancer to chemoradiotherapy Clin Cancer Res 7, 3399–3403 18 Pouyssegur J, Dayan F & Mazure NM (2006) Hypoxia signaling in cancer and approaches to enforce tumour regression Nature 441, 437–443 19 Brahimi-Horn MC, Chiche J & Pouyssegur J (2007) Hypoxia signalling controls metabolic demand Curr Opin Cell Biol 19, 223–229 20 Roos A & Boron WF (1981) Intracelluar pH Physiol Rev 61, 296–434 21 Pouyssegur J, Sardet C, Franchi A, L’Allemain G & Paris S (1984) A specific mutation abolishing Na+ ⁄ H+ antiport activity in hamster fibroblasts FEBS Journal 277 (2010) 4506–4518 ª 2010 The Authors Journal compilation ª 2010 FEBS 4517 Role of CA9 in PYM resistance 22 23 24 25 26 27 28 29 30 31 32 G Zheng et al precludes growth at neutral and acidic pH Proc Natl Acad Sci USA 81, 4833–4837 Chambard JC & Pouyssegur J (1986) Intracellular pH controls growth factor-induced ribosomal protein S6 phosphorylation and protein synthesis in the G0–G1 transition of fibroblasts Exp Cell Res 164, 282–294 ` Chiche J, Ilc K, Laferriere J, Trottier E, Dayan F, ´ Mazure NM, Brahimi-Horn MC & Pouyssegur J (2009) Hypoxia-inducible carbonic anhydrase IX and XII promote tumor cell growth by counteracting acidosis through the regulation of the intracellular pH Cancer Res 69, 358–368 Matsuyama S, Llopis J, Deveraux QL, Tsien RY & Reed JC (2000) Changes in intramitochondrial and cytosolic pH: early events that modulate caspase activation during apoptosis Nat Cell Biol 2, 318–325 Nagel WW & Vallee BL (1995) Cell cycle regulation of metallothionein in human colonic cancer cells Proc Natl Acad Sci USA 92, 579–583 Jayasurya A, Bay BH, Yap WM & Tan NG (2000) Correlation of metallothionein expression with apoptosis in nasopharyngeal carcinoma Br J Cancer 82, 1198–1203 Theocharis SE, Margeli AP & Koutselinis A (2003) Metallothionein: a multifunctional protein from toxicity to cancer Int J Biol Markers 18, 162–169 Miyazaki H, Naitoh Y, Nakahashi Y, Yanagitani S, Kuno K, Ueno Y, Okajima A & Inoue K (1998) Induction of metallothionein isoforms in rat hepatoma cells by various anticancer drugs J Biochem 124, 65–71 Kelley SL, Basu A, Teicher BA, Hacker MP, Hamer DH & Lazo JS (1998) Over expression of metallothionein confers resistance to anticancer drugs Science 241, 1813–1815 Wang GW, Klein JB & Kang YJ (2001) Metallothionein inhibits doxorubicin-induced mitochondrial cytochrome c release and caspase-3 activation in cardiomyocytes J Pharmacol Exp Ther 298, 461–468 Chun JH, Kim HK, Kim E, Kim IH, Kim JH, Chang HJ, Choi IJ, Lim HS, Kim IJ, Kang HC et al (2004) Increased expression of metallothionein is associated with irinotecan resistance in gastric cancer Cancer Res 64, 4703–4706 Yang F, Zhou M, He Z, Liu X, Sun L, Sun Y & Chen Z (2007) High-yield expression in Escherichia coli of soluble human MT2A with native functions Protein Expr Purif 53, 186–194 4518 33 Jin Y, Tipoe GL, Liong EC, Lau TY, Fung PC & Leung KM (2001) Overexpression of BMP-2 ⁄ 4, -5 and BMPR-IA associated with malignancy of oral epithelium Oral Oncol 37, 225–233 34 Langenfeld EM, Calvano SE, Abou-Nukta F, Lowry SF, Amenta P & Langenfeld J (2003) The mature bone morphogenetic protein-2 is aberrantly expressed in nonsmall cell lung carcinomas and stimulates tumor growth of A549 cells Carcinogenesis 24, 1445–1454 35 Langenfeld EM & Langenfeld J (2004) Bone morphogenetic protein-2 stimulates angiogenesis in developing tumors Mol Cancer Res 2, 141–149 36 Reya T & Clevers H (2005) Wnt signalling in stem cells and cancer Nature 434, 843–850 37 Bafico A, Liu G, Yaniv A, Gazit A & Aaronson SA (2001) Novel mechanism of Wnt signalling inhibition mediated by Dickkopf-1 interaction with LRP6 ⁄ Arrow Nat Cell Biol 3, 683–686 38 Mao B, Wu W, Davidson G, Marhold J, Li M, Mechler BM, Delius H, Hoppe D, Stannek P, Walter C et al (2002) Kremen proteins are Dickkopf receptors that regulate Wnt ⁄ b-catenin signaling Nature 417, 664–667 39 Lee AY, He B, You L, Xu Z, Mazieres J, Reguart N, Mikami I, Batra S & Jablons DM (2004) Dickkopf-1 antagonizes Wnt signalling independent of b-catenin in human mesothelioma Biochem Biophys Res Commun 323, 1246–1250 40 Mikheev AM, Mikheeva SA, Liu B, Cohen P & Zarbl H (2004) Functional genomics approach for the identification of putative tumor suppressor genes: Dickkopf-1 as suppressor of HeLa cell transformation Carcinogenesis 25, 47–59 41 Aguilera O, Fraga MF, Ballestar E, Paz MF, Herranz M, Espada J, Garcı´ a JM, Munoz A, Esteller M & ˜ ´ Gonzalez-Sancho JM (2006) Epigenetic inactivation of the Wnt antagonist DICKKOPF-1 gene in human colorectal cancer Oncogene 25, 4116–4121 42 Vibhakar R, Foltz G, Yoon JG, Field L, Lee H, Ryu GY, Pierson J, Davidson B & Madan A (2007) Dickkopf-1 is an epigenetically silenced candidate tumor suppressor gene in medulloblastoma Neurooncology 9, 135–144 43 Livak KJ & Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C (T)) method Methods 25, 402–408 FEBS Journal 277 (2010) 4506–4518 ª 2010 The Authors Journal compilation ª 2010 FEBS ... CTGCGGTGCTGTTGTGG CACCATCATAAGGGTAAACAT ACAGCAAAAAGGAGGCCAAA GCCACAATCCAGTCATTCCA GATAAGCTTGTGGAAGTCGCGT TCTCACTGGCCCTAAACTGG CTGATAGGGGTTGGGTGATG GCATTTCCATTTCCCTAAGCAC CAACACAATCCTGAGGCACA TCCCTTTGCCTCCTGTTGTT... CGGAAACGCCTTAAGTCCAG AATAAGCTTCCGACTCTAGCCGC AGCTGGTGCAGGAGGAAGTA CCGAGAACCGAACTTACCAA AGGAAGCACCCAGCAATACCA CACCTTGGATGGGTATTCCA CACAGCTCCCATTCATTCCA TCCTCCCTGGAGAAGAGCTA CTCCTGGGACACGATGC CTGCGGTGCTGTTGTGG... ovarian carcinomas, colorectal carcinomas, esophageal carcinomas, bladder carcinomas and non-small cell lung carcinomas CA9 is strongly induced by hypoxia via the transcription factor hypoxia-inducible