Báo cáo khoa học: The proximity between C-termini of dimeric vacuolar H+-pyrophosphatase determined using atomic force microscopy and a gold nanoparticle technique ppt

The proximity between C-termini of dimeric vacuolar H + -pyrophosphatase determined using atomic force microscopy and a gold nanoparticle technique Tseng-Huang Liu 1 , Shen-Hsing Hsu 1 , Yun-Tzu Huang 1 , Shih-Ming Lin 1 , Tsu-Wei Huang 2 , Tzu-Han Chuang 3 , Shih-Kang Fan 4 , Chien-Chung Fu 3 , Fan-Gang Tseng 2, * and Rong-Long Pan 1, * 1 Department of Life Sciences and Institute of Bioinformatics and Structural Biology, College of Life Sciences, National Tsing Hua Univer- sity, Hsin Chu, Taiwan, ROC 2 Department of Engineering and System Science, National Tsing Hua University, Hsin Chu, Taiwan, ROC 3 Institute of NanoEngineering and MicroSystems, National Tsing Hua University, Hsin Chu, Taiwan, ROC 4 Institute of Nanotechnology, National Chiao Tung University, Hsin Chu, Taiwan, ROC Introduction Vacuolar H + -pyrophosphatase (V-PPase; EC 3.6.1.1) is a homodimeric protein with a monomeric molecular mass of 71–80 kDa [1]. V-PPase catalyzes electrogenic proton translocation from the cytosol to the vacuolar lumen to generate an inside-acidic and inside-positive membrane potential for the secondary transport of ions, metabolites, and toxic substances [1–3]. The cDNAs of V-PPase have been cloned from several higher plants, some protozoa, and several species of eubacteria and archeubacteria, and are highly similar (86–91% deduced amino acid identity) [1,3,4]. V-PPase requires Mg 2+ as a cofactor, and the binding of Mg 2+ Keywords atomic force microscopy; proton translocation; tonoplast; vacuolar H + -pyrophosphatase; vacuole Correspondence R L. Pan, Department of Life Sciences and Institute of Bioinformatics and Structural Biology, College of Life Sciences, National Tsing Hua University, Hsin Chu 30013, Taiwan, ROC Fax: +886 3 5742688 Tel: +886 3 5742685 E-mail: rlpan@life.nthu.edu.tw *These authors contributed equally to this work (Received 1 March 2009, revised 17 May 2009, accepted 10 June 2009) doi:10.1111/j.1742-4658.2009.07146.x Vacuolar H + -translocating inorganic pyrophosphatase [vacuolar H + -pyro- phosphatase (V-PPase); EC 3.6.1.1] is a homodimeric proton translocase; it plays a pivotal role in electrogenic translocation of protons from the cyto- sol to the vacuolar lumen, at the expense of PP i hydrolysis, for the storage of ions, sugars, and other metabolites. Dimerization of V-PPase is neces- sary for full proton translocation function, although the structural details of V-PPase within the vacuolar membrane remain uncertain. The C-termi- nus presumably plays a crucial role in sustaining enzymatic and proton- translocating reactions. We used atomic force microscopy to visualize V-PPases embedded in an artificial lipid bilayer under physiological condi- tions. V-PPases were randomly distributed in reconstituted lipid bilayers; approximately 43.3% of the V-PPase protrusions faced the cytosol, and 56.7% faced the vacuolar lumen. The mean height and width of the cyto- solic V-PPase protrusions were 2.8 ± 0.3 nm and 26.3 ± 4.7 nm, whereas those of the luminal protrusions were 1.2 ± 0.1 nm and 21.7 ± 3.6 nm, respectively. Moreover, both C-termini of dimeric subunits of V-PPase are on the same side of the membrane, and they are close to each other, as visualized with antibody and gold nanoparticles against 6·His tags on C-terminal ends of the enzyme. The distance between the V-PPase C-termi- nal ends was determined to be approximately 2.2 ± 1.4 nm. Thus, our study is the first to provide structural details of a membrane-bound V-PPase dimer, revealing its adjacent C-termini. Abbreviations AFM, atomic force microscopy; DDM, n-dodecyl-b- D-maltoside; GNP, gold nanoparticle; SD, standard deviation; V-PPase, vacuolar H + -pyrophosphatase; TEM, transmission electron microscopy. FEBS Journal 276 (2009) 4381–4394 ª 2009 The Authors Journal compilation ª 2009 FEBS 4381 can stabilize and activate the enzyme [1,5]. Relatively high concentrations of K + stimulate the proton-trans- locating function of V-PPase, whereas excess amounts of PP i ,Ca 2+ ,Na + and F ) inhibit its enzymatic activ- ity [6–8]. It is conceivable that the V-PPase provides specific binding domains for the substrate and the above-mentioned ions, as well as proton translocation. Truncation of the C-terminus induces a dramatic decline in V-PPase enzymatic activity, proton translo- cation, and coupling efficiency [9]. In addition, deletion of the C-terminus of V-PPase increases its susceptibil- ity to heat stress and substantially increases the appar- ent K + binding constant. It is thus likely that the C-terminus plays an essential role in sustaining the physiological functions of V-PPase. Interactions between the subunits of the V-PPase dimer have been studied [1,2,10–12]. Radiation inac- tivation analysis demonstrated that the proper dimeric structure of V-PPase on tonoplastic mem- branes is a prerequisite for both enzymatic activity and PP i -supported proton translocation [2,11,12]. Further target size measurements revealed that only one subunit of the purified dimeric complex was suf- ficient for the enzymatic reaction of V-PPase, although proton translocation requires the presence of both subunits [2]. Moreover, high hydrostatic pressure was employed to inhibit V-PPase through subunit dissociation of the enzyme, resulting in inac- tive forms [10]. The physiological substrate and sub- strate analogs enhance the high-pressure inhibition of V-PPase, indicating the vulnerability of the subunit– subunit interaction [10]. The above lines of evidence illustrate explicitly the importance of dimer forma- tion for V-PPase function, and suggest nonrandom and sequestered association of V-PPase subunits within the vacuolar membrane. Furthermore, the structures of purified V-PPases from pumpkin (Cu- curbita sp. Kurokawa Amagur) and Thermotoga mar- itime have been examined by electron microscopy [13,14]. Notwithstanding this, structure–function rela- tionships within this proton-translocating complex require further study. Atomic force microscopy (AFM) is a powerful tool used for nanoscale structural analysis of protein complexes [15,16], and of supported lipid bilayers in particular [17–20]. For instance, AFM has provided marvelously high-resolution images of purified dimeric membrane proteins in 2D crystals and of densely packed proteins in native membranes [21–23]. In the present study, we used AFM to directly observe purified V-PPases reconstituted into planar lipid bilayers under physiological conditions. Our images unambiguously reveal a dimeric complex for this proton-transporting V-PPase. Furthermore, the molecular volume of V-PPase calculated from AFM images suggests the presence of two identical subun- its, verifying the notion of the homodimeric V-PPase enzyme. A gold nanoparticle (GNP) technique com- bined with transmission electron microscopy (TEM) analysis was utilized to determine the distance between C-termini within a membrane-bound V-PPase dimer, and indicated that the C-termini are located at the interface of subunits. Results and discussion AFM analysis of purified V-PPase adsorbed onto mica Recombinant DNAs for overexpression of V-PPases containing a 6·His tag at either the C-terminus or N-terminus were prepared and transformed into a yeast host. Recombinant V-PPase containing a 6·His tag at the C-terminus (Fig. 1C) was overexpressed in yeast and successfully purified from microsomes. Unfortunately, V-PPase containing a 6·His tag at the N-terminus was poorly expressed in yeast and was therefore excluded from the study (data not shown). SDS/PAGE analysis of the purified C-termi- nal 6·His-tagged V-PPase followed by Coomassie Blue staining or western blotting showed that it was highly purified, comprising a single major band with a molecular mass of 73 kDa (Fig. 1A), as expected from the known structure of the V-PPase monomer [1,2,10]. During size exclusion chromatography, V-PPase was eluted with an apparent molecular mass of  145 kDa, similar to its native form and in agreement with previous studies suggesting a dimeric conformation [2,10–12]. The purified V-PPase was then reconstituted into liposomes by a detergent removal method using Bio- Rad SM-2 beads combined with freeze–thaw sonica- tion [13]. On addition of PP i to the proteoliposome solution containing Mg 2+ , a dramatic decrease in pH was generated in the interior of the liposomes (Fig. 1B, lower trace). The acidic pH was eliminated by the addition of the ionophore gramicidine D (5 lgÆmL )1 ), indicating the integrity of the membrane (data not shown). The liposomes alone (without V-PPase) did not exhibit proton-translocating activity (Fig. 1B, upper trace). Individual V-PPase molecules were adsorbed randomly on the mica surface and exhibited a proto- typical globular structure under physiological condi- tions (Fig. 2A). Figure 2B shows the heights of the adsorbed particles along the cross-section in Fig. 2A. Adjacent C-termini of dimeric H + -pyrophosphatase T H. Liu et al. 4382 FEBS Journal 276 (2009) 4381–4394 ª 2009 The Authors Journal compilation ª 2009 FEBS The width of individual protein molecules was measured at half the vertical height. The mean width and height [± standard deviation (SD), n = 21] of purified V-PPase were 22.5 ± 3.2 nm and 1.6 ± 0.4 nm, respectively. Furthermore, major peaks on height and width histograms for the AFM images also concurred with those parameters obtained above for V-PPase molecules (Fig. 2C,D). The flattening of particles was presumably caused by the interaction between the polar surface of the protein molecules and the charged surface of the mica [24]. These images represent the first direct nanoscale observation of V-PPase. Determination of molecular volume provides the stoichiometry of subunit components for functional enzymes [24]. In this study, the volume of V-PPase was calculated using Eqn (1) and determined to be 302.4 ± 40.6 nm 3 (V s )(n = 21), which was slightly larger than the theoretical value (V prot ; 274.5 nm 3 )of the protein (Table 1). This slight overestimation in volume probably arose from the broadening effect of the AFM tip [24]. It is also likely that variations in volume measurements might arise from distinct inter- actions of the tip with the individual purified V-PPase particles [25]. Nonetheless, these results unambiguously demonstrate the feasibility of this technique for nanoscale investigation of purified V-PPase molecules. AFM analysis of V-PPase reconstituted into liposomes The homodimeric structure of V-PPase in a planar lipid bilayer was imaged directly by AFM (Fig. 3). Purified V-PPase was first reconstituted into a sup- ported lipid bilayer, as confirmed by immunofluores- cence imaging (Fig. 3A). Figure 3A1 shows a planar lipid bilayer reconstituted with V-PPases and ana- lyzed by immunofluorescence using a primary anti- body against His followed by a Cy3-conjugated secondary antibody; no fluorescence was detected in bilayers without immunofluorescence labeling of the protein (Fig. 3A2). In addition, no immunofluores- cence was observed when the reconstituted sample was incubated directly with the Cy3-conjugated sec- ondary antibody in the absence of primary antibody against His (Fig. 3A3). Lipid bilayers lacking V-PPases also did not exhibit detectable fluorescence (Fig. 3A4). These results indicated successful incorpo- ration of V-PPase into a lipid bilayer, allowing for subsequent AFM analysis. To obtain high-resolution AFM images of individ- ual V-PPases within reconstituted membranes, the proteoliposomes prepared above were fused into a large planar lipid bilayer for direct observation. The thickness of the lipid bilayer without any protein was approximately 4.6 ± 0.5 nm (n = 12), determined Fig. 1. Purification and proton transport activity of V-PPase. (A) Analysis of purified V-PPase by western blotting (top) and SDS/ PAGE and Coomassie Blue staining (bot- tom). Lane 1: V-PPase-enriched microsome. Lane 2: purified V-PPase. Lane 3: reconsti- tuted V-PPase. Molecular mass (kDa) mark- ers are indicated on the left. (B) PP i - associated proton translocation of reconsti- tuted V-PPase. Proton transport was initi- ated by adding 1.0 m M PP i . At the end of each reaction, 5 lgÆmL )1 gramicidin D was added to stop the fluorescence quenching of acridine orange. (C) Topological model of V-PPase. Cylinders 1–16 indicate mem- brane-spanning domains. T H. Liu et al. Adjacent C-termini of dimeric H + -pyrophosphatase FEBS Journal 276 (2009) 4381–4394 ª 2009 The Authors Journal compilation ª 2009 FEBS 4383 from a cross-section of the lipid bilayer. The bilayer thickness was consistent with previous AFM mea- surements of a lipid bilayer composed of a phospha- tidylcholine/cholesterol mixture and prepared in a similar aqueous environment [26]. V-PPases reconsti- tuted into the lipid bilayer protruded from the bilayer surface in a diffuse pattern with a random distribution. The V-PPase images fell within two cat- egories according to the extramembranous protrusion height. These height differences reflect two distinct populations of individual V-PPases facing the recon- stituted membrane surface (Fig. 3D,E). Three-dimen- sional analysis of individual V-PPases randomly distributed on the membrane surface indicated that 56.7% of the protrusions were small, with a mean height of 1.2 ± 0.1 nm (n = 20) (Fig. 3B, solid cir- cles), and the remainder of the protrusions (43.3%) were large, with a mean height of 2.8 ± 0.3 nm (n = 17) (Fig. 3B, dotted circle). The uneven distri- bution and/or orientation of V-PPases on the mem- brane suggests that targeting of the V-PPase into the vacuolar membrane of plant cells may follow a spe- cific pattern, as previously suggested [10]. Figure 3C shows a cross-section along the line in Fig. 3B. The widths and heights of the reconstituted V-PPase pro- trusions in Fig. 3B are listed in Table 1. The AFM image of reconstituted V-PPase shows a ratio of approximately 2.40 : 1 for the height values of the cytosolic and luminal sides. In addition, the theoreti- cal ratio of the total amount of amino acids on the cytosolic and luminal sides was calculated as 2.31 : 1 (data not shown), verifying the efficacy of this tech- nique. The high protein density in 2D crystals or in native membranes allows high-resolution AFM topographs and the elucidation of protein subunit organization [21–23]. However, it is presently difficult to obtain V-PPase reconstituted in 2D crystals or packed at high density into a membrane (data not shown). Notwith- standing this, current AFM techniques suffice to provide unambiguous images of the dimeric structure of V-PPase. Four representative examples exhibiting minor variations are shown in Fig. 4A. The small differences in topography of the individual V-PPases in A B D C Fig. 2. AFM analysis of purified V-PPase. (A) Three-dimensional AFM image of purified V-PPase adsorbed onto mica. (B) Profile of peak heights along the cross-section shown in (A). Purified V-PPase protrudes 1.6 ± 0.4 nm (n = 21) from the mica surface. (C) Histo- gram of V-PPase height determined using the AFM image in (A). (D) Histogram of V-PPase width determined using the AFM image in (A). Adjacent C-termini of dimeric H + -pyrophosphatase T H. Liu et al. 4384 FEBS Journal 276 (2009) 4381–4394 ª 2009 The Authors Journal compilation ª 2009 FEBS the reconstituted lipid bilayer have probably resulted from contact with the AFM tip during scanning. Nevertheless, these AFM images are adequate for nanoscale resolution of the structural details of V-PPase [27,28]. Moreover, the resolution of the images from V-PPases in reconstituted membranes was Table 1. Dimensions of free and membrane-bound recombinant V-PPase determined by AFM. Values represent means ± SD. n = number of observations. Observed and predicted volumes were determined from AFM analysis using Eqn (1) and from theoretical analysis using Eqn (2). Protein (145 kDa) Height (nm) Width (nm) Volume (nm 3 ) Observed Predicted Purified V-PPase (n = 21) 1.6 ± 0.4 22.5 ± 3.2 302.4 ± 40.6 274.5 Reconstituted V-PPase 332.9 ± 46.9 274.5 Lumen side (n = 20) 1.2 ± 0.1 21.7 ± 3.6 Cytosolic side (n = 17) 2.8 ± 0.3 26.3 ± 4.7 Lipid bilayer (n = 12) 4.6 ± 0.5 Fig. 3. Reconstitution of V-PPase into proteoliposomes. (A) Immunofluorescence imaging of V-PPases reconstituted into lipid bilayers. (1) Sample treated with primary and secondary antibodies. (2) Sample not treated with either antibody. (3) Sample treated with only secondary antibody. (4) Lipid bilayer lacking V-PPases but treated with primary and secondary antibodies. (B) AFM image of V-PPase extramembranous protrusions on the luminal and cytosolic sides of the membrane. Solid circle, luminal side; dotted circle, cytosolic side. Inset: section of a lipid bilayer with thickness of 4.6 ± 0.5 nm (n = 12). (C) Profile of protrusion heights along the cross-section shown in (B). Two populations of V-PPase protrusions were observed: one with a mean height of 1.2 ± 0.1 nm (n = 20), and one with a mean height of 2.8 ± 0.3 nm (n = 17). (D) Histogram of V-PPase protrusion heights determined using the AFM image in (B). (E) Histogram of V-PPase peak widths deter- mined using the AFM image in (B). T H. Liu et al. Adjacent C-termini of dimeric H + -pyrophosphatase FEBS Journal 276 (2009) 4381–4394 ª 2009 The Authors Journal compilation ª 2009 FEBS 4385 typically higher than that of those directly adsorbed onto a mica surface. The volume of the V-PPase homodimers (V m ) in the reconstituted membrane was estimated using the height of the protein protrusion and the thickness of the lipid bilayer as the parameters for the volume of a sphere (Fig. 4B). The volume of reconstituted V-PPase was measured as 332.9 ± 46.9 nm 3 (n = 17). The V prot of a V-PPase homodimer with a molecular mass of 145 kDa, calculated on the basis of the amino acid composition, was determined to be 274.5 nm 3 [29]. This theoretical volume correlates very well with that measured from the AFM images. Note that these images were obtained by AFM scanning in a fluid, and therefore probably provide an authentic illustra- tion of V-PPase structure under physiological condi- tions. The AFM images indicate the dimeric structure of V-PPase reconstituted in a lipid bilayer. This study provides the first 3D representation of individual V-PPases protruding from the cytosolic and luminal sides of a membrane in aqueous solution. Proximity of V-PPase C-termini in reconstituted membranes Topology studies examining heterologous V-PPase expression in yeast suggested that both the C-termini and the N-termini of each subunit are located on the lumen side and are opposite the catalytic domain on the cytosolic side of the vesicular membrane [1]. Because V-PPase is homodimeric, there are two possi- ble configurations for association of the two subunits; the C-termini of both subunits may protrude from the same side or from opposite sides of the membrane Fig. 4. High-resolution AFM image of V-PPase dimers in a reconstituted membrane. (A) AFM analysis of extramembranous protrusions on the cytosolic side of proteoliposomes containing V-PPase (top panels) and those on the luminal side (bottom panels). (B) Topological model of the homodimeric structure of V-PPase. Adjacent C-termini of dimeric H + -pyrophosphatase T H. Liu et al. 4386 FEBS Journal 276 (2009) 4381–4394 ª 2009 The Authors Journal compilation ª 2009 FEBS [30]. The present study demonstrated two distinct types of protrusions randomly distributed in reconstituted lipid bilayers. If the C-termini of each V-PPase subunit within a dimer protruded from opposite sides of the membrane, the measured heights of these two types of protrusion should presumably be the same. The nega- tive results above thus indicate that the C-termini of the individual subunits of the enzyme are facing the same side of the membrane. The relative positions and proximity of the V-PPase C-termini on the surface of the reconstituted mem- branes were examined using an IgG antibody against the C-terminal His tag of the enzyme (Fig. 5). The AFM image of the immunolabeled V-PPase showed that protrusions of different heights and widths were randomly distributed on the lipid bilayer (Fig. 5A). The antibody could bind to V-PPase on either one or two molecules (Fig. 5B). Clearly, Fig. 5B2 depicts that two antibodies bind respectively to a single V-PPase mole- cule in close vicinity. AFM image analysis using spip software was used to generate histograms delineating the distribution of protrusion heights and widths (Fig. 5C,D), and this revealed three major groups of protrusions: (a) lower peaks (peak 1; 1.4 ± 0.2 nm mean height, n = 10) for structures of V-PPase on the lumen side of the membrane lacking bound antibody; (b) intermediate peaks (peak 2; 2.9 ± 0.2 nm mean height, n = 20) for those on the cytosolic side of the membrane; and (c) higher peaks (peak 3; 4.2 ± 0.3 nm mean height, n = 10) for antibodies bound presumably to the lumen side. The ratio of the sum of integrals for peak 1 and peak 3 (free lumen side and antibodies bind- ing to the lumen side) to peak 2 (cytosolic side) is con- sistent with our prior results (approximately 5.6 : 4.4). Fig. 5. AFM analysis of V-PPase in a reconstituted lipid bilayer immunolabeled with an antibody against His to detect the C-terminal 6·His tag of V-PPase. (A) Image of a large section of immunolabeled lipid bilayer reconstituted in the presence of V-PPase. (B) High-resolution images of immunolabeled protrusions in (A). (1) Protrusion showing a single antibody bound to V-PPase. (2) Protrusion showing two antibodies bound to V-PPase. (C) Histogram of protrusion height determined using the AFM image in (A). (D) Histogram of protrusion width determined using the AFM image in (A). T H. Liu et al. Adjacent C-termini of dimeric H + -pyrophosphatase FEBS Journal 276 (2009) 4381–4394 ª 2009 The Authors Journal compilation ª 2009 FEBS 4387 Previous AFM imaging studies have demonstrated that the height of a single IgG molecule is 2.4 ± 0.1 nm [24]. Taking this value into account, the height of peak 3 protrusions (4.2 ± 0.3 nm, n = 10) would be that of IgG molecules (2.4 ± 0.1 nm) sitting on V-PPase at the lumen side (1.2 ± 0.1 nm, n = 20). There were also two major groups in the histogram representing the distribution of protrusion widths, probably for those of the single IgG molecule (mean width = 41.5 ± 1.8 nm, n = 12; 38.5% of protru- sions) and those of two IgG molecules (mean width = 51.3 ± 0.8 nm, n = 20; 62.5% of protrusions) bound to a V-PPase in the lipid bilayer, respectively (Fig. 5D). It is well established that the hinge region of IgG links the two Fab arms to the Fc portion, provid- ing global flexibility to the IgG. The flexibility of the IgG molecule results in Fab ‘elbow bending’, Fab ‘arm waving’ and rotation, and Fc ‘wagging’ [31]. The observed variations in the number of IgG molecules bound to the 6·His-tagged C-termini of V-PPase subunits have presumably arisen from such antibody flexibility. Therefore, the space between the two anti- body molecules could not be precisely determined using current techniques. As a result, we were also unable to accurately determine the proximity of the V-PPase C-termini using the antibody-binding technique. We hence employed Ni 2+ –nitrilotriacetic acid GNP labeling as an alternative technique to evaluate the proximity of C-termini within V-PPase homodimers. Extremely small Ni 2+ –nitrilotriacetic acid GNPs were bound to the 6·His tags of V-PPase C-termini recon- stituted in lipid bilayers in aqueous solution, resulting in two major types of protrusion as observed with AFM: the cytosolic side of V-PPase, and the particles bound to the lumen side of V-PPase, respectively (Fig. 6). The solid circle in Fig. 6B indicates GNP bound to V-PPase C-terminus protruding from the surface of the lipid bilayer, whereas the dotted circle, V-PPase protrusion at the lumen side lacking bound GNP (Fig. 6B). More than 70% of V-PPases were covered by GNPs on the luminal side (data not shown). The height distribution histogram indicated that the heights of the lower V-PPase protrusions (peak 1) were consistent with those of its cytosolic por- tions, whereas the heights of the higher ones (peak 2) represented those of the GNPs bound to the C-termini of the enzyme (Fig. 6C). The height of the latter protrusions (4.9 ± 0.1 nm) reflects the sum of Ni 2+ – nitrilotriacetic acid GNP heights (mean height = 2.0 ± 0.1 nm, n = 16) and V-PPase heights on the luminal side (mean height = 1.2 ± 0.1 nm, n = 20). In contrast, the lower V-PPase protrusions represent those of its cytosolic sides alone. Moreover, in the width distribution histogram, the higher peaks (peak 1) represent either cytosolic protrusions of V-PPase lacking GNPs (mean width = 26.3 ± 4.7 nm, n = 17) or the luminal side containing GNP-bound C-termini (mean width = 28.2 ± 1.4 nm, n = 48). Other peaks (peaks 2 and 3) in the width distribution histogram (> 50 nm) probably reflect GNP clusters, because  20% of GNPs in solution are visualized as collec- tions after sonication (data not shown). The number of GNPs bound to V-PPase C-termini was then predicted using a Microscope Simulator (Com- puter Integrated Systems for Microscopy and Manipula- tion, University of North Carolina, Chapel Hill, NC, USA) (Fig. 6E). The width of the image for a single GNP on mica was empirically determined as 21.2 ± 1.1 nm (n = 27, data not shown); the theoreti- cal width of a single GNP on the surface of V-PPase was 24 nm (Fig. 6E, solid rhombus). The mean width of GNPs on the surface of V-PPase was empirically mea- sured as 28.2 ± 1.4 nm (n = 48), suggesting that more than one GNP was present on the surface of V-PPase. Because V-PPase is a homodimeric enzyme, it is conceiv- able that one GNP was bound to each C-terminus. Moreover, the distance between two GNPs (reflecting that between two V-PPase C-termini) was extrapolated from a simulation plot (Fig. 6E, solid circles). The solid triangle in Fig. 6E reflects the mean width of GNPs on the surface of V-PPase, corresponding to a GNP dis- tance of 2.2 ± 1.4 nm. Our results suggest explicitly that the two C-termini of V-PPase are in close proximity. To validate the prediction that the V-PPase C-termini are adjacent, a TEM analysis was used to directly mea- sure the distance between two GNPs bound to the C-ter- mini of purified V-PPase. The TEM image displays the bound GNPs as solid spheres with a diameter of 2.0 ± 0.2 nm (n = 18) (Fig. 7A). In addition, GNPs bound to V-PPase C-termini occurred in pairs (Fig. 7B), indicating the dimeric structure of the enzyme. The his- togram showing the distribution of distances between GNP pairs observed from the TEM image yields a mean distance of 1.9 ± 0.8 nm (Fig. 7C), concurring with the result generated by AFM analysis of GNP-labeled V-PPase (Fig. 6E; distance = 2.2 ± 1.4 nm). The slight fluctuation in distances between GNP pairs most likely arose from the flexibility of the V-PPase C-termini. For instance, the shorter distance observed indicates two closed GNPs on the C-termini of the enzyme. In con- trast, the longer distance indicates a probable extension of the C-termini of V-PPase. Verification of these possi- bilities requires further investigation. The C-terminus of V-PPase has been determined to be relatively conserved among various plant V-PPases, Adjacent C-termini of dimeric H + -pyrophosphatase T H. Liu et al. 4388 FEBS Journal 276 (2009) 4381–4394 ª 2009 The Authors Journal compilation ª 2009 FEBS and is presumed to be proximal to the catalytic site [32]. In addition, the importance of the V-PPase C- terminus in sustaining enzymatic and proton-translo- cating function and for indirect regulation of K + binding has been demonstrated [9]. Moreover, inter- subunit interactions of V-PPase are critical for proper enzyme function [10], suggesting that the interface between the two subunits may participate in enzy- matic and proton-pumping reactions. In the present study, AFM measurements and single nanoparticle analysis using TEM further demonstrated that the two C-termini of V-PPase homodimers are approxi- mately 1.9–2.2 nm apart. In conclusion, our study provides high-resolution images of single V-PPase molecules within a membrane, allowing analysis of the architecture, size and structure of V-PPase in a physiologically relevant environment. We propose a working model in which the proton channel lies at the interface between the C-termini of the V-PPase homodimer (Fig. 8). Fig. 6. AFM analysis of Ni 2+ –nitrilotriacetic acid GNPs bound to the C-terminal 6·His tag of V-PPase. (A) Lipid bilayer reconsti- tuted in the presence of Ni 2+ –nitrilotriacetic acid GNP-bound V-PPase. (B) High-resolu- tion image of individual dimeric structures of V-PPase labeled with GNPs in reconstituted membrane. Solid circle, GNP-bound V-PPase protrusion on the luminal side of the recon- stituted membrane; dotted circle, V-PPase protrusion lacking a GNP label on the lumi- nal side of the membrane. (C) Histogram of the protrusion heights determined using the AFM image in (A). (D) Histogram of the pro- trusion widths determined using the AFM image in (A). (E) Simulation of potential V-PPase protrusion widths based on dis- tances between GNP pairs bound to the V-PPase C-termini. Solid rhombus, predicted protrusion width based on a single GNP molecule bound to the C-terminus of V-PPase; solid circle, predicted protrusion widths based on the distance between two GNP molecules bound to V-PPase C-termini; solid triangle, actual protrusion width of GNP-bound V-PPase determined by AFM. Data represent the mean ± SD. T H. Liu et al. Adjacent C-termini of dimeric H + -pyrophosphatase FEBS Journal 276 (2009) 4381–4394 ª 2009 The Authors Journal compilation ª 2009 FEBS 4389 Experimental procedures Cloning, expression, and purification The mung bean (Vigna radiata L.) V-PPase cDNA (VPP; accession number P21616) [33] was cloned into the yeast expression vector pYES2 (Invitrogen, Carlsbad, CA, USA), and the two synthesized oligonucleotides P his (5¢-CCTCG AGCCATCATCATCATCATCATTAGGGCCGCATCAT GTAATTAGTTATGT-3¢) and P MluI (5¢-GTACACGCG TCTGATCAG-3¢) were inserted into the 3¢-end of the pYES2–VPP plasmid to generate the V-PPase–(His) 6 tail. The pYES2–VPP–(His) 6 cDNA was transferred into the Saccharomyces cerevisiae strain BJ2168 (MATa, prc-407, prb1-1122, pep4-3, leu2, trp1, ura3, GAL) according to the method described previously [34]. The yeast microsomal membranes enriched in 6 · His-tagged V-PPase were pre- pared as described by Kim et al. [35], with minor modifica- tions. Finally, V-PPase-enriched membrane fractions were resuspended in the storage buffer [10 mm Tris/HCl (pH 7.6) and 10% (w/v) glycerol] and stored at )70 °C for fur- ther use. The V-PPase (1 mgÆmL )1 )-enriched microsomal membrane fraction was solubilized in an extraction buffer [10 mm Tris/HCl (pH 8.0), 400 mm KCl, 15% (w/v) glyc- erol, 1 mm phenylmethanesulfonyl fluoride, 0.1% (w/v) n-dodecyl-b-d-maltoside (DDM)] by adding the detergent DDM dropwise, to a final concentration of 6 mgÆmL )1 , and gently stirred for 30 min on ice. The solution was diluted with the extraction buffer described above three- fold to five-fold, and unsolubilized materials were removed by ultracentrifugation at 75 000 g at 4 °C for 1 h. The supernatant was incubated with Ni 2+ –nitrilotriacetic acid beads prewashed with the extraction buffer for 1 h. The Ni 2+ –nitrilotriacetic acid beads were injected into the empty column and eluted at a flow rate of 0.5 mLÆmin )1 with the elution medium [10 mm Tris/HCl (pH 8.0), 15% (w/v) glycerol, 10 mm b-mercaptoethanol, 1 mm phen- ylmethanesulfonyl fluoride, 0.1% (w/v) DDM] with a step gradient of 20, 40, 60 and 250 mm imidazole, respectively. The fractions with highest PP i hydrolysis activity at 250 mm imidazole were pooled and dialyzed against med- ium containing 10 mm Tris/HCl (pH 8.0), 15% (w/v) glyc- erol, and 0.1% (w/v) Triton X-100, and then stored at )70 °C for further studies. Fig. 7. TEM analysis of Ni 2+ –nitrilotriacetic acid GNP-labeled V-PPase. (A) TEM image of Ni 2+ –nitrilotriacetic acid GNP-labeled purified V-PPase. (B) A gallery of zoomed images for the GNP pairs labelled on purified V-PPases. (C) Histogram of the distances between GNP pairs determined using the TEM image in (A). Fig. 8. A working model of V-PPase. The distance between C-termini of V-PPase is approximately 2.2 nm. Adjacent C-termini of dimeric H + -pyrophosphatase T H. Liu et al. 4390 FEBS Journal 276 (2009) 4381–4394 ª 2009 The Authors Journal compilation ª 2009 FEBS [...]... 32 Takasu A, Nakanishi Y, Yamauchi T & Maeshima M (1997) Analysis of the substrate binding site and carboxyl terminal region of vacuolar H+-pyrophosphatase of mung bean with peptide antibodies J Biochem 122, 883–889 33 Hung SH, Chiu SJ, Lin LY & Pan RL (1995) A cDNA clone encoding the A subunit of the vacuolar H+-ATPase from etiolated mung bean seedlings Plant Physiol 109, 1125–1127 34 Hsiao YY, Van... H+-translocating inorganic pyrophosphatase of plant vacuoles Biochem Biophys Res Commun 168, 1157–1162 12 Sarafian V, Potier M & Poole RJ (1992) Radiationinactivation analysis of vacuolar H+-ATPase and H+pyrophosphatase from Beta vulgaris L Functional sizes for substrate hydrolysis and for H+ transport Biochem J 283, 493–497 13 Sato MH, Kasahara M, Ishii N, Homareda H, Matsui H & Yoshida M (1994) Purified vacuolar. .. lm acridine orange, and 100 lgÆmL)1 microsomes The reaction was initiated by adding 1 mm sodium pyrophosphate (pH 7.6) The initial rate of fluorescence quenching was calculated as the proton transport activity [34,39–41] The ionophore, gramicidin D (5 lgÆmL)1), was then included at the end of each assay to confirm the integrity of the membrane SDS/PAGE and western analysis SDS/PAGE was performed according... Kim Y, Sarafian V, Poole RJ, Davies JM & Sanders D (1992) Vacuolar H+-translocating pyrophosphatases: a new category of ion translocase Trends Biochem Sci 17, 348–353 5 Gordon-Weeks R, Steele SH & Leigh RA (1996) The role of magnesium, pyrophosphate, and their complexes as substrates and activators of the vacuolar H+-pumping inorganic pyrophosphatase (studies using ligand protection from covalent inhibitors)... 4391 Adjacent C-termini of dimeric H+-pyrophosphatase T.-H Liu et al Nanogold solution (Nanoprobes, NY, USA), washed twice with NaCl/Pi, and then subjected to AFM imaging V2 is the specific volume of water (1 cm3Æg)1), and d is a factor describing the extent of hydration for air-dried proteins (0.4 mol H2O/mol protein) [44] AFM AFM was performed in the contact mode using a Nanoscope IIIa Multimode atomic. .. V-PPase was performed in the imaging buffer at room temperature (22–23 °C) All images were captured at 512 · 512 pixel resolution and processed using nanoscope III software (Digital Instruments, Santa Barbara, CA, USA) and spip software (Scanning Probe Image Processor; Image Metrology, Lyngby, Denmark) In general, AFM images were low-pass filtered, and single protein images were further passed through an... the volume of a single soluble or purified protein was calculated by regarding the molecule as a segment of a sphere, using Eqn (1) [29]: Vs ¼ ðph=6Þð3r2 þ h2 Þ ð1Þ where Vs is the molecular volume, and h and r are the height and the radius (half of the measured width) of the protein, respectively In addition, molecular volume based on molecular mass was calculated using the Eqn (2): Mo ¼ ðNA Vprot Þ=ðV1... H+-pyrophosphatase Biochim Biophys Acta 1465, 37–51 2 Tzeng CM, Yang CY, Yang SJ, Jiang SS, Kuo SY, Hung SS, Ma JT & Pan RL (1996) Subunit structure of vacuolar proton pyrophosphatase as determined by radiation inactivation Biochem J 316, 143–147 3 Drozdowicz YM & Rea PA (2001) Vacuolar protonpyrophosphatases: from the evolutionary backwaters into the mainstream Trends Plant Sci 6, 206–211 4 Rea PA, Kim Y, Sarafian... polyclonal antibody raised against the MAP (Mitogen-activated protein kinase)-conjugated synthetic peptide of the sequence KVERNIPEDDPRNPA, which corresponds to positions 261–275 of the substrate-binding domain of mung bean V-PPase Bands of immunoblots were visualized using a chemiluminescence kit (New England Nuclear, Boston, MA, USA), according to the manufacturer’s recommendations Reconstitution of V-PPase... to Laemmli [42] Denatured proteins were subjected to SDS/PAGE on a Phast System (Pharmacia, Uppsala, Sweden) with a 12.5% (w/v) polyacrylamide PhastGel The gels were stained with Coomassie Blue or electrotransferred to a poly(vinylidene difluoride) membrane by using semidry electrotransblotting apparatus (Nova Blot, Amersham Pharmacia Biotech, Piscataway, NJ, USA) The blots were incubated with the rabbit . Carlsbad, CA, USA), and the two synthesized oligonucleotides P his (5¢-CCTCG AGCCATCATCATCATCATCATTAGGGCCGCATCAT GTAATTAGTTATGT-3¢) and P MluI (5¢-GTACACGCG TCTGATCAG-3¢). The proximity between C-termini of dimeric vacuolar H + -pyrophosphatase determined using atomic force microscopy and a gold nanoparticle technique Tseng-Huang