Báo cáo khoa học: The proximity between C-termini of dimeric vacuolar H+-pyrophosphatase determined using atomic force microscopy and a gold nanoparticle technique ppt

Báo cáo khoa học: The proximity between C-termini of dimeric vacuolar H+-pyrophosphatase determined using atomic force microscopy and a gold nanoparticle technique ppt

Báo cáo khoa học: The proximity between C-termini of dimeric vacuolar H+-pyrophosphatase determined using atomic force microscopy and a gold nanoparticle technique ppt

... Carlsbad, CA, USA), and the two synthesized oligonucleotides P his (5¢-CCTCG AGCCATCATCATCATCATCATTAGGGCCGCATCAT GTAATTAGTTATGT-3¢) and P MluI (5¢-GTACACGCG TCTGATCAG-3¢) were inserted into the ... indicate that the C-termini of the individual subunits of the enzyme are facing the same side of the membrane. The relative positions and proximity of the V-PPas...
Ngày tải lên : 16/03/2014, 02:20
  • 14
  • 332
  • 0
Báo cáo khoa học: "The Tradeoffs Between Open and Traditional Relation Extraction" potx

Báo cáo khoa học: "The Tradeoffs Between Open and Traditional Relation Extraction" potx

... each relation. A “ ∗ ” indicates the use of all available training data; in these cases, R1- CRF was unable to match the precision of O-CRF. relation-specific data. Using labeled training data, the ... among the output variables Y , and arranging variables sequentially in a linear chain, RE can be treated as a sequence la- beling problem. Linear-chain CRFs have been ap- p...
Ngày tải lên : 08/03/2014, 01:20
  • 9
  • 399
  • 0
Tài liệu Báo cáo khoa học: The tandemly repeated domains of a b-propeller phytase act synergistically to increase catalytic efficiency doc

Tài liệu Báo cáo khoa học: The tandemly repeated domains of a b-propeller phytase act synergistically to increase catalytic efficiency doc

... was determined using the Bradford assay with BSA as the standard [28]. Phytase activity assay Phytase activity was determined by measuring the amount of phosphate released from InsP 6 using a modified ... domain and the functional relationship of tandemly repeated domains in BPPs. We conjecture that dual-domain BPPs have succeeded evolutionarily because they can increas...
Ngày tải lên : 14/02/2014, 15:20
  • 9
  • 801
  • 0
Tài liệu Báo cáo khoa học: The thioredoxin-independent isoform of chloroplastic glyceraldehyde-3-phosphate dehydrogenase is selectively regulated by glutathionylation docx

Tài liệu Báo cáo khoa học: The thioredoxin-independent isoform of chloroplastic glyceraldehyde-3-phosphate dehydrogenase is selectively regulated by glutathionylation docx

... oxidative damage of chloroplastic A 4 -GAPDH. Results Inactivation of A 4 -GAPDH by GSSG and other oxidants, and protection by substrate and cofactors Incubation of recombinant Arabidopsis A 4 -GAPDH with ... Arabidopsis A 4 -GAPDH The sequence encoding the putative mature form of the A. thaliana plastidial A 4 -GAPDH isoform (GapA-1 cDNA At3g26650 provided by T...
Ngày tải lên : 19/02/2014, 05:20
  • 15
  • 515
  • 0
Tài liệu Báo cáo khoa học: DNA strand exchange activity of rice recombinase OsDmc1 monitored by fluorescence resonance energy transfer and the role of ATP hydrolysis pptx

Tài liệu Báo cáo khoa học: DNA strand exchange activity of rice recombinase OsDmc1 monitored by fluorescence resonance energy transfer and the role of ATP hydrolysis pptx

... strand exchange assay were synthesized by Metabion (Martinsreid, Germany) with the following sequences: PhiC: 5¢-CGATACGCTCAAAGTCA AAATAATCAGCGTGACATTCAGAAGGGTAATAAG AACG-3¢;, PhiW: 5¢-CGTTCTTATTACCCTTCTGAA TGTCACGCTGATTATTTTGACTTTGAGCGTATCG-3¢ and ... 5¢-CGTTCTTATTACCCTTCTGAA TGTCACGCTGATTATTTTGACTTTGAGCGTATCG-3¢ and M13C: 5¢-CTACAACGCCTGTAGCATTCCACAGA CAGCCCTCATAGTTAGCGTAACGAGATCG-3¢....
Ngày tải lên : 19/02/2014, 07:20
  • 10
  • 568
  • 0
Tài liệu Báo cáo khóa học: The C-terminal domain of Escherichia coli Hfq increases the stability of the hexamer ppt

Tài liệu Báo cáo khóa học: The C-terminal domain of Escherichia coli Hfq increases the stability of the hexamer ppt

... suggests a conformational change at the interface between the subunits (Fig. 2C, bottom-right), that have been described as the strand b4ofchainBandthe strand b5 of chain A in the crystal structure ... with a 45  ndiamondATR attachment at 20 °C. The spectra are the average of 125 scans. Spectra were corrected for the linear dependence of the absorption measured...
Ngày tải lên : 19/02/2014, 12:20
  • 8
  • 427
  • 0
Tài liệu Báo cáo khoa học: "The grapho-phonological system of written French: Statistical analysis and empirical validation" pdf

Tài liệu Báo cáo khoa học: "The grapho-phonological system of written French: Statistical analysis and empirical validation" pdf

... impose a substantial restatement of the theory, because it violates the core assumption of the approach, namely, that language users induce all- or-none rules from the language to which they are ... models in the dual route framework can always be adapted to fit the empirical data. Although specific proposals might be refuted on the basis of empirical data, the...
Ngày tải lên : 20/02/2014, 19:20
  • 7
  • 502
  • 0
Báo cáo khoa học: The N-terminal region of the bacterial DNA polymerase PolC features a pair of domains, both distantly related to domain V of the DNA polymerase III s subunit ppt

Báo cáo khoa học: The N-terminal region of the bacterial DNA polymerase PolC features a pair of domains, both distantly related to domain V of the DNA polymerase III s subunit ppt

... The actual DNA synthesis is performed by the catalytic a- subunit (PolIIIa), which belongs to the C-family of DNA polymerases [2]. Polymerases of the C-family fall into two major groups, DnaE and ... DNA replication at the elongation step, including the different interactions that coordinate leading and lagging strand synthesis. Although bacterial DNA replication has been...
Ngày tải lên : 05/03/2014, 23:20
  • 10
  • 419
  • 0
Báo cáo khoa học: The oleic acid complexes of proteolytic fragments of a-lactalbumin display apoptotic activity pdf

Báo cáo khoa học: The oleic acid complexes of proteolytic fragments of a-lactalbumin display apoptotic activity pdf

... Fluka (Buchs, Switzerland). All other chemicals were of analytical reagent grade and were Sigma or Fluka products. Preparation of the OA complexes of a- LA fragments The a- LA fragments investigated, ... was shown that the fragments acquire an enhanced content of a- helical secondary structure upon binding OA. The physical and aggregation state of OA at physiological...
Ngày tải lên : 06/03/2014, 09:22
  • 11
  • 399
  • 0
Báo cáo khoa học: The Saccharomyces cerevisiae orthologue of the human protein phosphatase 4 core regulatory subunit R2 confers resistance to the anticancer drug cisplatin pot

Báo cáo khoa học: The Saccharomyces cerevisiae orthologue of the human protein phosphatase 4 core regulatory subunit R2 confers resistance to the anticancer drug cisplatin pot

... pF 6a- HIS3MX6 GGCAATTGGAGTGACATAGCAGCTACTACAACTACAAAAGCAAAATCTCCACAAAGTAAT CGGATCCCCGGGTTAATTAA R13 TUB2 deletion pF 6a- HIS3MX6 CCAAGTGCTTCAATCCTAGAGAAGAAGAAAGGTAAGAAAAAGAAAGGAAAGCAACTTAAT GAATTCGAGCTCGTTTAAAC Resistance ... pFA 6a- 13Myc-HIS3MX6 CAAATGGGAAGTTGTTGGTAGAGAAGTCATCTCTCGATCAGAATTCGAGCTCGTTTAAAC F3 PPH21 N-terminal 3HA tag pMPY-3xHA CATAGTGGAAAGAGGGATATAAATTATCGCATAAAACAATAAACAAA...
Ngày tải lên : 07/03/2014, 12:20
  • 13
  • 389
  • 0

Xem thêm