and are the inductance and capacitance per unit length of the coupled microstrip transmission line and are the capacitances of the loaded varactor at bias u and zero respectively is length of a periodical cell and is number of secti
Tunable ferroelectric thin film devices for microwave applications
... The remnant polarization Pr, is the polarization value of the material at zero bias, also known as the spontaneous polarization, the saturation polarization Ps, is the maximum polarization, and ... Figure 3.20 Tunability of the hybrid varactor at different bias voltages Inset shows the capacitance and the quality factor of the varactor at zero bias 71 Figure 4.1 Equivalent circuit of distributed ... constant called the Curie-Weiss constant and the value of T0 may be equal to or lower than the actual transition temperature Tc (Curie temperature) The validity of this assumption is experimentally...
- 150
- 478
- 0
Vector sum phase shifter using a quadrature magic t for application in polarization control
... into the sum-port and delta-port of the Quadrature Magic-T The signals will be vector-summed by the Quadrature Magic-T circuit when they reach the two output ports The Quadrature Magic-T is a circuit ... polarization (LHCP) and right handed circularly polarization (RHCP) are special cases of elliptical polarization For any other cases (both time variant and invariant), the polarization can always ... wave is dependent on the polarization of the antenna Antenna polarization is a characteristic of the antenna and its orientation [6] Thus, a simple straight wire antenna will have one polarization...
- 144
- 238
- 0
Tài liệu Category 6 and 5e Dynamic Angle Right/Left Patch Panels pptx
... here are current as of the date of publication of this document Because we are continuously improving our products, ADC reserves the right to change specifications without prior notice At any ... you may verify product specifications by contacting our headquarters office in Minneapolis ADC Telecommunications, Inc views its patent portfolio as an important corporate asset and vigorously ... = Purple 05 = Blue 11 = Brown 08 = Orange Spec Sheet Specifications Performance: Applications Supported: Front Interface: Rear Interface: Weight: Rack Mounting: Safety: Operating Temperature:...
- 2
- 288
- 0
Tài liệu Báo cáo khoa học: The Alzheimer b-peptide shows temperature-dependent transitions between left-handed 31-helix, b-strand and random coil secondary structures doc
... temperature The tted curves are calculated assuming the ZimmBragg model using a linearized approximation for s close to the transition temperature The fragments measured are Ab(140) (h), Ab(128 ... (5) and (6) to the data of Fig 2, a transition temperature Tm, an enthaply change DH and a cooperativity r was obtained for each peptide, Table The parameter Tm is the temperature when 50% of the ... Fig The temperature dependence of the / angle calculated from JHNHa couplings The transition temperature Tm calculated from CD data is indicated by an arrow (A) Residues 28 of Ab(19); (B) residues...
- 12
- 287
- 0
transmission line matrix (tlm) in computational mechanics - d. de cogan, et al., (crc, 2006) ww
... time-delay The capacitance and inductance contain parameters ε0 and µ0 and the product 1/(ε0 µ0) is equal to the square of the speed of light in a vacuum The medium of a transmission line through ... inductors and parallel capacitors that act as shunts to ground We could measure the capacitance of a length of line and dividing by the length we would get a value Cd, the distributed capacitance ... of transmission line matrix (TLM), the equivalent electrical analogue has the further major advantage that it leads directly to a simple and natural numerical discretization scheme There is a...
- 275
- 514
- 0
Báo cáo hóa học: " Efficient implementation of 90° phase shifter in FPGA" pptx
... gate) 7 Adder/subtractor 24 Page of converter The phase shifts obtained are 90.7°, 89.98°, and 89.73°, respectively The data from FPGA are captured in the PC and visualized in MATLAB The phase ... other Hardware architecture The proposed hardware architecture is shown in Figure The architecture consists of two basic blocks: coefficient add/sub and tap adder The delays are modeled as Flip-Flop ... output for a 13-MHz sinusoidal input is shown in Figure 15 adding one Here, we use a NOT gate for complementing and the carry of the tap adder is set instead of using an additional adder for adding...
- 5
- 303
- 0
Báo cáo nghiên cứu khoa học: " FAST CALCULATING FORMULAS OF CURRENT PASSING THROUGH GROUNDING SYSTEM OF HIGH VOLTAGE SUBSTATION WHEN LIGHTNING STRIKES AT THE GROUNDING WIRE OF TRANSMISSION LINE" pps
... into one then this equivalent twoterminals network will have the characteristic matrix as follows: ATD = A1 × A2 ×K × An = An (A 1) Appling the Caylay-Hamilton theorem to solve (A 1), we have: ⎡ ... E.IA Riabkova, Grounding on high voltage electrical equipments and apparatuses, Publisher Energy, Moscow, (1978) [3] A P Sakis Meliopoulos, Power system grounding and transients, New York and Basel ... have form as formula (3) (iii) The current which passes through the grounding system impedance of substations when lightning strikes at any point on the grounding wire of transmission line is...
- 8
- 451
- 0
Báo cáo y học: "Acute pressure overload of the right ventricle. Comparison of two models of right-left shunt. Pulmonary artery to left atrium and right atrium to left atrium: experimental study" doc
... the radius Because of the anatomical contiguity between pulmonary artery and left atrium, the length of the PA-LA graft is always shorter than the RA-LA graft The pressure gradient PA-LA is always ... experimental nor clinical data are available regarding the effects of a shunt not at the atrial level but from the pulmonary artery to the left atrium The purpose of this study was to examine the ... Blood gases The statistical analysis of blood gases in both groups of shunt and at all time intervals revealed no statistically difference for arterial pCO2 and arterial pO , arterial O2% saturation,...
- 10
- 337
- 0
Broadband phase shifter design for phased array radar systems
... Chapter uses the networks studied in Chapter and Chapter to design ultra-wideband quadrature and dual-band power dividers Chapter discusses another broadband approach using all-pass networks The ... Yokohama, Japan X Tang and K Mouthaan, Loaded -line phase shifter with enlarged phase shift range and bandwidth,” accepted in EuMC 2010, Paris, France X Tang and K Mouthaan, A broadband 180° phase ... electrically shape and steer the antenna beam In modern radar applications where multi-function capability and communication security are required, broadband phase shifters are essential This work mainly...
- 199
- 297
- 0
Transmission line and and waveguide
... and Dispersion Rectangular Waveguide 32 Earliest type of transmission line Use for couplers, detectors, isolators, attenuators, and slotted lines Wave band: 1~220 GHz Support TE & TM waves ... Laplace’s Equation TEM Wave (Cont.) Electric field can be expressed as the gradient of a Scalar potential also satisfies Laplace ‘s equation The voltage and current Wave Impedance 10 Procedure ... Outline General Solutions for TEM, TE, and TM Waves Parallel Plate Waveguide Rectangular Waveguide Circular Waveguide Coaxial Line Surface Waves on a Grounded Dielectric Sheet Stripline Microstrip...
- 67
- 226
- 0
Báo cáo hóa học: " Research Article Blind Deconvolution in Nonminimum Phase Systems Using Cascade Structure" pptx
... average of 100 trails Figure illustrates the comparison results of the three algorithms It shows that the performances of PFD and NG are similar, and both of them are better than FD algorithm That is ... MISI fluctuates at the initiation in FD algorithm due to the error back propagation In PFD algorithm, we use scalar anticausal filter in PFD and then avoid the error back propagation So the convergence ... situation of simulation 1, such as NG algorithm and Bussgang algorithm In this simulation, we only compared PFD and FD algorithms in nonminimum phase system because both algorithms can separate...
- 10
- 229
- 0
microwave circuit modeling using electromagnetic field simulation
... computational burden? What are the strengths and weaknesses of the different numerical techniques that underlie the various software tools? These are the questions that guide our approach and emphasis ... de-embedding, and visualization Part of this discussion focuses on validation structures and some simple “calibration elements” that stimulate our thinking and make us confident that we are using the tool ... impedances and electrical lengths The software might use a Y-matrix, a cascade of ABCD parameter blocks, or a cascade of S-parameter blocks for the actual analysis At the ports, we typically ask...
- 488
- 730
- 0
Báo cáo sinh học: " Multivariate Bayesian analysis of Gaussian, right censored Gaussian, ordered categorical and binary traits using Gibbs sampling" pptx
... Simulated data The simulated data consist of records on five-thousand animals First the complete data consisting of a Gaussian, a right censored Gaussian, an ordered categorical, and a binary trait are ... analysis of Gaussian, right censored Gaussian, categorical and binary traits using the Gibbs sampler and data augmentation The methodology was applied to analyse a simulated dataset and the results show ... if the number of binary traits is greater than one) The outline of the paper is the following: in Section 2, a fully Bayesian analysis of an arbitrary number of Gaussian, right censored Gaussian,...
- 25
- 166
- 0
Supported group II transition metal catalysts in liquid phase reactions using borrowing hydrogen methodology 2
... Declaration I hereby declare that this thesis is my original work and it has been written by me in its entirety, under the supervision of Prof Stephan Jaenicke, (in the laboratory catalysis lab ... the thesis This thesis has also not been submitted for any degree in any university previously The content of the thesis has been partly published in: H H Liu, G K Chuah, S Jaenicke*, N-alkylation ... S5-04-04 and S5-02-02), Chemistry Department, National University of Singapore, between August 2008 and December 2012 I have duly acknowledged all the sources of information which have been used in the...
- 2
- 324
- 1
Supported group II transition metal catalysts in liquid phase reactions using borrowing hydrogen methodology 1
... chemicals and materials are produced using catalysis at one stage or another The catalyst can either be dissolved in the reaction medium (homogeneous catalysis), or it can be a separate, normally ... particle size Coordinatively saturated (terrace) and coordinatively unsaturated (edge and corner) surface atoms usually have different catalytic activities Kaneda et al observed that in the alcohol ... react with any available nucleophile The characteristic nucleophilicity of the amine substrate makes the transamination pathway available within the amine activation manifold Transamination, also...
- 221
- 658
- 0
Sự khác biệt giữa LEFT JOIN , RIGHT JOIN , INNERJOIN
... Employees.Name FROM Employees, Orders WHERE Employees.Employee_ID = Orders.Employee_ID AND Orders.Product = ‘Printer’ kết trả về: Name Hansen, Ola Sử dụng JOIN Ta sử dụng từ khoá JOIN để kết nối li u ... thứ hai (Orders) N u có dòng bảng Employees không ứng với dòng bảng Orders dòng tính kết trả về: Name Hansen, Ola Svendson, Tove Svendson, Stephen Svendson, Stephen Pettersen, Kari Product Printer ... ON Employees.Employee_ID = Orders.Employee_ID WHERE Orders.Product = ‘Printer’ kết trả về: Name Hansen, Ola Product Printer Table Chair ...
- 3
- 13,035
- 29
Báo cáo khoa học: An engineered right-handed coiled coil domain imparts extreme thermostability to the KcsA channel docx
... thermostability to the KcsA channel Table DNA sequence of the synthesized rhcc gene ACCGTTATCATCGACGACCGTTACGAATCTCTGAAAAACCTGATCACCCTGCGTGCGGACCGTCTGGAAATGATTATCAACGACAACGTTTCTACCATCCTGGCGTCAATT TGA ... for KcsA–RHCC at pH and 8, respectively The open and closed states are indicated at the bottom of the chart NPo values at pH and are indicated above the graphs They are indicative of the mean levels ... thermostability analyses (KcsA–RHCC at pH 8) The tetramer, dimer and monomer bands of KcsA–RHCC are indicated on the left-hand side of the gel The specific temperatures for heat treatment are indicated...
- 11
- 395
- 0
Báo cáo khoa học: "Left-to-Right Target Generation for Hierarchical Phrase-based Translation" doc
... 1993 The mathematics of statistical machine translation: Parameter estimation Computational Linguistics, 19(2):263–311 David Chiang 2005 A hierarchical phrase-based model for statistical machine ... city of Niigata The Health and Welfare Ministry in that the Japanese people in the village are made law The Health and Welfare Ministry decided to apply the Disaster Relief Law to the village ... Hideto Kazawa and Jun Suzuki, for useful discussions on the hierarchical phrase-based translation Franz Josef Och 2003 Minimum error rate training in statistical machine translation In Proc of ACL...
- 8
- 232
- 0
Báo cáo khoa học: "DETERMINISTIC LEFT TO RIGHT PARSING OF TREE ADJOINING LANGUAGES*" ppt
... EPDA apart from noting that the moves of the two machines are dual of each other LR Parsing Algorithm An LR parser consists of an input, an output, a sequence of stacks, a driver program, and a ... and GOTOfoo, take a state i and an auxiliary tree # and produce a state j An example of a parsing table for a grammar generating L = {anbnecndnln > 0} is given in Figure We denote an instantaneous ... sequence of pushdowns captures the generalization of the nature of the derived trees of a CFG to the nature of derived trees of a TAG From Thatcher (1971), we can observe that the path set of a CFG...
- 8
- 218
- 0
From business strategy to IT action right decisions for a better bottom line
... asking the question forces a rearticulation of the strategies, in terms that are actionable by line management IT is then able to understand more fully what management is intending and what actions ... be articulated throughout the company The issue for management is to identify and understand that constraint, and allocate IT resources within that number to the best and highest-impact activities ... centers and telecommunications operations ix x ABOUT THE AUTHORS Bill Walton is a Principal with The Beta Group His areas of special interest and expertise include Performance Measurement, Alignment,...
- 354
- 577
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose