anchoring of metal complexes or their ligands at an organic macromolecule
Handbook of Polymer Synthesis Second Edition Episode 11 pptx
... incorporation of different kinds of metal complexes or metal chelates in linear or crosslinked organic or inorganic macromolecules The formation and stabilization of metal and semiconductor cluster ... A Anchoring of Metal Complexes or their Ligands at an Organic Macromolecule General Considerations A macromolecular ligand principally can interact with a metal compound MXn by covalent, coordinative, ... surface of an organic polymer or an macromolecular inorganic carrier Anchoring of metal complexes exhibit the advantage of higher reaction rates for reactions at the metal complex centers and the easiness...
- 77
- 495
- 1
Báo cáo khoa học: Amino acid residues on the surface of soybean 4-kDa peptide involved in the interaction with its binding protein potx
... value of the 4-kDa peptide variant to the Kd value of the wild-type 4-kDa peptide Of the 19 alanine Table Association rate constants (ka), dissociation rate constants (kd) and dissociation constants ... was incubated on an orbital shaker, at a slow setting, for 10 at room temperature In the soluble fraction, cell debris was removed by centrifugation at 48 000 g for 15 at °C The supernatant was ... ratio of dissociation of the variant to that of the wild-type The amino acids mutated to alanine are designated by a single-letter code variants, 13 caused a significant impairment in binding of...
- 10
- 420
- 0
Báo cáo khóa học: CD38 is expressed as noncovalently associated homodimers on the surface of murine B lymphocytes doc
... p42 and p95 for their pattern of isoelectric points by IEF and 2D polyacrylamide gel electrophoresis For p42 we observed two dominant isoelectric points of 7.7 and 7.2 and two minor points at ... NP-40 (lanes 1, 2, and 6) or Chaps (lanes 3, 4, and 8) and CD38 was immunoprecipitated The samples were heated in the presence (lanes 5–8) or absence (lanes 1–4) of 5% (v/v) 2-mercaptoethanol and ... NP-40 (lane 1), Triton X-100 (lanes and 3), digitonin (lanes and 5), Chaps (lanes and 7) or deoxy-BigChap (lanes and 9) Lysates were immunoprecipitated with antibody to CD38 (NIM-R5) and CD38...
- 10
- 448
- 0
báo cáo hóa học:" Unsaturated phosphatidylcholines lining on the surface of cartilage and its possible physiological roles" potx
... POPC and SLPC require one saturated fatty acid, either palmitic or stearic acid, and one unsaturated fatty acid, either linoleic or oleic acid In the case of DLPC it requires two unsaturated fatty ... acquisition of funding RWC contributes to the analysis and interpretation of data, drafting the manuscript and acquisition of funding AO contributes to the analysis and interpretation of data, drafting ... about 39% and the majority of fatty acids were unsaturated fatty acids (61%) As two fatty acids are needed to form an intact SPC or USPC molecule, DPPC requires two saturated fatty acids, ie palmitic...
- 6
- 432
- 0
Báo cáo toán học: " Spin-related tunneling through a nanostructured electric-magnetic barrier on the surface of a topological insulator" potx
... that the in-plane spin orientation of the transmitted and the reflected electrons can be rotated over certain angles that are determined by the incident angle and energy Our results demonstrate ... shown above can be examined by the measurable quantities, the conductance G, and Fano factor F [20, 21] The ballistic conductance and Fano factor for a given Fermi energy at zero temperature are ... perfect transmission region, and provides us with an additional way to control the transmission and the spin orientation of the transmitted and reflected electrons The transmission feature shown...
- 18
- 404
- 0
Báo cáo lâm nghiệp: "Interactions of ozone and pathogens on the surface structure of Norway spruce needle" potx
... epistomatal chambers Tubular wax covering the stomata was more often flat and solid under ozone exposure with concentrations higher than 200 !g The change was observable at the edges of the stomata ... erosion-promoting effect of the fungal pathogens was observed to be faster and much more dramatic than that caused by air pollutants Needles fumigated with ambient air and 100 f of were the most infected, ... both natural and that caused by air pollution, probably increases cuticular transpiration (Cape and Fowler, 1981) and accelerates winter desiccation and needle shedding (Lewitt, 1980; Huttunen and...
- 4
- 263
- 0
Báo cáo y học: "Identification of bacteria on the surface of clinically infected and non-infected prosthetic hip joints removed during revision arthroplasties by 16S rRNA gene sequencing and by microbiological culture" doc
... at 94°C for minutes, followed by 35 cycles of denaturation at 94°C for minute, annealing at 58°C for minute and extension at 72°C for 1.5 minutes, and finally an extension step at 72°C for 10 minutes ... agar and CY-agar plates Columbia blood agar plates were incubated in 5% CO2 at 37°C, and FAA plates were incubated at 37°C in an anaerobic chamber with an atmosphere of 85% N2, 10% CO2 and 5% ... use of the following cycling parameters: an initial denaturation step at 92°C for minutes, followed by 30 cycles of denaturation at 94°C for 30 seconds, annealing at 52°C for 30 seconds and extension...
- 11
- 491
- 0
Báo cáo y học: " HIV-1 neutralization by monoclonal antibody against conserved region 2 and patterns of epitope exposure on the surface of native viruses" pot
... Acknowledgements We thank Dr Susan Zolla-Pazner, Dr Hermann Katinger, National Institute for Biological Standards and Control (NIBSC), and National HIV Repository and Bioinformatic Center (Thailand) for providing ... culture) for h at 37°C After washing steps, 100 μl of HRP-conjugated goat-anti mouse IgG (Invitrogen, USA) was added and the plates were allowed to incubate for h at 37°C Then, 100 μl of TMB substrate ... with normal saline or that of fresh culture medium Immunization and monoclonal antibody production Six to eight week old female BALB/c mice (from National Laboratory Animal Center, Thailand) were...
- 8
- 445
- 0
Báo cáo y học: "HLA-DR regulation and the influence of GM-CSF on transcription, surface expression and shedding
... Administration of recombinant human granulocyte-macrophage colony- stimulating factor after chemotherapy regulates the expression and secretion of monocyte tumor necrosis factor (TNF) and TNF receptors ... demonstrated that an up-regulation of HLADR mRNA was observed from hours culture and at time points 4, and hours Transcriptional regulation of HLA-DR by IFN-γ has previously been reported [10] and ... study indicates that GM-CSF is also able to regulate HLA-DR at the level of transcription To investigate whether a post-translational modification was a mechanism involved in the regulation of HLA-DR,...
- 11
- 618
- 0
Effect of urban emissions on the horizontal distribution of metal concentration in sediments in the vicinity of Asian large cities
... distribution of copper and that of nickel made it difficult to simply correlate their concentrations with the human activities in Metro Manila Lower concentrations of lead and zinc were observed for the ... Juan River (Station SJ), which collects untreated wastewater and urban storm water runoff, contained high concentrations of lead and zinc Table summarizes the results of all the target metals in ... This study shows that the sediments of streams that receive untreated wastewater contained higher concentrations of lead and zinc The data on the metal concentration of wastewater in the Philippines...
- 11
- 440
- 0
Tài liệu Báo cáo khoa học: Binding of ligands originates small perturbations on the microscopic thermodynamic properties of a multicentre redox protein pptx
... The authors are grateful to Professor A.V Xavier, for many fruitful suggestions and discussions, and to Professor Helena Santos for kindly providing the Zn-rubredoxin The assistance of Isabel ... anthraquinone-2-7-disulfonate, anthraquinone2-sulfonate, safranine O, diquat, neutral red, phenosafranine, and methylviologen, all at a ratio of 100 : of cytochrome vs mediator to avoid interference ... the dramatic difference in size, and in agreement with previous comparative work of binding inorganic and protein partners to cytochromes c3 [6] Table shows that as for the case of phosphate binding,...
- 10
- 640
- 0
Tài liệu Báo cáo khoa học: Coordination chemistry of iron(III)±porphyrin±antibody complexes In¯uence on the peroxidase activity of the axial coordination of an imidazole on the iron atom ppt
... the antibody and particularly to appreciate the size of the cavity left around the iron atom and which kind of ligands it can accommodate; second, to measure the in¯uence of an axial ligand of ... 2), that even the formation of the mono-imidazole complex of 13G10±Fe(ToCPP) is more dif®cult than the formation of the bis-imidazole complex of Fe(ToCPP) A likely explanation for this is that one ... suggested for those two complexes as: (a) their spectra of absorption were similar to those previously reported for (porphyrin)Fe±CN and [(porphyrin)Fe(CN)2]± complexes [49], their maxima of absorption...
- 11
- 470
- 0
Báo cáo khoa học: Protein–protein interactions and selection: generation of molecule-binding proteins on the basis of tertiary structural information potx
... selection of high-affinity antibodies [39]: one Fab had high affinity for human VEGF (Kd = 60 nm) X-ray structural analysis of the complex of another Fab and human death receptor confirmed the importance ... equilibrium dissociation constant (Kd) of 0.25 nm, comparable to that of vitronectin This result implies that the library approach is important for the design of edge sequences neighboring to the grafted ... loop generated the VHH fragments with high affinity for specific inorganic material surfaces [32] The combination of grafting and local library methods might also be suitable for generating specific...
- 9
- 505
- 0
Báo cáo khoa học: Structure of Streptococcus agalactiae serine⁄threonine phosphatase The subdomain conformation is coupled to the binding of a third metal ion pptx
... the question of whether the difference in conformation of the flap domain is related to binding of the third metal ion or the substrate The ligands for Mn3 in MtSTP were Asp118, Asp191 and Ser160, ... and STPs), and their complexes with their downstream targets, which in S agalactiae include the response regulator CovR, adenylosuccinate synthase and a family II inorganic pyrophosphatase (SaPPase) ... roughness of the analysis is taken into account SaSTP has been shown to dephosphorylate three different substrates These are a family II inorganic pyrophosphatase, a response regulator CovR, and a...
- 10
- 542
- 0
Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx
... reduction [6,8] Although the importance of bacterial dissimilatory metal reduction in controlling the fate and transport of metals and their potential for remediation purposes are well recognized, ... mm fumarate as the electron acceptor) were washed with and suspended in an equal volume of air-saturated NaCl ⁄ Pi (pH 7.5), and incubated at room temperature for h to ensure oxidation of the ... overnight cultures of MR-1R (lane 1), and mutants omcA– (lane 2), omcB– (lane 3), and omcA– omcB– (lane 4) A molecular mass standard is indicated at the left (D) Bar graph representation of the cytochrome...
- 11
- 731
- 0
Báo cáo khoa học: Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding site on the catalytic domain doc
... GLU H447A forward (5¢- GCAAGTCATTT TGGATGCTATTAATGATGATGGCTC-3¢), GLU H447A reverse (5¢- GAGCCATCATCATTAATAGCATCCAAAA TGACTTGC-3¢); GLU T462A forward (5¢- GAACAACTT AACAGATATGCCGGTTATTCCACCGGTGCC-3¢), ... and Rfree factors (the Cruickshank’s dispersion precision indicator DPI [19], and the average temperature factors for protein atoms, water molecules and ligands are given in Table The temperature ... (B) of Glu Lanes 1,6, wt enzyme; lanes 2,7, mutant R15A; lanes 3,8, mutant H447A; lanes 4,9, double mutant H447A, D450A; lanes 5,10 mutant T462A mutant glucoamylases demonstrate that mutations of...
- 11
- 548
- 0
Báo cáo Y học: Membrane embedded location of Na+ or H+ binding sites on the rotor ring of F1F0 ATP synthases ppt
... accepted that subunit a and the oligomeric cn rotor ring of F1F0 ATP synthases form the membrane embedded complex responsible for coupling ion transport across the membrane and that this transport requires ... accessibility of these sites and their location within the membrane The results of Fig show the inactivation kinetics of the I tartaricus ATPase by DCCD or PCD With DCCD more than 90% of the activity ... lg of POPC and lg of I tartaricus ATP synthase were diluted into 300 lL of 50 mM potassium phosphate, pH 7.0, mM MgCl2 and 100 mM K2SO4 and used for a single measurement For titration of uorescence...
- 9
- 439
- 0
Báo cáo khoa học: ATP-binding domain of heat shock protein 70 is essential for its effects on the inhibition of the release of the second mitochondria-derived activator of caspase and apoptosis in C2C12 cells potx
... McClean, VA, USA) The attenuance of formazan formed in control cells was considered as 100% viability Statistical analysis Data are expressed as the mean ± SEM of the indicated number of separate ... RG (2005) Antiapoptotic and anti-inflammatory mechanisms of heat-shock protein protection Ann N Y Acad Sci 1053, 74–83 34 Liang P, Jiang B, Yang X, Xiao X, Huang X, Long J, Zhang P, Zhang M, Xiao ... Kim R (2005) Recent advances in understanding the cell death pathways activated by anticancer therapy Cancer 103, 1551–1560 31 Scorrano L & Korsmeyer SJ (2003) Mechanisms of cytochrome c release...
- 10
- 726
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng 9 tr 25